Cyanidin prevents the hyperproliferative potential of fibroblast-like synoviocytes and disease progression via targeting IL-17A cytokine signalling in rheumatoid arthritis

Journal Pre-proof Cyanidin prevents the hyperproliferative potential of fibroblastlike synoviocytes and disease progression via targeting IL-17A cytokine signalling in rheumatoid arthritis

Snigdha Samarpita, Ramamoorthi Ganesan, Mahaboobkhan Rasool PII:

S0041-008X(20)30041-7

DOI:

https://doi.org/10.1016/j.taap.2020.114917

Reference:

YTAAP 114917

To appear in:

Toxicology and Applied Pharmacology

Received date:

24 September 2019

Revised date:

31 January 2020

Accepted date:

6 February 2020

Please cite this article as: S. Samarpita, R. Ganesan and M. Rasool, Cyanidin prevents the hyperproliferative potential of fibroblast-like synoviocytes and disease progression via targeting IL-17A cytokine signalling in rheumatoid arthritis, Toxicology and Applied Pharmacology (2019), https://doi.org/10.1016/j.taap.2020.114917

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Cyanidin prevents the hyperproliferative potential of fibroblast-like synoviocytes and disease progression via targeting IL-17A cytokine signalling in rheumatoid arthritis Snigdha Samarpita1 , Ramamoorthi Ganesan2 , Mahaboobkhan Rasool1*

1

Immunopathology Lab, School of Biosciences and Technology, Vellore Institute of

Immunology Program, Department of Clinical Science, H. Lee Moffitt Cancer Center,

oo

2

f

Technology (VIT), Vellore - 632 014, Tamil Nadu, India.

Dr. M. Rasool

Jo u

*Corresponding author

rn

al

Pr

e-

pr

Tampa, Florida 33612, United States.

SMV 240, Immunopathology Lab School of Biosciences and Technology Vellore Institute of Technology (VIT) Vellore - 632 014, India Mobile: +91 9629795044 Email: [email protected]

1

Journal Pre-proof Abstract The hyperplastic phenotype of fibroblast-like synoviocytes (FLSs) plays an important role for synovitis, chronic inflammation and joint destruction in rheumatoid arthritis (RA). Interleukin 17A (IL-17A), a signature pro-inflammatory cytokine effectively influences the hyperplastic transformation of FLS cells and synovial pannus growth. IL-17A cytokine signalling participates in RA pathology by regulating an array of pro-inflammatory mediators and

f

osteoclastogenesis. Cyanidin, a key flavonoid inhibits IL-17A/IL-17 receptor A (IL-17RA)

oo

interaction and alleviates progression and disease severity of psoriasis and asthma. However,

pr

the therapeutic efficacy of cyanidin on IL-17A cytokine signalling in RA remains unknown. In the present study, cyanidin inhibited IL-17A induced migratory and proliferative capacity

e-

of FLS cells derived from adjuvant-induced arthritis (AA) rats. Cyanidin treatment reduced

Pr

IL-17A mediated reprogramming of AA-FLS cells to overexpress IL-17RA. In addition, significantly decreased expression of IL-17A dependent cyr61, IL-23, GM-CSF, and TLR3

al

were observed in AA-FLS cells in response to cyanidin. At the molecular level, cyanidin

rn

modulated IL-17/IL-17RA dependent JAK/STAT-3 signalling in AA-FLS cells. Importantly,

Jo u

cyanidin activated PIAS3 protein to suppress STAT-3 specific transcriptional activation in AA-FLS cells. Cyanidin treatment to AA rats attenuated clinical symptoms, synovial pannus growth, immune cell infiltration, and bone erosion. Cyanidin reduced serum level of IL-23 and GM-CSF and expression of Cyr 61 and TLR3 in the synovial tissue of AA rats. Notably, the level of p-STAT-3 protein was significantly decreased in the synovial tissue of AA rats treated with cyanidin. This study provides the first evidence that cyanidin can be used as IL17/17RA signalling targeting therapeutic drug for the treatment of RA and this need to be investigated in RA patients. Keywords:

rheumatoid

arthritis,

interleukin-17A,

fibroblast-like

synoviocytes,

hyperplastic synovium, cyanidin 2

Journal Pre-proof 1. Introduction Rheumatoid arthritis (RA) is an autoimmune disease of joints. Pathogenesis includes penetration of various inflammatory immune cells into the synovial compartment which triggers inflammation, neoangiogenesis, synovitis, resulting in adjacent cartilage and joint destruction [1]. Fibroblast-like synoviocytes (FLSs) are a key component of synovitis, play an intermediary role in cartilage and joint destruction [2]. After acquiring a hyperplastic

f

phenotype, FLS secrets a broad array of mediators that promotes resistance to apoptosis

oo

activation and chemotaxis of immune cells and angiogenesis [3]. In addition, FLS cells also

pr

produce adhesion molecules and matrix-metalloproteases (MMPs) to directly breakdown the extracellular matrix of cartilage [4]. Previous studies have revealed that inflammatory

e-

cytokines trigger the onset and progression of the RA disease. The targeted humanized

Pr

monoclonal antibodies directed against tumor necrosis factor α (TNF-α) and the interleukin‐ 6 receptor (IL‐ 6R) demonstrated clinically effective in a subset of patients, including that

al

developed resistance to disease-modifying antirheumatic drugs (DMARDs) [5, 6]. However,

rn

ceiling effect, resistance, and loss of therapy responsiveness in half of the patients remain a

therapies.

Jo u

major challenge [7,8]. This suggests the urgent need for the development of more effective

Among the various immune cells migrated into the synovium, T helper 17 (Th17) cells, a subset of CD4 T cells are critically linked in the pathogenic events of RA [9]. The signature cytokine interleukin (IL) 17A secreted from Th17 cells act on FLS cells to induce hyperplastic transformation and convert quiescent to aggressive cells [10]. Mast cells have also been reported to play a role in RA pathogenesis via the production of IL-17A [11]. Elevated levels of IL-17A in serum and synovial fluid of RA patients have been associated with severe clinical outcomes [12]. Suppression of collagen-induced arthritis (CIA) with reduced inflammation, synovitis and joint destruction in mice deficient with IL-17A further 3

Journal Pre-proof supports its critical role in RA pathogenesis [13]. IL-17A also induce RANKL expression which leads to

osteoclast differentiation and

amplifies bone erosion [14]. IL-17A

synergistically interacts with TNF-α to promote activation of FLS, resulting in the secretion of various pro-inflammatory cytokines [15]. Due to these eminent roles of IL-17A in RA pathogenesis, this cytokine is currently being targeted in clinical trials. IL-17A mediates its function via binding to cell surface receptor IL-17 receptor subunit A

f

(IL-17RA). We have recently shown that IL-17/IL-17RA cytokine signalling triggers signal

oo

transducer and activator of transcription 3 (STAT-3) dependent expression of cysteine-rich

pr

angiogenic inducer 61 (cyr61), granulocyte-macrophage colony-stimulating factor (GMCSF), toll-like receptor 3 (TLR3) and IL 23 in RA-FLS cells [16]. Cyr61 known to exert its

e-

pathogenic effects via stimulating higher production of IL-6 from RA-FLS cells [17].

Pr

Activation of TLR3 by its ligands provokes nuclear factor kappa B (NF-κB) signalling mediated pro-inflammatory cytokines secretion and facilitates inflammation in RA [18]. GM-

al

CSF is another cytokine that specifically activates macrophages, leading to inflammation. In

rn

addition, GM-CSF also synergizes with IL-17A and increases synovial IL-6 and IL-23 levels

Jo u

in RA [19]. IL-17A-IL-23 axis shown to have a critical role in RA. IL-23 cytokine is required for the stabilization of functionally active Th17 cells [20]. In addition, Th17 cells can utilize IL-23/IL23R signalling to expand, which maintains chronic inflammation [21]. Various preclinical studies have shown that neutralization of IL17A or IL23 cytokine alleviated symptoms and protected bone damage in RA [22].

