Cyclic strain induces vascular smooth muscle cell differentiation from murine embryonic mesenchymal progenitor cells

Cyclic strain induces vascular smooth muscle cell differentiation from murine embryonic mesenchymal progenitor cells Gordon M. Riha, BS, Xinwen Wang, MD, PhD, Hao Wang, PhD, Hong Chai, MD, PhD, Hong Mu, MD, PhD, Peter H. Lin, MD, Alan B. Lumsden, MD, Qizhi Yao, MD, PhD, and Changyi Chen, MD, PhD, Houston, Tex

Background. Hemodynamic forces play a crucial role in regulating vascular cell phenotype. However, the underlying molecular mechanisms are largely unknown. The objective of this study was to test our hypothesis that cyclic strain could affect smooth muscle cell (SMC) differentiation. Methods. A murine embryonic mesenchymal progenitor cell line (C3H/10T1/2) was cultured with or without cyclic strain for 6 days. Changes in cell morphology were studied with fluorescence dye Calcein-AM staining. Expression of specific SMC markers, smooth muscle specific ␣-actin (␣-SMA), and smooth muscle myosin heavy chain (SMMHC), was determined by real-time polymerase chain reaction (PCR) and Western blot. Transforming growth factor- ␤ (TGF-␤) was used as a positive control. Results. With cyclic strain, CH3/10T1/2 cells demonstrated spindle-shaped morphology and parallel alignment. Cells exposed to cyclic strain illustrated significantly increased mRNA levels of ␣-SMA and SMMHC by 3- and 2-fold, respectively, compared with static cells (P ⬍ .05). In addition, cells cultured under cyclic strain with TGF-␤ (2 ng/ml) supplementation demonstrated increased mRNA levels of ␣-SMA and SMMHC by 10- and 2-fold, respectively, compared with static cells (P ⬍ .05). Furthermore, protein levels of ␣-SMA and SMMHC were also significantly increased by more than 3fold in cyclic strain–treated cells compared with static cultures (P ⬍ .05). TGF-␤ synergistically enhanced the effect of cyclic strain on ␣-SMA mRNA expression in CH3/10T1/2 cells. Conclusions. This is the first study to demonstrate that cyclic strain significantly induces expression of two of the most important SMC markers in a murine embryonic mesenchymal progenitor cell line. Cyclic strain and TGF-␤ have a synergistic effect on ␣-SMA mRNA expression. (Surgery 2007;141:394-402.) From the Molecular Surgeon Research Center, Division of Vascular Surgery and Endovascular Therapy, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, Houston, Tex

Presented at the 1st Annual Academic Surgical Congress through the Society of University Surgeons at the Hyatt Manchester, February 7-10, 2006, San Diego, California. Supported in part by research grants from the National Institutes of Health (Lin: K08 HL076345; Lumsden: R01 HL75824; Yao: R01 DE15543 and R21 AT003094; and Chen: HL065916, HL072716, EB-002436, and R01 HL083471). Gordon Miles Riha is a Howard Hughes Medical Institute Medical Student Research Training Fellow whose work is supported by HHMI (2004-2005). Accepted for publication July 7, 2006. Reprint requests: Changyi (Johnny) Chen, MD, PhD, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, One Baylor Plaza, Mail stop: NAB-2010, Houston, TX 77030. E-mail: [email protected]. 0039-6060/$ - see front matter © 2007 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2006.07.043

394 SURGERY

Biomechanical forces are inherently present within the vasculature due to the pulsatile nature of blood flow. These hemodynamic forces play a crucial role in regulating vascular development, remodeling, healing, and lesion formation. During the last 10 years, research into this area has increased because of its implications for novel advancement in a number of fields related to cardiovascular surgery. The ability to harness these hemodynamic forces would allow manipulation of cellular differentiation, which could lead to the development of a fully engineered, small-diameter vascular graft; it also could contribute to the further understanding of vascular disease.1-5 Cyclin strain, which is one of the hemodynamic forces within the vasculature, has been characterized as a tensile stress that is perpendicular to the lumen and cyclic due to the pulsatile nature of