Collectively, targeting IL-17A/IL-17R

signalling can be more beneficial in reducing IL-17A cytokine-mediated pathogenic effects in RA. Various IL-17A cytokine signaling targeting antibodies, including the anti-IL17A humanized

monoclonal antibodies

secukinumab

and ixekizumab and the anti-IL17RA

monoclonal antibody brodalumab have been investigated in clinical trials [23]. Although inhibiting IL-17A action in RA highlighted the importance of reducing synovitis and joint 4

Journal Pre-proof destruction, IL7A ligand blockade may open a new window for various opportunistic infections [24]. Cyanidin (Fig. 1A) is a naturally occurring red anthocyanin that belongs to the flavonoid family and is primarily found in berries, red cabbages, black currant, purple rice bran and other fruits [25]. Cyanidin has been shown to exhibit beneficial effects in various human diseases including cancers, diabetes, obesity, and inflammation [25]. Cyanidin has received

anti-inflammatory,

anti-thrombogenic,

anti-viral,

chemopreventive

oo

antioxidant,

f

greater attention following the discovery of its various pharmacological properties such as and

anti-

pr

osteoporotic properties [26]. Importantly, a recent study demonstrated that cyanidin act as a competitive small molecule inhibitor that recognizes IL-17A binding site in IL-17RA and

e-

blocks IL-17A/IL-17RA interaction [27]. Further showed attenuation of psoriasis and asthma

Pr

progression after cyanidin mediated blockade of IL-17A cytokine signalling in preclinical murine models [27]. Another important study has identified that cyanidin inhibits osteoclast from osteoclast

precursor

al

differentiation

cells and

induces osteoclast formation via

rn

modulating RANK-RANKL signalling [25]. Cyanidin can also interfere with IL-6 mediated

Jo u

STAT-3 signalling activation [28]. Although, the therapeutic benefits of cyanidin has been studies previously against psoriasis and asthma, to date, to the best of our knowledge, there is no mechanistic evidence are available for the anti-arthritic effect of cyanidin on IL-17A cytokine signalling mediated pathogenesis of FLS cells in RA. The current study was aimed to uncover the therapeutic effect of cyanidin, and its underlying molecular mechanism on inhibiting IL-17A cytokine activated FLS cells in RA. 2. Materials and Methods 2.1. Reagents

5

Journal Pre-proof Cyanidin chloride was purchased from Sigma-Aldrich (St. Louis, MO, USA). Recombinant murine IL-17A was obtained from PeproTech (Rocky Hill, NJ) and the STAT-3 inhibitor S3I-201 was purchased from MedChem Express (NJ, USA). DMEM (Dulbecco’s Modified Eagle’s Medium), FBS (Fetal bovine serum), BSA (Bovine serum albumin), antibioticantimycotic solution and type II collagenase were purchased from Sigma-Aldrich (St. Louis, USA). Primary antibodies targeting STAT-3, p-STAT-3, JAK-1, p-JAK-1, JAK-3, p-JAK-3, β-actin and fluorescein isothiocyanate (FITC) conjugated secondary antibody were purchased

oo

f

from Cell Signalling Technology (Beverly, MA). Anti-Cyr61, anti-IL-23, anti-TLR3, and anti-GM-CSF antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

pr

Anti-IL-17RA, anti-PIAS-3, anti-PCNA, and HRP conjugated anti-mouse and anti-rabbit

e-

secondary antibody were purchased from ABclonal (MA, USA). Anti- BrdU antibody was

Pr

purchased from R&D Systems (Minneapolis, USA). FITC coupled CD 90.2 monoclonal antibody was obtained from Biolegend (San Diego, CA, USA). ELISA kits to detect IL-23

al

and GM-CSF were purchased from PeproTech (NJ, USA). All other chemicals and reagents

Jo u

2.2. Experimental animals

rn

for the study were purchased from commercial sources and were of analytical grade.

Wistar albino rats (150-180 g. b. wt.) were procured from the animal house facility of Vellore Institute of Technology (VIT), Vellore, India to investigate the anti-arthritic effects of cyanidin chloride. Prior to the experiments, the animals were made acclimatized to conventional housing conditions. Rats were fed with standard rodent diet and water ad libitum. All experimental procedures were conformed to the norms of the Committee for the Purpose of Control and Supervision on Experiments on Animals (CPCSEA), India, and was certified by the Institutional Animal Ethical Committee (IAEC).

6

Journal Pre-proof 2.3. Isolation and primary culture of FLS Adjuvant induced arthritis (AA) was induced as previously reported [29]. In brief, experimental rats were injected intradermally with complete Freud’s adjuvant (CFA) (heatkilled Mycobacterium tuberculosis suspended in sterile paraffin oil at a concentration of 10 mg/ml) (Sigma-Aldrich, St. Louis, USA) into the right footpad. The progress of arthritis severity was observed periodically. On day 19, AA-FLS cells were obtained from freshly

f

collected synovial tissues by enzymatic digestion with 0.4% type II collagenase in DMEM

oo

supplemented with 5% FBS with gentle agitation at 37 ˚C for 4 h. Single-cell suspensions

pr

were cultured in DMEM containing 10% FBS and antibiotics (100U/ml penicillin and 100μg/ml streptomycin) at 37°C with 5% CO 2 and left for cells to adhere. The culture

e-

medium containing non-adherent cells was removed and attached cells were then grown

Pr

continuously until reaches about 90% confluence. Cells were then collected by incubation with trypsin-EDTA solution and further cultured under the same culturing conditions.

Jo u

2.4. Purity analysis of FLS

rn

al

Isolated AA-FLS cells between 4 to 9 passages were used for further experiments.

The isolated FLS cells were analyzed for purity and phenotype using flow cytometry. FLS cells were detached and washed with ice-cold FACS buffer. The cells were then resuspended with FACS buffer containing FITC conjugated CD 90.2 monoclonal antibody (10 µg/ml) for 30 min at 4˚C. The purity analysis was performed using a FACS Calibur system (BD Biosciences, New Jersey, USA). The flow cytometry analysis results showed that nearly 87% of isolated cells were stained positive for FLS cell surface marker CD90.2 and 99% for CD55 marker (Fig. 1B).

7

Journal Pre-proof 2.5. MTT cell viability assay AA-FLS cells were seeded in 96-well tissue culture plate at a density of 3000 cells per well for 24 h. Following attachment, cells were treated with increasing concentration of cyanidin chloride (2.5 – 100 µM) for 24 h. MTT, 3-(4,5-Dimethylthiazolyl)-2,5-diphenyltetrazolium bromide (Sigma, USA) reagent (5mg/ml in PBS) was added to each well and incubated for 4 hours. At the end of incubation, 100 µl of DMSO was added for the solubilization of

f

formazan crystals. The color developed was read at an absorbance of 570 nm. The number of

oo

viable cells per tested concentration of the drug was expressed as values in percentage

pr

compared to the control value of 100%.

e-

2.6. Cell culture and treatment

Pr

FLSs isolated from normal and AA rats were maintained in DMEM medium supplemented with FBS (10%) and antibiotic-antimycotic solution (1%). The cultured FLS cells were

al

incubated in a humidified atmosphere with 5% C02 and at a temperature of 37°C. Upon

rn

attachment, the AA-FLS were pre-treated or left untreated with increasing concentration of

Jo u

cyanidin (5, 7.5 and 10 µM) or S3I-201 (50 µM) for 24 h, followed by stimulation with/without IL-17 (10 ng/ml) for next 24 h unless otherwise stated. Normal FLS cultured in complete DMEM medium were considered as a negative control. 2.7. Colony formation assay AA-FLS cell proliferation was determined using the colony formation assay. Cells were seeded and cultured for 24 hours. Upon establishment, cells were pre-treated or left untreated with the tested concentration of cyanidin, or S3I-201 (50 µM) and then stimulated with/without IL-17 (10 ng/ml) for 24 hours. Then, cells were trypsinized and reseeded at 300 cells/ 35 mm dish and allowed to grow to form colonies for 2 weeks at 37 ˚C and 5% CO 2. The colonies formed were fixed with methanol and stained with crystal violet (10 g/L; Fisher 8

Journal Pre-proof Scientific, Fair Lawn, NJ, USA). Images were photographed using an inverted microscope (Olympus, Tokyo, Japan) in magnification 20× and the number of colonies formed was counted and quantified. Following treatment, protein lysates were prepared and analyzed for the protein expression of proliferating cell nuclear antigen (PCNA) by western blot as described in section 2.9. 2.8. Cell migration assay

oo

f

A wound-healing assay was performed to determine the migration rate of AA-FLSs. Cells were seeded on the six-well plate and cultured until confluence. Next, a sterile P200 pipette

pr

tip was used to create a parallel wound by scratching at the center of each well. The wells

e-

were then washed with PBS to remove the floating cells and incubated with serum-free

Pr

DMEM in the presence or absence of cyanidin chloride, or S3I-201(50 µM) before stimulation with/without IL-17 (10 ng/ml). The extent of the wound closure was imaged

al

using an inverted microscope (Olympus, Tokyo, Japan) at magnification 20 X. The number

rn

of cells migrated in three different fields per group was counted to assess the cell migration

Jo u

rate. 2.9. Western blot analysis

Total protein was extracted using RIPA lysis buffer (Sigma, USA) and the concentration was determined by the Bradford method (Bio-rad, Hercules, CA, USA). Immunoblotting was performed with a previously described protocol [30]. In brief, an equal amount of protein lysates (30 µg each lane) was resolved in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred onto polyvinylidene difluoride (PVDF) membranes (Amersham Pharmacia Biotech, Uppsala, Sweden). The membranes were then blocked overnight at 4˚C with 5% BSA in tris-buffered saline tween-20 (TBST) and then subsequently incubated with primary antibodies against JAK-1, p-JAK-1, JAK-3, p-JAK-3, 9

Journal Pre-proof Cyr61, IL-23, and GM-CSF for overnight at 4˚C. Finally, the membranes were probed with HRP-labelled anti-mouse or anti-rabbit secondary antibodies (Cell Signalling Technology, Beverly, MA) for 2 h at room temperature.

The protein bands were developed using an

enhanced chemiluminescence solution (Millipore, USA) and visualized with autoradiography film. β-actin was used as a loading control and the relative expression of each protein was calculated with ImageJ software version 1.48 (Wayne Rasband, NIH, Maryland U.S.).

oo

f

2.10. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted using TRIzol reagent (Sigma-Aldrich, St. Louis, USA) according to

pr

manufacturer’s instructions and transcribed into cDNA using reverse transcription 326 cDNA

e-

kit (Applied Biosystems, CA, USA). qRT-PCR was carried out on converted cDNA using

Pr

EvaGreen Supermix PCR kit (Bio-Rad, Hercules, CA, USA) on C1000 Touch thermal cycler (Bio-Rad, Hercules, CA). Previously published primer pair sequences for cyr61, IL-23, GM-

al

CSF, TLR-3, and IL-17RA genes were used in this study [31]. The primer pair sequences

rn

were shown in table 1. PCR amplification was performed using cycling parameters as follows: 95 °C for 15 min, 94 °C for 15 s, 40 cycles of 60 °C for 30 s, and 72 °C for 30 s.

Jo u

qRT-PCR was performed in triplicates for each sample and the relative expression level of target genes was normalized to GAPDH using the 2- ΔΔCt method [31]. 2.11. Cell transfection

AA-FLS cells were transfected with small interfering RNA (siRNA) to alter the expression of IL-17RA. The siRNA targeting IL-17RA and negative control siRNA were obtained from RiboBio (Guangzhou, China). Gene knockdown experiment was conducted as earlier reported [31]. In brief, AA-FLS cells were transfected with a transfection mixture of siRNA (5nM) oligonucleotides using Xfect RNA transfection reagent (Clontech, CA, USA) in serum-free medium for four hours. Next, cells were cultured with complete DMEM medium 10

Journal Pre-proof containing 10% FBS for 48 hours. At the end of incubation, cells were pre-treated /left untreated with cyanidin chloride, or DMSO and followed by stimulation with or without IL17A (10ng/ml), or S3I-201(50 µM). The expression of IL-17RA was analyzed using flow cytometry, qRT-PCR, and western blotting. Expression levels of cyr61, IL-23, GM-CSF, and TLR -3 were also quantified using western blotting analysis. 2.12. Flow cytometry analysis

oo

f

Following treatment completion, AA-FLS cells were detached, washed with PBS and stained with a primary antibody targeting IL-17RA (antibody dilution 1: 500) and TLR-3 (antibody

pr

dilution 1: 200) prepared in FACS buffer. Next, the cells were incubated with FITC

e-

conjugated secondary antibody. Flow cytometry was performed on FACS Calibur flow

Pr

cytometer (BD Biosciences, Mansfield, MA, USA) 2.13. Immunofluorescence staining analysis

al

AA-FLS were cultured on gelatin-coated glass coverslips in a 6-well tissue culture plate. For

rn

bromodeoxyuridine (BrdU) staining, cells were incubated with 10 µM BrdU (R&D Systems).

Jo u

Following fixation with paraformaldehyde (4%), cells were permeabilized in 0.2% Triton X100 for 5 min and blocked in 5% BSA for 30 min at room temperature. The coverslips were incubated with primary anti-BrdU, anti-STAT-3, anti-p-STAT-3, anti-PIAS-3 antibodies for overnight at 4˚C, and then incubated with FITC and Alexa Fluor conjugated secondary antibody (Cell Signalling Technology, Beverly, MA) for 2 h. It was then counterstained with 4′6-diamindino-2-phenylindole (DAPI; 1µg/ml) (Sigma-Aldrich, St Louis, MO, USA) for 5 min and images were captured using fluorescence microscopy (Olympus America, Melville, NY, USA). 2.14. Adjuvant-induced arthritis and administration

11

Journal Pre-proof Experimental rats were injected intradermally with complete Freud’s adjuvant (CFA) into the right hind paw. On day 11, adjuvant-induced arthritis (AA) rats were randomized into two groups (n=6 per group): (group 2) AA rats; without treatment and (group 3) AA rats with cyanidin treatment. Cyanidin chloride (1 mg/kg b. wt.) was prepared with 0.1% DMSO solution in PBS and administered intraperitoneally from days 11 to 21. The specified concentration of cyanidin was selected as described previously [27] and based on our preliminary dose titration experiment. A vehicle control group received 0.1% DMSO in

oo

f

parallel until the end of the treatment period. In addition, the naive rats were also treated with cyanidin chloride (1 mg/kg b. wt.). The in vivo treatment schema for the experimental rats

ePr

2.15. Clinical evaluation of arthritis

pr

was shown in Fig 6A.

The disease progression of adjuvant-injected arthritis (AA) in the experimental rats was rated

al

by a blinded observer. From day 0 of CFA injection, the rats were observed every 3 days for

rn

paw edema, and changes in body weight. Arthritis scores were assessed on a macroscopic scale of 0-4: grade 0 (no edema or any visual changes) grade 1 (slight edema and limited

Jo u

erythema) grade 2 (light edema and erythema) grade 3 (obvious edema and significant erythema) grade 4 (severe edema and extensive erythema). One day prior to sacrifice, radiographs of rat hind limbs were obtained to examine the status of joint structural changes. The radiograph images were digitalized using MBR-1505R (Hitachi Medical Corporation, Japan) with a 0.5 mm focal spot and processed using X-ray film (Kodak Diagnostic Film) placed 60 cm below the X-ray source operated at 5 mA and 40 kV, and exposed for about 1 s. Radiographic scores were confirmed by independent observers on the basis of joint structural changes such as joint space, soft tissue volume, and degenerative joint changes. 2.16. Histopathological and immunohistochemical assessment

12

Journal Pre-proof Hind limbs were excised from the sacrificed rats on day 21. Immediately, the tissues were fixed in 10% paraformaldehyde and decalcified in 10% EDTA before embedding in paraffin. Tissue sections (5 µm) were stained with hematoxylin and eosin and observed under an Olympus inverted microscope (Tokyo, Japan). Further, paraffin-embedded sections were deparaffinized with two changes of xylene (5 min each) for immunohistochemical staining. Deparaffinized tissue section (5µm) slides were dehydrated using graded alcohol series with increasing concentration and incubated in 0.3% hydrogen peroxide (prepared in 60%

f

For antigen retrieval, the sections

oo

methanol) for quenching endogenous peroxidase activity.

were incubated in a beaker containing retrieval solution placed in the water bath at 92 °C for

pr

20 min. After blocking in 5 %BSA a room temperature of 1 hr, the slides were stained

e-

overnight with mouse monoclonal anti-p-STAT-3, anti-Cyr 61, anti-TLR-3 antibodies

tetrahydrochloride

After

washing,

(DAB)

slides

were

(Sigma-Aldrich).

al

temperature.

Pr

followed by incubation with HRP-conjugated mouse secondary antibody for 2 hr at room incubated

with

3,3’

-diaminobenzidine

Slides were counter-stained

with Mayer’s

rn

hematoxylin solution, dehydrated, and mounted with Dibutylphthalate polystyrene xylene

Jo u

(DPX) (Sigma-Aldrich). All images were photographed using an Olympus photomicroscope (Tokyo, Japan) at 40x magnification. Staining intensity was evaluated by experienced pathologists on a scale of 1-4 (0 = absent, 1 = weak, 2 = moderate, 3 = high, and 4 = very high) in a blinded manner [32]. 2.17. ELISA The level of pro-inflammatory cytokines such as IL-23 and GM-CSF in the serum of experimental rats was quantified using murine specific ELISA kits according to the manufacturer’s protocol (Peprotech). 2.18. Statistical Analysis

13

Journal Pre-proof Data were expressed as mean ± SEM from three independent experiments and evaluated using SPSS 15.0 software (IBM SPSS Statistics, Cary, NC). One-way analysis of variance (ANOVA) followed by Bonferroni multiple comparison post-test was used to evaluate differences between experimental groups. P-value ≤ 0.05 was considered significant.