Surgery Volume 141, Number 3 blood flow.6,7 Numerous studies have elucidated the effect of cyclic strain on smooth muscle cell (SMC) differentiation and phenotype modulation.8-13 The majority of these studies have demonstrated that cyclic strain promotes a more differentiated and quiescent state that is suggestive of the contractile phenotype seen within vascular SMCs in vivo. Recently, studies have used cyclic strain in attempts to differentiate progenitor cells along a SMC lineage.14,15 These studies represent an exciting direction for cyclic strain application; however, these reports contain uncertainties that complicate the assessment of the effects of cyclic strain on progenitor cell differentiation. For example, some reports demonstrate a downregulation or transient increase in markers of SMC differentiation when cells are exposed to strain.14 Other studies have used bone marrow aspirates as the starting cell culture. Although these latter studies have demonstrated differentiation toward a SMC lineage with strain exposure,15 the heterogeneous cell population within the aspirate skews the overall examination of the effects of cyclic strain on progenitor differentiation. The cell line C3H/10T1/2 (10T1/2) is a murine embryonic mesenchymal progenitor cell line that has been shown to have the potential to differentiate into a variety of specialized cell types including adipocytes, chondrocytes, and osteocytes.16-18 Recently, our group demonstrated that, when 10T1/2 cells are exposed to physiologic hemodynamic conditions of shear stress, this progenitor cell line increases markers suggestive of differentiation toward mature endothelial cells.19 The effects of cyclic strain on 10T1/2 have not previously been demonstrated. However, studies have shown that when 10T1/2 cells are supplemented with transforming growth factor-␤ (TGF-␤) in culture, they possess the ability to differentiate along a smooth muscle lineage.20,21 Thus, we hypothesized that cyclic strain could induce 10T1/2 cells to differentiate toward a mature SMC lineage. This change toward a SMC lineage could increase our understanding of the effects of cyclic strain on progenitor cell differentiation. Furthermore, induction of 2 different phenotypes (SMCs and endothelial cells) from 1 mesenchymal cell line with 2 different hemodynamic forces could augment our understanding of the overall effects of hemodynamic factors on vascular cell differentiation. MATERIALS AND METHODS Chemicals and reagents. Trypsin/EDTA and fetal bovine serum (FBS) were purchased from Invitrogen (Grand Island, NY). Dulbecco modified

Riha et al 395

Eagle medium (DMEM) was obtained from American Type Culture Collection (Manassas, Va). An RNAqueous Kit was acquired from Ambion (Austin, Tex). An iScipt cDNA Synthesis Kit and an iQ SYBR Green Supermix Kit were purchased from Bio-Rad (Hercules, Calif). Collagen Type I Bioflex plates were obtained from Flexcell International (Hillsborough, NC). Cell culture and cyclic strain. Murine embryonic mesenchymal progenitor cells, C3H/10T1/2, (American Type Culture Collection, Rockville, Md) were cultured at 37°C and 5% CO2 in DMEM plus 5% FBS. When growth reached 80% confluence, cells were detached with trypsin/EDTA solution and subcultured in growth medium according to the manufacturer’s recommendations. All cells used for the current experiment were used at passage 6 to 9. A regimen of external mechanical strain was applied using a Flexercell Strain Unit (FX 4000; Flexcell) to 10T1/2 cells seeded on 6-well flexiblebottom collagen type I coated Bioflex plates (Flexcell) and grown in DMEM/5% FBS with or without TGF-␤ (2 ng/ml) supplementation. Prior to being subjected to strain, cells at 80% confluence were serum-starved for 12 hours. Culture dishes were placed on base plates in a humidified incubator (37°C, 5%CO2) equipped with 25-mm diameter loading posts beneath each well. The base plate was attached to a vacuum source, which allowed the flexible membrane bottom of each well to be stretched; this provided uniform strain to the membrane substrate to which 10T1/2 cells were attached. The vacuum regulator was computercontrolled (10% strain, 60 cycles/min) for 6 days in concordance with earlier strain studies.13-15 Time-matched control cultures were also plated with or without TGF-␤, respectively, and grown on collagen type I coated Bioflex plates (Flexcell) with no external mechanical strain applied. For each experiment, at least 3 different cell cultures were used to determine the effects of strain. Morphology analysis. Cells with or without TGF-␤ supplementation that were subjected to either static culture or mechanical strain were exposed to a Calcein-AM fluorescent stain immediately after the plate was removed from the humidified incubator on day 6. Cell morphology and distribution were recorded by Olympus 1⫻5 microscope (Olympus USA, Inc., Melville, NY). Real-time polymerase chain reaction. Total cellular RNA was extracted using the RNAqueous Kit (Ambion). cDNA was generated by reverse transcription using the iScript cDNA Synthesis Kit (BioRad). Real-time quantitative polymerase chain

396 Riha et al

Surgery March 2007

Table. Primers used for mouse gene expression analysis by real-time PCR Genes

Accession no.