3. Results

oo

f

3.1. Effect of cyanidin on AA-FLS cells viability

pr

MTT assay was performed to determine the effect of cyanidin chloride on the viability of AA-FLS. Cells were pre-treated with increasing concentration of cyanidin chloride (0, 2.5, 5,

e-

7.5, 10, 15, 20, 30 and50 µM) or vehicle control DMSO (0.1%) for 24 h. Cyanidin treatment

Pr

from 15µM to 50µM concentrations significantly decreased the viability of AA-FLS (Fig 1C). However, cyanidin treatment at concentrations 2.5, 5, 7.5 and 10µM showed no effect

al

on reducing the viability of AA-FLS (Fig. 1C). Based on this observation, cyanidin

rn

concentration of 5, 7.5 and 10 µM was selected for further experiments.

Jo u

3.2. Cyanidin treatment reduces IL-17A cytokine-induced proliferative and migratory potential of AA-FLS cells

Uncontrolled expansion of FLS cells is considered as a pivotal factor for the development of hyperplastic synovium [1]. This expended destructive synovial tissue held key responsible for joint destruction in RA [2]. Previous studies have identified that IL-17A stimulates the proliferation of FLS in RA [10, 12]. In the present study, increased migration and colony formation capacity of AA-FLS cells was observed when compared to normal FLS cells. The migration and colony-forming potential of AA-FLS cells greatly increased after stimulation with IL-17A compared to AA-FLS (Fig. 2A & B). Interestingly, pre-treatment of cyanidin decreased IL-17A induced migration and colony-forming capacity of AA-FLS cells in a 14

Journal Pre-proof concentration-dependent manner (Fig. 2A & B). Similarly, IL-17A mediated the migrative and proliferative effect of AA-FLS cells was abrogated by S3I-201 treatment (Fig. 2A & B). In addition, the protein expression of proliferative marker PCNA was further evaluated by western blot. The reduced expression of PCNA protein was observed in AA-FLS cells that were first pre-treated with increasing concentration of cyanidin followed by IL-17A stimulation compared to AA-FLS cells that only stimulated with IL-17A (Fig. 2D-i). The maximum inhibition of PCNA protein expression was observed for cyanidin at 10 µM

oo

f

concentration (Fig. 2D-i). To further confirm the cyanidin inhibitory effect on AA-FLS cell proliferation, we performed BrdU staining analysis. Notably, AA-FLS cells treated with

pr

cyanidin at 10 µM concentration dramatically reduced percentage BrdU positive cells as

e-

compared to AA-FLS cells stimulated with IL-17 (Fig. 2C). These results suggest that

Pr

cyanidin modulates IL-17A induced proliferation of FLS cells and may prevent synovial outgrowth in RA.

rn

TLR 3 in AA-FLS cells

al

3.3. Effect of cyanidin on IL-17A mediated expression of cyr61, IL-23, GM-CSF and

Jo u

To assess the therapeutic role of cyanidin on IL-17A mediated expression of cyr61, IL-23, GM-CSF and TLR3, AA-FLS cells were pre-treated with increasing concentration of cyanidin then stimulated with IL-17A cytokine. Addition of IL-17A significantly increased protein and mRNA expression of cyr61, IL-23, and GM-CSF in AA-FLS compare to that of unstimulated control (Fig 2D-ii, 2F). This result consistent with our previous observation (16). Importantly, pre-treatment of cyanidin markedly decreased protein and mRNA expression of cyr61, IL-23, and GM-CSF in AA-FLS response to IL-17A in a concentrationdependent manner (Fig 2D-ii & 2F). In addition, pre-treatment of S3I-201 also significantly decreased IL-17 induced protein and mRNA expression of cyr61, IL-23 and GM-CSF in AAFLS (Fig 2D-ii & 2F). Next, the effect of cyanidin on the extracellular membrane expression 15

Journal Pre-proof of TLR3 in AA-FLS cells in response to IL-17A cytokine was examined. The flow cytometry analysis result revealed increased (nearly 97.6%) percentage of TLR-3 positive AA-FLS cells after stimulation with IL-17A compared to unstimulated AA-FLS cells (73%) (Fig 2E). Notably, pre-treatment of cyanidin led to a decrease in the percentage of TLR3 expressing AA-FLS cells' response to IL-17A in a concentration-dependent manner (Fig. 2E). In addition, a decrease in the percentage of TLR3 positive AA-FLS cells (19.4%) was also observed in the S3I-201 pre-treatment group (Fig. 2E). Cyanidin pre-treatment reduced IL-

oo

f

17A cytokine-induced mRNA expression of TLR3 in AA-FLS cells (Fig. 2F)

pr

To further support the selective inhibitory role of cyanidin on IL-17A/IL-RA dependent pathogenic mediator expression, the IL-17RA gene knockdown study was conducted.

IL-

e-

17RA gene knockdown by its specific siRNA or pre-treatment of cyanidin significantly

Pr

diminished IL-17A induced protein expression of cyr61, IL-23, GM-CSF and TLR3 in AAFLS cells (Fig. 3). These results provide the evidence that cyanidin downregulates cyr61, IL-

rn

al

23, GM-CSF, and TLR-3 via targeting IL-17A/IL-17RA dependent action.

Jo u

3.4. Cyanidin inhibits IL-17RA expression in AA-FLS cells Reports have shown that RA-FLS cells highly express IL-17RA [12, 16]. The IL-17A cytokine critically mediates disease pathogenic signalling via binding to IL-17RA [12]. Cyanidin potently disrupts the formation of IL-17/IL-17RA complex via binding to the extracellular domain of IL-17RA [27]. In the present study, the regulatory role of cyanidin on IL-17A cytokine-mediated expression of IL-17RA in AA-FLS cells was examined. As shown in Fig. 4A. increased mRNA expression of IL-17RA was observed in AA-FLS cells after stimulation with IL-17A. From the flow cytometry results, nearly 99% of AA-FLS cells stained positive for IL-17RA after stimulation with IL-17A cytokine compared to that of unstimulated AA-FLS cells (Fig. 4B). Pre-treatment of cyanidin leads to a significant

16

Journal Pre-proof decrease in the IL-17A induced mRNA expression of IL-17RA (Fig. 4A) and a drastic decrease of IL-17RA positive AA-FLS cells in a concentration-dependent manner (Fig. 4B). S3I-201 pre-treatment significantly downregulated IL-17 induced mRNA expression of IL17RA (Fig. 4A) and reduced IL-17RA positive AA-FLS cells (17%) like that observed for cyanidin at 10µM concentration (Fig. 4A and 4B). Next, gene knockdown experiment was employed using siRNA to target IL-17RA in AA-

f

FLS cells. Upon IL-17RA knockdown, IL-17A failed to increase the percentage of IL-17RA

oo

positive AA-FLS cells (8.6%) compared to IL-17A stimulated AA-FLS cells (99%) (Fig.

pr

4C). Cyanidin at 5µM and 7.5µM concentrations reduced IL-17RA positive AA-FLS cells by 80.5% and 58.4% respectively response to IL-17A cytokine (Fig. 4C). Interestingly, the

e-

maximum reduction in the percentage of IL-17RA positive AA-FLS cells was observed for

Pr

cyanidin at 10µM concentration and this result similar to that of the IL-17RA knockdown group (Fig. 4C). Therefore, these results suggest the possible preventive effect of cyanidin on

rn

al

altering IL-17A/IL-17RA signaling in RA.

AA-FLS cells

Jo u

3.5. Cyanidin regulates IL-17/IL-17RA dependent JAK/STAT3 signalling pathway in

To examine the underlying molecular mechanism through which cyanidin modulates AAFLS cells mediated disease severity, IL-17/IL-17RA dependent JAK/STAT3 signaling pathway was examined. As shown in fig. 5A, IL-17A cytokine stimulation significantly increased phosphorylation of JAK1 at Tyr 1034/1035 residue and JAK3 at Tyr 980/981 residue, an essential IL-17A/IL-17RA dependent intracellular signal-transducing proteins in AA-FLS cells when compared to unstimulated AA-FLS cells. Interestingly, pre-treatment of cyanidin markedly reduced IL-17A induced phosphorylation of JAK1 at Tyr 1034/1035 residue and JAK3 at Tyr 980/981 residue in AA-FLS cells (Fig. 5A). Cyanidin at 10µM

17

Journal Pre-proof concentration pre-treatment exhibited a maximum inhibitory effect on preventing IL-17A cytokine-induced JAK1 and JAK3 activation in AA-FLS cells (Fig. 5A). This suggests that cyanidin also targets STAT-3 upstream intracellular JAK1 and JAK3 kinases. Next, the cellular expression of total and phosphorylated STAT-3 was examined by immunofluorescence staining. As expected, the cellular expression of total STAT-3 and phosphorylated STAT-3 levels was increased in AA-FLS cells after stimulation with IL-17A

f

cytokine compared with unstimulated AA-FLS cells (Fig. 5B). Pre-treatment of cyanidin

(Fig.

5B).