Forward primer

Reverse primer

GAPDH ␣-SMA SMMHC

M32599 NM_007392 NM_013607

CGTGCCGCCTGGAGAAACC GACATGTGCTACCCTTAACTT GATCAGTGCCAGATCCGAGC

TGGAAGAGTGGGAGTTGCTGTTG TGAAGTGATTGATGCCATCCA ATCGCTGAGCTGCCCTTTC

PCR, polymerase chain reaction.

reaction (PCR) primers targeting murine alphasmooth muscle actin (␣-SMA) and smooth muscle myosin heavy chain (SMMHC) were designed by Beacon Designer 2.1 software (Bio-Rad, Hercules, Calif) and purchased from Sigma-Genosys (BioRad, The Woodlands, Tex). GAPDH was used as internal control (Table). Real-time PCR was performed in an iCycler iQ real-time PCR detection system (Bio-Rad) using the iQ SYBR Green SuperMix Kit (Bio-Rad). Controls were performed with no reverse transcription (RT) (mRNA sample) or water for SMC ␣-SMA, SMMHC, and GAPDH to demonstrate the specificity of the primers and the lack of DNA contamination in samples. PCR cycling conditions were as follows: initial 95°C for 90 seconds, then 40 cycles using 95°C for 20 seconds, and 60°C for 1 minute. Melt curve analysis was performed on the iCycler over the range 55°C to 95°C by monitoring iQ SYBR green fluorescence with increasing temperature (0.5°C increment changes at 10-second intervals). The level of the target gene expression was determined by the comparative cycle threshold (Ct) number, whereby the target is normalized to the endogenous reference GAPDH. The ⌬Ct is determined by subtracting the Ct of the GAPDH control from the Ct of the target [⌬Ct ⫽ Ct (target) –Ct (GAPDH)]. This relative value of target to endogenous reference is described as the fold of GAPDH ⫽ 2-⌬Ct. Western blot analysis. Cell lysates were prepared at the end of the cyclic strain. Proteins were extracted with cell lysis buffer (Cell Signaling, Danvers, Mass) according to the manufacturer’s instructions. Equal amounts of total proteins (50 ␮g) were loaded on to 10% SDS-PAGE, fractionated by electrophoresis, and transferred to PVDF membranes (Amersham Biosciences Corp, Piscataway, NJ). The membrane was incubated with the primary antibody at 4°C overnight. Dilutions of 1:300 for ␣-SMA and 1:1000 for SMHHC were used. The membrane was incubated with secondary antimouse (1:10,000) horseradish peroxidase-labeled antibodies for 40 minutes at room temperature. Bands were visualized with ECL plus Chemiluminescent Substrate (Amersham) according to the

manufacturer’s instructions. Densitometric measurement was performed to quantify the relative expression of target proteins compared to GAPDH after Western blotting using an imaging densitometer with AlphaEaseFC software (Alpha Innotech Co., San Leandro, Calif). Statistical analysis. Data from the different groups were compared using a paired Student t test (2-tailed). A value of P ⬍ .05 was considered statistically significant. Data are reported as mean ⫾ standard error of the mean (SEM) with at least 3 replicates unless otherwise noted. RESULTS Effect of cyclic strain on cell morphologic changes of 10T1/2 cells. After 6 days of exposure to static or strain (10% strain, 60 cycles/min) conditions with or without TGF-␤ supplementation (2 ng/ml), 10T1/2 cells were Calcein-AM–stained and observed under fluorescence microscopy (Fig 1). Cyclic strain had a distinct morphologic effect on 10T1/2 cell culture. Cells cultured under static conditions demonstrated a differential round shape with random distribution. This contrasted sharply with cells that were exposed to cyclic strain, which showed a spindle-shaped morphology with parallel alignment. No significant morphologic differences were observed between cells that were cultured under conditions of strain with or without TGF-␤ supplementation. Cyclic strain increases ␣-SMA expression in 10T1/2 cells. ␣-SMA has been identified as an abundant actin isoform in vascular SMCs, and so ␣-SMA was used as a marker of differentiation toward a smooth muscle lineage. Progenitor 10T1/2 cells were exposed to 4 and 6 days of strain, and real-time PCR was used to quantify the mRNA levels of ␣-SMA. Compared with static control, cells cultured under condition of strain (10% strain, 60 cycles/min) in the medium without TGF-␤ supplementation demonstrated a 3-fold increase in levels of ␣-SMA at 4 and 6 days (Fig 2) (both P ⬍ .05). Similarly, when cells were exposed to TGF-␤ (2 ng/ml) under static conditions (positive control), mRNA levels of ␣-SMA increased greater than 5-fold compared to static control without TGF-␤

Riha et al 397

Surgery Volume 141, Number 3

TGF-β β (-)

TGF-β (+)

Static Culture

Cyclic Strain

Fig 1. Effect of cyclic strain on cell morphologic changes of 10T1/2 cells. Photomicrographs of Calcein-AM fluorescent stained 10T1/2 cells cultured under static conditions or exposed to cyclic strain (10% strain, 60 cycles/min, 6 days). Both static and strained cells were concomitantly cultured with or without TGF-␤ (2 ng/ml) supplementation. Cultures under static conditions demonstrated cells with round morphology and random distribution. This contrasts with cell cultures exposed to conditions of strain which showed a spindle-shaped morphology and parallel alignment.

supplementation at 4 and 6 days (both P ⬍ .05). However, the most significant quantitative increase in mRNA levels of ␣-SMA was demonstrated in 10T1/2 cultures that were exposed to both 6 days of strain and 2 ng/ml of TGF-␤ supplementation. These cells showed a synergistic increase in ␣-SMA 10-fold greater than static control (P ⬍ .05). Western blotting was used with GAPDH acting as a protein control to evaluate the expression of relative protein levels of ␣-SMA in cells cultured under static conditions or conditions of strain with or without TGF-␤ supplementation at 6 days (Fig 3, A). Cells cultured under conditions of strain with or without TGF-␤ supplementation both demonstrated greater than a 3-fold increase in ␣-SMA protein levels compared to static control (P ⬍ .05) (Fig 3, B). These results differed greatly with the positive control TGF-␤–supplemented static cell culture, which did not show significant increases in ␣-SMA compared to static, non-supplemented con-

trol. These results suggest that cyclic strain exposure induces the expression of ␣-SMA in 10T1/2 cells at both the mRNA and protein levels, and that cyclic strain combined with TGF-␤ supplementation may act synergistically at the mRNA level. Cyclic strain increases SMHHC expression in 10T1/2 cells. SMMHC is another marker of differentiation that characterizes vascular SMCs and supports their principal function of contraction. Real-time PCR was used to quantify the relative amounts of SMMHC mRNA present in 10T1/2 cells exposed to 4 and 6 days of cyclic strain (10% strain, 60 cycles/min) or static conditions with or without TGF-␤ supplementation (2 ng/ml). No difference was observed at 4 days in all cultures. Compared to static control, cells cultured under conditions of strain with or without TGF-␤ supplementation demonstrated a 2-fold increase in SMMHC mRNA levels at 6 days (Fig 4). Additionally, the positive control culture (static condi-

398 Riha et al

Surgery March 2007

0 day

4 days

12

6 days *

10

0.35 8

0.3 0.25

*

0.2 0.15 0.1

*

6

* *

*

4

Fold Increase

α-SMA mRNA Levels (Normalized to GAPDH)

0.4

2

0.05

1 0

0 Cyclic Strain

TGF-β

Cyclic Strain + TGF-β

Fig 2. Effect of cyclic strain on ␣-SMA mRNA levels in 10T1/2 cells. Total RNA was extracted from cells exposed to conditions of strain (10% strain, 60 cycles/min, 4 and 6 days) without TGF-␤ supplementation, from cells cultured under static conditions with TGF-␤ supplementation (2 ng/ml), and from cells exposed to conditions of strain (10% strain, 60 cycles/min, 4 and 6 days) with TGF-␤ supplementation (2 ng/ml). Relative ␣-SMA levels were determined by real-time quantitative PCR. Values of mRNA amounts were normalized to GAPDH expression and expressed relative to static control at day 0. 10T1/2 cells exposed to cyclic strain alone expressed a 3-fold increased ␣-SAM mRNA level compared to static control at 4 and 6 days whereas 10T1/2 cells cultured under static conditions with TGF-␤ supplementation (positive control) expressed greater than a 5-fold increase in ␣-SMA mRNA compared to static control at 4 and 6 days. When 10T1/2 cells were cultured with both cyclic strain and TGF-␤, the expression of ␣-SMA mRNA was significantly increased 10-fold over static control. Data are presented as mean ⫾ standard error of the mean. Three experiments were performed per group. *P ⬍ .05.