Likewise,

pre-treatment of AA-FLS

cells with S3I-201

inhibited

pr

cells

oo

reduced IL-17A cytokine-induced STAT-3 expression and its phosphorylation in AA-FLS

phosphorylated STAT-3 at the cellular level in response to IL-17A cytokine stimulation (Fig.

e-

5B). Interestingly, cyanidin pre-treatment also induced cellular expression of protein inhibitor

Pr

of activated STAT-3 (PIAS3), a naturally available negative regulator that reverses the action of activated STAT-3 in AA-FLS cells in a concentration-dependent manner (Fig. 5B). These

al

results demonstrate that cyanidin inhibits the proliferative potential of AA-FLS cells and

rn

expression of pro-inflammatory pathogenic mediators via modulating IL-17A/IL-17RA

Jo u

dependent JAK/STAT3 signaling pathway. 3.6. The therapeutic effect of cyanidin in adjuvant-induced arthritis (AA) in vivo The therapeutic efficacy of cyanidin was further evaluated in adjuvant-induced arthritis (AA) rat model. The disease severity of arthritis in the experimental rats was monitored periodically by assessing paw swelling and body weight loss after complete Freund’s adjuvant (CFA) injection. As shown in fig. 6A-ii & B, substantial paw swelling, and body weight loss were observed in the AA control group. The intraperitoneal administration of cyanidin was started on day 11 and continued till day 20. Treatment of cyanidin significantly reduced hind paw swelling and increased the body weight in AA rats (Fig. 6A & B).

18

Journal Pre-proof The histopathological examination revealed joint space narrowing, immune cells infiltration and pannus formation in AA control rats (Fig. 6C – i & ii). In addition, the radiological assessment showed reduced joint space and bone erosion in AA control rats (Fig. 6C - iii). In contrast, cyanidin treatment ameliorated histopathological alterations as observed by reduced immune cell infiltration and smooth synovial lining (Fig. 6C – i & ii). Cyanidin treatment also exhibited protect effect against bone erosion in AA rats (fig. 6C -iii).

f

The synovial tissues of experimental rats were examined for the expression of phosphorylated

oo

STAT-3, cyr61, and TLR-3 by immunohistochemistry analysis. The increased level of p-

pr

STAT-3, cyr61 and TLR-3 proteins was observed in the synovial tissue of AA control rats (Fig. 6D). Interestingly, the synovial tissue of cyanidin treated AA rats showed reduced

e-

staining intensity for p-STAT-3, cyr61, and TLR-3 proteins when compared to AA control

Pr

rats (Fig. 6D). As shown in fig. 6E, significantly increased level of IL-23 and GM-CSF was observed in the serum of AA rats. However, a significant decrease in the level of IL-23 and

al

GM-CSF was seen in cyanidin treated AA rats compared to that of AA control rats (Fig. 6E).

rn

Collectively, these results suggest that cyanidin has the capacity to prevent disease

4. Discussion

Jo u

progression, severity and suppresses pro-inflammatory mediators in RA.

Given the importance of IL-17A cytokine-dependent signalling cascade in mediating the pathogenesis, this cytokine being an attractive target for the development effect therapies in RA [33]. Currently available targeted therapies directed against TNF-α and IL-6R in combination with DMARDs demonstrated clinically effective in the majority of RA patients but ceiling effect and loss of therapy responsiveness over the period of time remains obvious drawback [5,6]. Development of new treatments is critically needed not only for high disease severity RA patients but also for those showed loss of therapy responses. Various

19

Journal Pre-proof investigations reported that FLS cells are a major component of synovium exhibit pivotal roles in disease progression and joint destruction in RA [34]. Importantly, recent studies have shown

that

IL-17A

cytokine-dependent

signalling

mainly

controls

hyperplastic

transformation of FLS and synovial pannus growth in RA [35, 36]. The enhanced FLS cells proliferative potential has also been observed when IL-17A synergistically stimulated with other pro-inflammatory cytokines such as TNF-α in RA [15]. IL-17A induced high proliferative RA-FLS cells to secrete MMPs and RANKL to breakdown cartilage and

oo

f

promote osteoclast-mediated bone erosion [37]. In the present study, cyanidin prevented IL17A cytokine-induced proliferative capacity of AA-FLS cells in vitro and reduced synovial

pr

hyperplasia in the AA rat model. Further, cyanidin diminished arthritis severity, histological

e-

alterations, immune cells infiltration, inflammation and prevented bone erosion in AA rat

Pr

model. These data suggest that cyanidin can be a new alternative therapeutic strategy for the treatment of RA.

al

A recent study has identified that IL-17A cytokine increases nodal pathogenic mediators such

rn

as cyr61, IL-23 and GM-CSF in AA-FLS cells and highlighted the importance of IL-17A

Jo u

cytokine in mediating FLS dependent disease progression in RA [16]. IL-17A cytokine present in the inflamed synovium promotes RA-FLS cells survival and enhances TLR3 expression [38]. Activation of TLR3 exacerbates osteoclastogenesis and promotes Th17 cell expansion in RA [39, 40]. Cyr61 has a critical pathogenic role in IL-17A dependent proliferation of RA-FLS cells and stimulates IL-8 production to influence neutrophil chemotaxis in RA [41]. IL-23 mediates TNF-α production from RA-FLS, thus leading to synovial hyperplasia and bone erosion [42]. In addition, IL-23 stimulates the expansion of functionally active Th17 cells and increases the inflammatory response of autoantibodies [43,44]. GM-CSF mediated osteoclast differentiation and T cells activation in RA has been shown previously [45]. IL-17A cytokine co-operates with GM-CSF and influences FLS cell 20

Journal Pre-proof proliferation and augments the disease progression of RA [12]. These findings suggest that high proliferative potential of FLS cells and pannus formation can be reversed via blockade of IL-17A cytokine-dependent expression of cyr61, IL-23, GM-CSF and TLR-3 in RA. Cyanidin has been shown to exhibit various pharmacological effects like immunomodulatory, anti-inflammatory and anti-cancer properties [25]. A recent finding suggests that cyanidin-3glucoside (C3G) inhibits lipopolysaccharide (LPS) induced TNF-α, IL-1β, and IL-6

f

expression by interfering NF-kB and MAPK signalling cascade in RA-FLS cells [44]. In this

oo

study, exogenous IL-17A stimulation enhanced the production of pathogenic effector

pr

molecules such as cyr61, IL-23, GM-CSF, and TLR3 in AA-FLS cells. This outcome is consistent with the previous findings [16]. In this study, cyanidin reduces IL-17A cytokine-

e-

mediated expression of cyr61, IL-23, GM-CSF, and TLR3 in AA-FLS cells. In addition,

Pr

cyanidin reduced the expression level of cyr61, IL-23, GM-CSF, and TLR-3 in AA rats. This data further suggests that the prevention of IL-17A mediated cyr61, IL-23, GM-CSF and

al

TLR3 expression in FLS cells and AA rats by cyanidin will benefit in controlling pannus

Jo u

clinical settings.

rn

formation and disease severity in RA patients. This approach needs to be investigated in

IL-17A cytokine mediates its disease-promoting effects via binding to cell surface receptor IL-17RA.

IL-17A/IL-17RA interaction activates various pro-inflammatory signals and

promotes severe inflammation. The importance of IL-17A/IL-17RA interaction on various cell types including FLS cells mediated RA progression has been shown previously [12]. The paramount of IL-17A cytokine mainly comes from CD4+ Th17 cells and mast cells infiltrated within the hyperplastic synovium. This IL-17A cytokine mediates paracrine action in RAFLS cells [46]. The expression IL-17RA differs based on the cell types and FLS cells known to overexpress this receptor on their cell surface [47]. Recently, the direct effect of IL-17A cytokine on inducing overexpression of IL-17RA in FLS cells supported the fact of 21

Journal Pre-proof reprogramming FLS cells to react prominently to the IL-17A cytokine available in the inflammatory microenvironment [16]. IL-17A/IL-17RA interaction is currently emerging as an attractive and promising therapeutic target for RA therapy [33]. Although monoclonal antibodies targeting IL-17 or IL-17RA have shown promising outcomes in clinical trials, they include high production cost and limited route of administration [27]. Therefore, alternative therapies to overcome these disadvantages and specifically targets IL-17/IL-RA signalling and IL-17A cytokine-mediated aggressive RA-FLS cells need to be developed. A recent

oo

f

report has suggested that cyanidin act as a small molecule inhibitor and effectively inhibits the binding of IL-17A to IL-17RA. In addition, blockade of IL-17A/17RA interaction

pr

inhibited skin hyperplasia, immune cells infiltration and Th17 cells mediated disease

e-

progression in an animal model of psoriasis [27]. Cyanidin treatment prevented disease

Pr

severity of asthma via attenuation of IL-17/IL-RA interaction in the murine model for asthma [27]. This present study showed that cyanidin downregulates IL-17A induced expression of

al

IL-17RA in AA-FLS cells. Further, suggest that the prevention of high proliferative mediator