tions, 2 ng/ml TGF-␤ supplementation) also showed greater than a 2-fold increase in SMMHC mRNA levels at 6 days compared to control (both P ⬍ .05). Relative protein levels of SMMHC in static- and strain-exposed cultures were assessed at 6 days using Western blot, with GAPDH acting as an internal control. Static cultures of 10T1/2 cells without TGF-␤ supplementation demonstrated nonexpression of SMMHC protein (Figs 3, A and C). However, when cell cultures were exposed to cyclic strain with or without TGF-␤ supplementation, both cultures demonstrated significant increases in SMMHC protein that were 5-fold higher than positive control cultures (P ⬍ .05). These results suggest that cyclic strain exposure induces the expression of SMMHC in 10T1/2 cells at both the mRNA and protein levels.

DISCUSSION Hemodynamic forces play a crucial role in the modulation of vascular cell differentiation. The current study demonstrates that cyclic strain significantly induces morphologic changes and causes the upregulation of markers of SMC differentiation such as ␣-SMA and SMMHC at both the mRNA and protein levels in a murine embryonic mesenchymal progenitor cell line. Additionally, when 10T1/2 cultures were exposed to both cyclic strain and TGF-␤, levels of ␣-SMA mRNA were significantly increased to a degree suggestive of a synergistic interaction. Biomechanical environmental factors such as cyclic strain can influence cellular morphology and orientation. The current study demonstrated that, after 6 days of cyclic strain exposure, 10T1/2 cells adopted an elongated, spindle-shaped form with

Riha et al 399

Surgery Volume 141, Number 3

A

α-SMA Protein / GAPDH

B

SMMHC

SMC α -actin

GAPDH Cyclic strain TFG-β

+ -

-

+ +

1.2 1

* *

0.8 0.6 0.4 0.2 0

+

Cyclic strain TGF-β

+ -

-

+ +

+

SMMHC Protein / GAPDH

C 0.09 0.08 0.07

* * *

0.06 0.05 0.04 0.03

*

0.02 0.01 0

Cyclic strain TGF-β

+ -

+ +

-

+

Fig 3. Effect of cyclic strain on protein levels of ␣-SMA and SMMHC in 10T1/2 cells. Total protein was isolated from murine 10T1/2 cells exposed to cyclic strain (10% strain, 60 cycles/min, 6 days) without TGF-␤ supplementation, from cells cultured under static conditions and supplemented with TGF-␤ (2 ng/ml), from cells exposed to cyclic strain (10% strain, 60 cycles/min, 6 days) with TGF-␤ supplementation (2 ng/ml), and from static control at day 0. After electrophoresis and transfer to a PVDF membrane, the protein was immunoblotted with specific antibody to ␣-SMA and SMMHC. A, Visualization of bands. B and C, Respective histograms of the relative protein levels of ␣-SMA and SMMHC. B, Cells exposed to cyclic strain alone and those exposed to cyclic strain with TGF-␤ both demonstrated greater than a 3-fold increase in protein levels of ␣-SMA over static control. C, Cells exposed to cyclic strain alone and those exposed to cyclic strain with TGF-␤ also demonstrated significant increases in protein levels of SMMHC compared to static control. Data are presented as mean ⫾ standard error of the mean. Three experiments were performed per group. *P ⬍ .05.

parallel arrangement in culture. This cellular organization is very similar to the morphologic form seen in SMC culture, which is suggestive of a change toward a mature SMC phenotype.22,23 This change in morphology contrasts with the cellular morphology seen in static cell culture, which is comparable to the morphology observed in undifferentiated 10T1/2 progenitor cells both in this study and in past analyses performed in our laboratory involving this cell line.19 Interestingly, there was a lack of change in the static TGF-␤ cultures. Others have demonstrated that phenotypic differ-

entiation toward a SMC phenotype using TGF-␤ in culture may take up to 10 to 20 days with certain cell types24; thus, the static TGF-␤ culture results seen in this study may be limited by the experimental time period. Differentiation is most often judged with the utilization and examination of the upregulation of markers that are indicative of a mature, differentiated SMC phenotype. For the current study, we used ␣-SMA and SMMHC as markers of SMC differentiation. Both of these markers are contractile proteins that have been exploited by other studies

400 Riha et al

Surgery March 2007

4 days

6 days

SMHHC mRNA Level (Normalized to GAPDH)

0.0016 0.0012

250

*

0.0014 *

*

0.001

200 150

0.0008 0.0006

100

0.0004

50

0.0002 0

% of Control

0 day

0 Cyclic Strain

TGF-β

Cyclic Strain + TGF-β

Fig 4. Effect of cyclic strain on SMMHC mRNA levels in 10T1/2 cells. Total RNA was extracted from cells exposed to conditions of strain (10% strain, 60 cycles/min, 4 and 6 days) without TGF-␤ supplementation, from cells cultured under static conditions with TGF-␤ supplementation (2 ng/ml), and from cells exposed to conditions of strain (10% strain, 60 cycles/min, 4 and 6 days) with TGF-␤ supplementation (2 ng/ml). Relative SMMHC levels were determined by real-time quantitative PCR. Values of mRNA amounts were normalized to GAPDH expression and expressed relative to static control at day 0. 10T1/2 cells exposed to cyclic strain alone expressed a 2-fold increased SMMHC mRNA level compared to static control at 6 days, whereas 10T1/2 cells cultured under static conditions with TGF-␤ supplementation (positive control) expressed a 2.3-fold increase in SMMHC compared to static control at 6 days. When 10T1/2 cells were cultured with both cyclic strain and TGF-␤, the expression of SMMHC mRNA was increased 2-fold over static control at 6 days. No significant difference was seen at 4 days of culture. Data are presented as mean ⫾ standard error of the mean. Three experiments were performed per group. *P ⬍ .05.

to establish differentiation along a SMC lineage.9,11 However, in contrast to other studies that have looked only at the upregulation of these markers at the protein level,15 we used real-time PCR and Western blotting. We did so to demonstrate upregulation of mature SMC markers and to further support our premise that cyclic strain promotes differentiation of 10T1/2 cells along a SMC line under conditions of cyclic strain compared to static culture. The current study found that this differentiation was most significant at 6 days rather than 4 days of culture. This time period is in accordance with other cyclic strain– based studies that have noted significant changes after 7 days of strain exposure, 15 and is likely due to the time needed for integrin redistribution and regulated activation of various transcription factor pathways.7 Earlier studies have demonstrated that TGF-␤ enhances SMC differentiation in the 10T1/2 cell

line.20,21 For example, Hirschi et al20 demonstrated that cultures of 10T1/2 cells treated with 1 ng/ml of TGF-␤ showed increased expression of the mature SMC-specific proteins ␣-SMA, SM-myosin, and SM22␣ compared with untreated controls. Additionally, their study showed that, when neutralizing antibodies against TGF-␤ were added to 10T1/2 and EC coculture, the intensity of immunostaining for SMC-specific proteins in 10T1/2 cells was significantly less than standard control coculture.20 Thus, the upregulation of ␣-SMA and SMMHC in this study at the mRNA level in static culture with TGF-␤ supplementation demonstrated was logical. Notably, cells cultured under static conditions with TGF-␤ supplementation showed an increase in ␣-SMA and SMMHC protein, although this increase in protein was not significant. This small, non-significant increase in protein levels with TGF-␤ in static culture was verified by Nerem et al,13 who also demonstrated slight, non-significant

Surgery Volume 141, Number 3 increases in protein levels of ␣-SMA in static culture with TGF-␤ supplementation. However, the novel synergistic enhancement of levels of ␣-SMA at the mRNA level when cyclic strain and TGF-␤ were combined in culture is of particular interest. This augmentation of differentiation has been illustrated by Nerem et al13; however, they exploited the use of mature rat aortic SMCs rather than undifferentiated progenitor cells in that particular study. This synergistic enhancement with progenitor-based cells is stimulating and significant from the perspective of tissue engineering. By combining different mechanical and cytokine modalities, one may be able to promote more rapid maturation of progenitor cells on a smalldiameter vascular graft, thus improving graft stability more suitable for implantation. Nevertheless, future studies are needed before this synergistic enhancement may be harnessed. For example, in the current study, levels of SMMHC were not synergistically enhanced at the mRNA levels or protein levels. Others have suggested that the action of TGF-␤ may be potentiated by cyclic strain to increase the expression of ␣-SMA,13 but this potentiation may not be obvious to the same degree with SMMHC. Future research at our laboratory is planned to examine this potentiation as well as the limited synergy seen in the ␣-SMA protein analysis to recognize and further understand how to augment protein differentiation with these combinations of mechanical and chemical factors. The particular cell line used in the current study, 10T1/2, was advantageous from a physiologic basis for further understanding the effects of hemodynamic forces on vascular cell differentiation. Earlier studies looking at the effects of cyclic strain on progenitor cell differentiation have used bone marrow aspirate for their starting cell culture,15 and one must question the heterogeneous nature of these cultures. A heterogeneous starting cell culture may contain cells or subpopulations that may not give a correct physiologic representation of the overall effects of cyclic strain on progenitor cell differentiation. The current study used a homogenous murine embryonic mesenchymal progenitor cell line, which only utilized cells between passages 6 and 9, assuring that separate subpopulations were not examined. This 10T1/2 monoclonal cell line has no background of spontaneous transformation or differentiation. Additionally, this cell line has been well characterized by others and has been shown to have the ability to differentiate along a smooth muscle cell lineage when supplemented with TGF-␤.20,21 Furthermore, utilization of the 10T1/2 cell line was advantageous when the