Jo u

AA-FLS cells.

rn

expressions might be through cyanidin mediated blockade of IL-17/IL-17RA interaction in

It is now well known that IL-17A/IL17RA interaction can activate JAK/STAT-3 signaling [48]. The aberrant activation of JAK/STAT-3 signalling has been implicated in mediating disease progression and poor clinical outcome in RA [49]. Tofacitinib, a selective JAK inhibitor effectively prevents STAT-3 activation in FLS cells and reduces the secretion of pro-inflammatory cytokines and chemokines and prevents synovial inflammation in RA [50]. Thus, inhibition of JAK/STAT activation is of importance for controlling RA disease severity. The augmented level of phosphorylated STAT-3 was observed in FLS cells from RA patients [51]. Blockade of STAT-3 action by its specific inhibitor ameliorated IL-17A dependent inflammatory signalling and induced apoptosis in RA-FLS cells [51]. Importantly, 22

Journal Pre-proof recent findings demonstrated that IL-17/IL-17RA interaction led to an increase in STAT-3 activation in AA-FLS and this effect was reversed by S3I-201 inhibitor [16]. The present study revealed that cyanidin decreased IL-17/IL-RA dependent intermediate signalling molecules JAK1 and JAK3 activation and their immediate downstream transcription factor STAT-3 activation in AA-FLS cells. Cyanidin also downregulated STAT-3 activation in the synovial tissue of AA rat model. Importantly, cyanidin was able to activate PIAS3 protein, a naturally available negative regulator of STAT-3 in AA-FLS cells. The activated PIAS3

oo

f

binds to the STAT-3 binding domain and inhibits transcription regulation of target genes.

pr

5. Conclusions

e-

In outline, this study demonstrates that cyanidin prevents the hyperproliferative potential of

Pr

FLS cells and synovial hyperplasia and reduces the expression of pathogenic effector molecules in the AA rat model. In addition, cyanidin interferes IL-17/IL-17RA interaction

al

and reduces IL-17A mediated reprogramming of AA-FLS cells to overexpress IL-17RA. The

rn

inhibitory effect of cyanidin on AA-FLS cells mediated pathogenesis was via the regulation IL-17/IL-17RA dependent JAK/STAT-3 signaling pathway. This study further suggests that

Jo u

cyanidin may be considered as an alternative therapeutic approach that might advance the battle against IL-17A cytokine signaling mediated RA pathogenesis and this needs to be investigated in clinical settings. Conflicts of interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the Science and Engineering Research Board (SERB), Department of Science and Technology, Government of India, New Delhi (File no. EMR/2017/000523). 23

Journal Pre-proof References [1]

G.S. Firestein and I.B. McInnes, “Immunopathogenesis of rheumatoid arthritis.,” Immunity., vol. 46, no. 2, pp. 183-96, Feb 2017.

[2]

Y. Yamanishi and G. S. Firestein, “Pathogenesis of rheumatoid arthritis: the role of synoviocytes.,” Rheum. Dis. Clin. North Am., vol. 27, no. 2, pp. 355–371, May 2001.

[3]

N. Bottini and G. S. Firestein, “Duality of fibroblast-like synoviocytes in RA: passive

oo

f

responders and imprinted aggressors.,” Nat. Rev. Rheumatol., vol. 9, no. 1, pp. 24–33,

[4]

pr

Jan. 2013.

T. C. A. Tolboom, A. H. M. V. D. H. Mil, R. G. H. H. Nelissen, F. C. Breedveld, E.

e-

M. Toes, and T. W. J. Huizinga, “Invasiveness of Fibroblast-like Synoviocytes Is an

Pr

Individual Patient Characteristic Associated With the Rate of Joint Destruction in Patients With Rheumatoid Arthritis,” vol. 52, no. 7, pp. 1999–2002, 2005. S. Mpofu, F. Fatima, and R. J. Moots, “Anti-TNF-α therapies: they are all the same

al

[5]

K. Yoshizaki, N. Nishimoto, M. Mihara, and T. Kishimoto, “Therapy of rheumatoid

Jo u

[6]

rn

(aren’t they?),” Rheumatology, vol. 44, no. 3, pp. 271–273, 2004.

arthritis by blocking IL-6 signal transduction with a humanized anti-IL-6 receptor antibody.,” Springer Semin. Immunopathol., vol. 20, no. 1–2, pp. 247–259, 1998. [7]

H. M. Shepard, G. L. Phillips, C. D Thanos, and M. Feldmann, “Developments in therapy with monoclonal antibodies and related proteins.,” Clin. Med., vol. 17, no. 3, pp. 220–232, Jun. 2017.

[8]

T. Bongartz, A. J. Sutton, M. J. Sweeting, I. Buchan, E. L. Matteson, and V. Montori, “Anti-TNF antibody therapy in rheumatoid arthritis and the risk of serious infections and malignancies: systematic review and meta-analysis of rare harmful effects in 24

Journal Pre-proof randomized controlled trials.,” JAMA, vol. 295, no. 19, pp. 2275–2285, May 2006. [9]

J. Yang, M. S. Sundrud, J. Skepner, and T. Yamagata, “Targeting Th17 cells in autoimmune diseases.,” Trends Pharmacol. Sci., vol. 35, no. 10, pp. 493–500, Oct. 2014.

[10]

E. Kontny et al., “Taurine chloramine inhibition of cell proliferation and cytokine production by rheumatoid arthritis fibroblast-like synoviocytes.,” Arthritis Rheum.,

[11]

oo

f

vol. 42, no. 12, pp. 2552–2560, Dec. 1999. T. J. Kenna and M. A. Brown, “The role of IL-17-secreting mast cells in inflammatory

M. Robert and P. Miossec, “IL-17 in Rheumatoid Arthritis and Precision Medicine:

e-

[12]

pr

joint disease.,” Nat. Rev. Rheumatol., vol. 9, no. 6, pp. 375–379, Jun. 2013.

Pr

From Synovitis Expression to Circulating Bioactive Levels,” Front. Med., vol. 5, p. 364, 2019.

M. I. Koenders et al., “Blocking of interleukin-17 during reactivation of experimental

al

[13]

rn

arthritis prevents joint inflammation and bone erosion by decreasing RANKL and

[14]

Jo u

interleukin-1.,” Am. J. Pathol., vol. 167, no. 1, pp. 141–149, Jul. 2005. S. Kotake et al., “IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis.,” J. Clin. Invest., vol. 103, no. 9, pp. 1345– 1352, May 1999. [15]

J. A. A. Fischer et al., “Combined inhibition of tumor necrosis factor alpha and interleukin-17 as a therapeutic opportunity in rheumatoid arthritis: development and characterization of a novel bispecific antibody.,” Arthritis Rheumatol. (Hoboken, N.J.), vol. 67, no. 1, pp. 51–62, Jan. 2015.

[16]

R. Ganesan and M. Rasool, “Interleukin 17 regulates SHP-2 and IL-17RA/STAT-3 25

Journal Pre-proof dependent

Cyr61,

IL-23

and

GM-CSF

expression

and

RANKL

mediated

osteoclastogenesis by fibroblast-like synoviocytes in rheumatoid arthritis.,” Mol. Immunol., vol. 91, pp. 134–144, Nov. 2017. [17]

J. Lin et al., “Cyr61 induces IL-6 production by fibroblast-like synoviocytes promoting Th17 differentiation in rheumatoid arthritis.,” J. Immunol., vol. 188, no. 11, pp. 5776– 5784, Jun. 2012. C. Ospelt et al., “Overexpression of Toll-like Receptors 3 and 4 in Synovial Tissue

oo

f

[18]

From Patients With Early Rheumatoid Arthritis Toll-like Receptor Expression in Early

A. E. M. Van Nieuwenhuijze, D. M. Roeleveld, B. Walgreen, and M. Bennink,

e-

[19]

pr

and Longstanding Arthritis,” vol. 58, no. 12, pp. 3684–3692, 2008.

Pr

“Synergism Between GM-CSF and IL-17 Causes Enhanced Joint Pathology Via the Production of IL-6 and IL-23,” pp. 3–4.

A. Awasthi et al., “NIH Public Access,” vol. 182, no. 10, pp. 5904–5908, 2010.

[21]

F. Cornelissen, J. P. van Hamburg, and E. Lubberts, “The IL-12/IL-23 axis and its role

rn

al

[20]

Jo u

in Th17 cell development, pathology and plasticity in arthritis.,” Curr. Opin. Investig. Drugs, vol. 10, no. 5, pp. 452–462, May 2009. [22]

E. Lubberts, “The IL-23-IL-17 axis in inflammatory arthritis.,” Nat. Rev. Rheumatol., vol. 11, no. 7, pp. 415–429, Jul. 2015.

[23]

A. Wasilewska, M. Winiarska, M. Olszewska, and L. Rudnicka, “Interleukin-17 inhibitors . A new era in treatment of psoriasis and other skin diseases,” pp. 247–252, 2016.

[24]

D. E. Furst and P. Emery, “Review Rheumatoid arthritis pathophysiology : update on emerging cytokine and cytokine-associated cell targets,” no. January, pp. 1560–1569, 26

Journal Pre-proof 2014. [25]

C. Dou et al., “Dual Effect of Cyanidin on RANKL-Induced Differentiation and Fusion of Osteoclasts.,” J. Cell. Physiol., vol. 231, no. 3, pp. 558–567, Mar. 2016.

[26]

J. Cheng et al., “Cyanidin Chloride inhibits ovariectomy-induced osteoporosis by suppressing

RANKL-mediated

osteoclastogenesis

and

associated

signaling

pathways.,” J. Cell. Physiol., vol. 233, no. 3, pp. 2502–2512, Mar. 2018.

f

C. Liu et al., “The flavonoid cyanidin blocks binding of the cytokine interleukin-17A

oo

[27]

to the IL-17RA subunit to alleviate inflammation in vivo.,” Sci. Signal., vol. 10, no.

T. A. Mace et al., “Bioactive compounds or metabolites from black raspberries

e-

[28]

pr

467, Feb. 2017.

Pr

modulate T lymphocyte proliferation, myeloid cell differentiation and Jak/STAT signaling.,” Cancer Immunol. Immunother., vol. 63, no. 9, pp. 889–900, Sep. 2014. J. Zhao, Q. Ouyang, and Z. Hu, “A protocol for the culture and isolation of murine

al

[29]

H. M. Doss, S. Samarpita, R. Ganesan, and M. Rasool, “Ferulic acid, a dietary

Jo u

[30]

rn

synovial fibroblasts,” no. 85, pp. 171–175, 2016.

polyphenol suppresses osteoclast differentiation and bone erosion via the inhibition of RANKL dependent NF-kappaB signalling pathway.,” Life Sci., vol. 207, pp. 284–295, Aug. 2018. [31]

R. Ganesan and M. Rasool, “Ferulic acid inhibits interleukin 17-dependent expression of nodal pathogenic mediators in fibroblast-like synoviocytes of rheumatoid arthritis.,” J. Cell. Biochem., Aug. 2018.

[32]

F. Sultana, M. K. Neog, and M. Rasool, “Withaferin-A, a steroidal lactone encapsulated

mannose decorated

liposomes ameliorates rheumatoid

arthritis by 27

Journal Pre-proof intriguing the macrophage repolarization in adjuvant-induced arthritic rats,” Colloids Surfaces B Biointerfaces, vol. 155, pp. 349–365, 2017. [33]

W. B. van den Berg and P. Miossec, “IL-17 as a future therapeutic target for rheumatoid arthritis.,” Nat. Rev. Rheumatol., vol. 5, no. 10, pp. 549–553, Oct. 2009.

[34]

A. Mor, S. B. Abramson, and M. H. Pillinger, “The fibroblast-like synovial cell in rheumatoid arthritis: a key player in inflammation and joint destruction.,” Clin.

[35]

oo

f

Immunol., vol. 115, no. 2, pp. 118–128, May 2005. S. Ryu, J. H. Lee, and S. I. Kim, “IL-17 increased the production of vascular

pr

endothelial growth factor in rheumatoid arthritis synoviocytes.,” Clin. Rheumatol., vol.

M.-L. Toh et al., “Role of Interleukin 17 in Arthritis Chronicity through Survival of

Pr

[36]

e-

25, no. 1, pp. 16–20, Feb. 2006.

1–13, 2010.

S. Samarpita, H. M. Doss, R. Ganesan, and M. Rasool, “Interleukin 17 under hypoxia

rn

[37]

al

Synoviocytes via Regulation of Synoviolin Expression,” PLoS One, vol. 5, no. 10, pp.

Jo u

mimetic condition augments osteoclast mediated bone erosion and expression of HIF1alpha and MMP-9.,” Cell. Immunol., vol. 332, pp. 39–50, Oct. 2018. [38]

S.-Y. Lee et al., “Interleukin-17 increases the expression of Toll-like receptor 3 via the STAT3 pathway in rheumatoid arthritis fibroblast-like synoviocytes.,” Immunology, vol. 141, no. 3, pp. 353–361, Mar. 2014.

[39]

K.-W. Kim et al., “TLR-3 enhances osteoclastogenesis through upregulation of RANKL expression from fibroblast-like synoviocytes in patients with rheumatoid arthritis.,” Immunol. Lett., vol. 124, no. 1, pp. 9–17, May 2009.

[40]

F. Hu et al., “Toll-Like Receptors Expressed by Synovial Fibroblasts Perpetuate Th1 28

Journal Pre-proof and Th17 Cell Responses in Rheumatoid Arthritis,” PLoS One, vol. 9, no. 6, p. e100266, Jun. 2014. [41]

X. Zhu et al., “Cyr61 is involved in neutrophil infiltration in joints by inducing IL-8 production by fibroblast-like synoviocytes in rheumatoid arthritis.,” Arthritis Res. Ther., vol. 15, no. 6, p. R187, 2013.

[42]

J. Gao, R. Kong, X. Zhou, L. Ji, J. Zhang, and D. Zhao, “MiRNA-126 expression

oo

f

inhibits IL-23R mediated TNF-α or IFN-γ production in fibroblast-like synoviocytes in a mice model of collagen- induced rheumatoid arthritis,” pp. 607–615, 2018. M. J. McGeachy and D. J. Cua, “Th17 cell differentiation: the long and winding

pr

[43]

Y. Sun and L. Li, “Cyanidin-3-glucoside inhibits inflammatory activities in human

Pr

[44]

e-

road.,” Immunity, vol. 28, no. 4, pp. 445–453, Apr. 2008.

fibroblast-like synoviocytes and in mice with collagen-induced arthritis.,” Clin. Exp.

N. Ruef, S. Dolder, D. Aeberli, M. Seitz, D. Balani, and W. Hofstetter, “Granulocyte-

rn

[45]

al

Pharmacol. Physiol., vol. 45, no. 10, pp. 1038–1045, Oct. 2018.

Jo u

macrophage colony-stimulating factor-dependent CD11c-positive cells differentiate into active osteoclasts.,” Bone, vol. 97, pp. 267–277, Apr. 2017. [46]

H. Ito, H. Yamada, T. N. Shibata, H. Mitomi, S. Nomoto, and S. Ozaki, “Dual role of interleukin-17 in pannus growth and osteoclastogenesis in rheumatoid arthritis,” pp. 1– 11, 2011.

[47]

I. Chyuan and J. Chen, “Review Article Role of Interleukin- ( IL- ) 17 in the Pathogenesis and Targeted Therapies in Spondyloarthropathies,” vol. 2018, 2018.

[48]

S. K. Raychaudhuri, C. Abria, and S. P. Raychaudhuri, “Regulatory role of the JAK STAT kinase signalling system on the IL-23/IL-17 cytokine axis in psoriatic arthritis.,” 29

Journal Pre-proof Annals of the rheumatic diseases, vol. 76, no. 10. England, p. e36, Oct-2017. [49]

L. B. Ivashkiv and X. Hu, “The JAK/STAT pathway in rheumatoid arthritis: pathogenic or protective?,” Arthritis and rheumatism, vol. 48, no. 8. United States, pp. 2092–2096, Aug-2003.

[50]

S. Rosengren, M. Corr, G. S. Firestein, and D. L. Boyle, “The JAK inhibitor CP690,550 (tofacitinib) inhibits TNF-induced chemokine expression in fibroblast-like

oo

f

synoviocytes: autocrine role of type I interferon.,” Ann. Rheum. Dis., vol. 71, no. 3, pp. 440–447, Mar. 2012.

M. Cho, S.-Y. Lee, H.-J. Son, J.-G. Ryu, E.-K. Kim, and H.-Y. Kim, “Critical role of

pr

[51]

e-

STAT3 in IL-17-mediated survival of fibroblast-like synoviocytes in rheumatoid

Pr

arthritis. (171.16),” J. Immunol., vol. 188, no. 1 Supplement, pp. 171.16--171.16, 2012.

al

Figure legends:

Fig. 1. Effect of cyanidin on AA-FLS cell viability. (A) Chemical structure of cyanidin

rn

chloride. (B) Flow cytometry staining of isolated FLS cells with CD 90.2 and CD 55 markers

Jo u

at the fourth passage for purity analysis. Left panel, unstained cells, Right panel, isolated FLS cells were stained for CD 90.2 and CD 55 markers. (C) The viability of AA-FLS cells after treatment with the indicated concentration of cyanidin for 24 h was estimated using MTT assay. The data were presented as mean ± SEM (n = 3 independent experiments were performed).

***P

<

0.001

compared

with

untreated

control.