Riha et al 401

results of the current study were combined with the results of an earlier study performed in our laboratory that also used the 10T1/2 cell line. This earlier study, by Wang et al,19 demonstrated that, when 10T1/2 cells were exposed to steady physiologic fluid shear stress of 15 dyn/cm2 for 6 and 12 hours, they demonstrated significant increases in markers of endothelial cell differentiation. The marker CD31, a glycoprotein localized to the EC junction and used as a mature EC marker, was used for the current experiment as a negative control and did not show any appreciable mRNA increase in 10T1/2 cells exposed to cyclic strain. This finding contrasts sharply with our earlier shear stress experiments, which showed a 757-fold increase in CD31 mRNA levels without concomitant increases in markers of SMC differentiation when exposed to shear stress.19 Thus, the results of these 2 studies must be considered as evidence that 2 different hemodynamic forces may induce 2 very different vascular cell phenotypes from 1 starting progenitor cell population. This overall result from these 2 studies is exciting in regard to its implications for the importance of hemodynamic forces in general. Hemodynamic forces may be viewed as key factors for cellular differentiation in development and in vascular disease, as well as tools for innovative applications in vascular tissue engineering. In summary, our findings raise the possibility that cyclic strain induces the expression of 2 markers of a mature SMC phenotype at both the mRNA and protein levels in a murine embryonic mesenchymal progenitor cell line. These cells also demonstrated morphologic change toward the SMC phenotype. These findings implicate differentiation along a mature SMC lineage. Furthermore, this study suggests that cyclic strain and TGF-␤ may act together in a synergistic fashion to augment the expression of markers of SMC differentiation at the mRNA level. Overall, this study may serve as a reference point for understanding the effects of cyclic strain on progenitor cell differentiation; however, further research is necessary before full application may be realized. For example, a mature, engineered graft necessitates stable and permanent cellular differentiation. Future research within our laboratory will investigate extended cyclic strain time parameters and their effects on differentiation because of the time limitation of 6 days in the current study. Additional research into this arena will undoubtedly yield more information and provide instruments for further appreciation of hemodynamic forces in the realms of vascular disease and tissue engineering.