FLS,

fibroblast-like

synoviocytes; CD, cluster of differentiation; AA, adjuvant-induced arthritis; SEM, standard error of mean. Fig.2. Effect of cyanidin on IL-17A induced proliferative potential of AA-FLS cells. (A) AA-FLS cells were pre-treated with/without cyanidin (5, 7.5 and 10 µM) or S3I-201 (50 µM) and then stimulated with/without IL-17A. A wound-induced migration assay was performed 30

Journal Pre-proof to examine the migration capacity of AA-FLS cells. Images were captured after 24 h of initial scratch.

Migrated AA-FLS cells in three different fields were counted; 20X magnification

and scale: 10µm. (B) AA-FLS cell proliferation was examined by colony formation assay. Following in vitro treatment, cells were cultured in 35 mm plates for two weeks. Representative images (magnification 20 X; scale: 20 µm) were photographed following two weeks' culture and the number of colonies formed was quantified. (C) BrdU incorporation was determined by immunofluorescence staining analysis. Scale bar = 10 µm. (D) Expression

oo

f

of (i) PCNA, (ii) Cyr 61, IL-23 and GM-CSF proteins were analyzed by western blot and (E) the expression level of TLR-3 was determined by flow cytometry. (F) The mRNA expression

pr

of Cyr 61, IL-23, GM-CSF and TLR-3 were determined using qRT-PCR. All graphs display

e-

the mean ± SEM of results obtained from triplicate. ***P < 0.001 compared with normal FLS

Pr

cells. #P < 0.05, ##P < 0.01 and ###P < 0.001 compared with AA-FLS cells stimulated with IL-17A. IL, interleukin; PCNA, proliferating cell nuclear antigen; Cyr 61, cysteine-rich

al

angiogenic inducer 61; GM-CSF, granulocyte-macrophage colony-stimulating factor; TLR,

Jo u

messenger RNA

rn

toll-like receptor; qRT-PCR, quantitative real-time polymerase chain reaction; mRNA,

Fig. 3. Effect of cyanidin on IL-17 induced expression of nodal pathogenic mediators in AA-FLS. AA-FLS cells were transfected with small interfering RNA targeting IL17RA (siIL-17RA) or negative control siRNA (siNC). Following transfection, cells were pre-treated with cyanidin or left untreated, followed by stimulation with/without IL-17A. The protein expression of Cyr 61, IL-23, GM-CSF and TLR-3 was determined by using western blot. The data were presented as mean ± SEM (n = 3 independent experiments were performed). ***P < 0.001 vs normal FLS cells. #P < 0.05, ##P < 0.01 and ###P < 0.001 vs AA-FLS cells stimulated with IL-17A. n=3 independent experiments were performed. siRNA, small interfering RNA; IL-17RA, IL-17 receptor type A. 31

Journal Pre-proof Fig. 4. Effect of cyanidin on IL-17 induced expression of IL-17RA in AA-FLS cells. (A) AA-FLS were pre-treated with cyanidin (5, 7.5 and 10 µM) or S3I-201 (50 µM) or left untreated and then stimulated with/without IL-17A for 24 h. At the end of treatment, the expression of IL-17RA mRNA was determined by qRT-PCR analysis, (B) and the level of IL-17RA expressing AA-FLS cells was performed by flow cytometry analysis. (C) AA-FLS cells were transfected with small interfering RNA targeting IL17RA (siIL-17RA) or negative control siRNA (siNC). Following transfection, cells were pre-treated with cyanidin or left

oo

f

untreated, followed by stimulation with/without IL-17A. The IL-17RA expressing AA-FLS cells level was determined using flow cytometry analysis. ***P < 0.001 vs normal FLS cells.

pr

#P < 0.05, ##P < 0.01 and ###P < 0.001 vs AA-FLS cells stimulated with IL-17A. The data

e-

were presented as mean ± SEM and all the experiments were carried out in triplicates.

Pr

Fig. 5. Effect of cyanidin on IL-17A dependent JAK/STAT3 signalling pathway in AAFLS cells. Cells were pre-treated with/without cyanidin (5, 7.5 and 10 µM) or S3I-201 (50

al

µM) and then stimulated with/without IL-17A. (A) The protein expression of JAK-1, p-JAK-

rn

1, JAK-3, and p-JAK-3 was determined using western blot. (B) STAT-3, p-STAT-3 and

Jo u

PIAS-3 protein expression were analyzed by immunofluorescence staining. Scale bar = 10 µm. All error bars represent mean ± SEM of three independent experiments. ***P < 0.001 vs normal FLS cells. ##P < 0.01 and ###P < 0.001 vs AA-FLS cells stimulated with IL-17A. JAK, Janus activated kinase; STAT, signal transducer and activator of transcription proteins. Fig. 6. Therapeutic effect of cyanidin in adjuvant-induced arthritis (AA) rats in vivo. Experimental rats were injected intradermally with CFA into the right hind paw on day 0. After the onset of arthritis, AA or normal rats were intraperitoneally administered with 1 mg/kg b.wt. of cyanidin or 0.1% DMSO from day 11 to day 20. (A-i) Experimental timeline indicating the in vivo arthritis induction and treatment schedule of cyanidin. (ii) Macroscopic images of paw swelling on day 21. Conventional physical assessments such as paw thickness 32

Journal Pre-proof (A-ii) and body weight (B) were assessed. (C-i) Experimental rat knee joint sections were H & E stained (upper panel) for histological changes like joint space and pannus formation (magnification 40 X), (C-ii) and adjacent sections (lower panel) demonstrated cellular infiltration (100 X magnification). (C-iii) Representative radiographic images of rat joints and radiographical scoring graded on a semi-quantitative four-point scale in a blinded manner. Yellow arrow: joint space; Black arrow: pannus formation; white arrow: joint deformity. (D) Immunohistochemistry staining was performed to evaluate the expression of

oo

f

(i) p-STAT-3 (ii) Cyr 61 (iii) TLR-3. (E) The level of GM-CSF and IL-23 were assessed in serum samples of experimental rats by ELISA. All error bars represent mean ± SEM. ***P <

pr

0.001 vs DMSO vehicle control. ###P < 0.001 vs AA rats. CFA, complete Freund’s adjuvant;

Jo u

rn

al

Pr

e-

DMSO, dimethyl sulfoxide.

33

Jo u

rn

al

Pr

e-

pr

oo

f

Journal Pre-proof

34

Journal Pre-proof Credit Author Statement

Jo u

rn

al

Pr

e-

pr

oo

f

1. Snigdha Samarpita – Investigation, Validation, Formal analysis, Writing original draft 2. Dr.Ramamoorthi Ganesan – Conceptualization, Methodology, Writing, Reviewing and Editing 3. Dr.M.Rasool – Conceptualization, Supervision, Writing reviewing and editing Project administration, and Fund acquisition

35

Journal Pre-proof TABLE 1 Primer pair sequences used for qRT-PCR Forward

Reverse

Cyr61

5′‐ CGCGAAGCAACTCAACGAGG‐ 3′

5′‐ GAGACAGTTCTTGGGGACACA‐ 3′

IL‐ 23

5′‐ CTGAGAAGCAGGCAACAAGATG‐ 3′

5′‐ TCACAACCATCACCACACTGG‐ 3′

GM‐ CSF

5′‐ GCAGACCCGCCTGAAGCTAT‐ 3′

5′‐ CGGCTTCCAGCAGTCAAAAGG‐ 3’

TLR‐ 3

5′‐ CACTTGCTTCTCACCCCAAC‐ 3′

IL‐ 17RA

5′‐ CCACCAGCGATCCAATGTCAC‐ 3′

GAPDH

5′‐ -AGGTCGGTGTGAACGGATTTG3′‐

oo

f

Genes

Pr

e-

pr

5′‐ CTGAGTTGACCCAACCAAGAG‐ 3′ 5′‐ ATCAGCACCAGAAAGCCTCCA‐ 3′ 5′‐ TGTAGACCATGTAGTTGAGGTCA3′

Jo u

rn

al

Abbreviations: Cyr61, cysteine‐ rich angiogenic inducer 61, GM‐ CSF, granulocyte‐ macrophage colony stimulating factor; IL, interleukin; IL‐ 17RA, IL‐ 17 receptor type A; TLR‐ 3, toll‐ like receptor 3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

36

Journal Pre-proof Highlights

f oo pr ePr al rn



Cyanidin inhibits IL-17A/IL-17 receptor A (IL-17RA) interaction Cyanidin modulates IL-17/IL-17RA dependent JAK/STAT-3 signalling in AA-FLS cells Cyanidin inhibits IL-17A induced migratory and proliferative capacity of AA-FLS cells

Jo u

 

37

Figure 1

Figure 2A

Figure 2B

Figure 2C

Figure 3

Figure 4

Figure 5

Figure 6A

Figure 6B

Figure 6C