402 Riha et al

REFERENCES 1. Hoerstrup SP, Zund G, Sodian R, Schnell AM, Grunenfelder J, Turina MI. Tissue engineering of small caliber vascular grafts. Eur J Cardiothorac Surg 2001;20:164-9. 2. Niklason LE, Gao J, Abbott WM, Hirschi KK, Houser S, Marini R, Langer R. Functional arteries grown in vitro. Science 1999;284:489-3. 3. Niklason LE, Abbott W, Gao J, Klagges B, Hirschi KK, Ulubayram K, Conroy N, Jones R, Vasanawala A, Sanzgiri S, Langer R. Morphologic and mechanical characteristics of engineered bovine arteries. J Vasc Surg 2001:33: 628-38. 4. Beranek JT. Vascular endothelium-derived cells containing smooth muscle actin are present in restenosis. Lab Invest 1995:72:771. 5. Riha GM, Lin PH, Lumsden AB, Yao Q, Chen C. Review: application of stem cells for vascular tissue engineering. Tissue Eng 2005;11:1535-52. 6. Tock J, Van Putten V, Stenmark KR, Nemenoff RA. Induction of SM-alpha-actin expression by mechanical strain in adult vascular smooth muscle cells is mediated through activation of JNK and p38 MAP kinase. Biochem Biophys Res Commun 2003;301:1116-21. 7. Riha GM, Lin PH, Lumsden AB, Yao Q, Chen C. Roles of hemodynamic forces in vascular cell differentiation. Ann Biomed Eng 2005;33:772-9. 8. Birukov KG, Shirinsky VP, Stepanova OV, Tkachuk VA, Hahn AW, Resink TJ, Smirnov VN. Stretch affects phenotype and proliferation of vascular smooth muscle cells. Mol Cell Biochem 1995;144:131-9. 9. Reusch P, Wagdy H, Reusch R, Wilson E, Ives HE. Mechanical strain increases smooth muscle and decreases nonmuscle myosin expression in rat vascular smooth muscle cells. Circ Res 1996;79:1046-53. 10. Smith PG, Moreno R, Ikebe M. Strain increases airway smooth muscle contractile and cytoskeletal proteins in vitro. Am J Physiol 1997;272:L20-27. 11. Van Gieson EJ, Murfee WL, Skalak TC, Price RJ. Enhanced smooth muscle cell coverage of microvessels exposed to increased hemodynamic stresses in vivo. Circ Res 2003:92: 929-36. 12. Kanda K, Matsuda T. Behavior of arterial wall cells cultured on periodically stretched substrates. Cell Transplant 1993;2: 475-84.

Surgery March 2007

13. Stegemann JP, Nerem RM. Phenotype modulation in vascular tissue engineering using biochemical and mechanical stimulation. Ann Biomed Eng 2003;31:391-402. 14. Park JS, Chu JS, Cheng C, Chen F, Chen D, Li S. Differential effects of equiaxial and uniaxial strain on mesenchymal stem cells. Biotechnol Bioeng 2004;88:359-68. 15. Hamilton DW, Maul TM, Vorp DA. Characterization of the response of bone marrow-derived progenitor cells to cyclic strain: implications for vascular tissue-engineering applications. Tissue Eng 2004;10:361-69. 16. Taylor SM, Jones PA. Multiple new phenotypes induced in 10T1/2 and 3T3 cells treated with 5 azacytidine. Cell 1979;17:771-9. 17. Lu Y, Raptis L, Anderson S, Corbley MJ, Zhou YC, Pross H, Haliotis T. Ras modulates commitment and maturation of 10T1/2 fibroblasts to adipocytes. Biochem Cell Biol 1992; 70:1249-57. 18. Katagiri T, Yamaguchi A, Ikeda T, Yoshiki S, Wozney JM, Rosen V, Wang EA, Tanaka H, Omura S, Suda T. The non-osteogenic mouse pluripotent cell line, C3H10T1/2, is induced to differentiate into osteoblastic cells by recombinant human bone morphogenetic protein-2. Biochem Biophys Res Commun 1990;172:295-9. 19. Wang H, Riha GM, Yan S, Li M, Chai H, Yang H, Yao Q, Chen C. Shear stress induces endothelial differentiation from a murine embryonic mesenchymal progenitor cell line. Arter Throm Vasc Bio 2005;25:1817-23. 20. Hirschi KK, Rohovsky SA, D’Amore PA. PDGF, TGF-␤, and heterotypic cell-cell interactions mediate endothelial cellinduced recruitment of 10T1/2 cells and their differentiation to a smooth muscle cell fate. J Cell Bio 1998;141:805-14. 21. Sinha S, Hoofnagle MH, Kingston PA, McCanna ME, Owens GK. Transforming growth factor-␤1 signaling contributes to development of smooth muscle cells from embryonic stem cells. Am. J Physiol Cell Physiol 2004;287:C1560-8. 22. Albinsson S, Nordstrom I, Hellstrand P. Stretch of the vascular wall induces smooth muscle differentiation by promoting actin polymerization. J Biol Chem 2004;279:34849-55. 23. Zeidan A, Nordstrom I, Albinsson S, Malmqvist U, Sward K, Hellstrand P. Stretch-induced contractile differentiation of vascular smooth muscle: sensitivity to actin polymerization inhibitors. Am J Physiol Cell Physiol 2003;284:C1387-96. 24. Arciniegas E, Sutton AB, Allen TD, Schor AM. Transforming growth factor beta 1 promotes the differentiation of endothelial cells into smooth muscle-like cells in vitro. J Cell Science 1992;103:521-9.