- Email: [email protected]
Cyclic stretch influenced expression of membrane connexin 43 in human periodontal ligament cell
archives of oral biology 57 (2012) 1602–1608
Available online at www.sciencedirect.com
journal homepage: http://www.elsevier.com/locate/aob
Cyclic stretch influenced expression of membrane connexin 43 in human periodontal ligament cell Chun Xu a,b,d,*, Zhen Fan c,d, Wenting Shan a,b, Yi Hao a,b, Jiayin Ma a,b, Qingfeng Huang a,b, Fuqiang Zhang a,b,* a
Department of Prosthodontics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Shanghai Key Laboratory of Stomatology & Shanghai Research Institute of Stomatology, Shanghai, China c Department of Implantology, The Affiliated Stomatology Hospital of Tongji University, Shanghai, China b
article info
abstract
Article history:
Objective: Periodontal ligament (PDL) cells play an important role in preserving periodontal
Accepted 13 July 2012
homeostasis and periodontal remodelling in response to mechanical stimulations. Gap junction intercellular communication (GJIC) is essential for homeostasis and many other
Keywords:
biological processes of multicellular organisms. While the role of GJIC in mechanotransduc-
Connexin 43
tion of PDL cells remains largely unknown. In the present study, we examined the influence
Periodontal ligament cell
of cyclic stretch on the expression of membrane gap junction protein connexin 43 (Cx43) in cultured human PDL cells.
Stretch
Design: Cultured human PDL cells were exposed to 1%, 10% and 20% stretch strains for 0.5 h, 1 h and 24 h. Then the membrane Cx43 protein expression was measured by flow cytometry and the Cx43 mRNA level was measured by real-time polymerase chain reaction. Results: Half hour and 1 h cyclic stretches with strains up to 20% did not change the expression of membrane Cx43 protein, while 24 h cyclic stretches with 10% and 20% strains down-regulated the expression of membrane Cx43 protein in a strain magnitude-dependent manner. Furthermore, cyclic stretch also changed the Cx43 mRNA level and induced realignment in cells. Conclusion: The present research provide the first evidence that cyclic stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. # 2012 Elsevier Ltd. All rights reserved.
1.
Introduction
Periodontal ligament (PDL) is a specialized connective tissue that connects cementum and alveolar bone, and acts as the major element in tooth mobility and stress distribution to the supporting tissues.1 The predominant cell type in PDL is the PDL cell, which is generally believed to play an important role
in the process of preserving periodontal homeostasis and periodontal remodelling.2 During occlusal function or orthodontic tooth movement, PDL cells are directly subject to mechanical stress.3 Many studies have shown that mechanical stress induced biological changes in PDL cells and recent researches on mechanotransduction in PDL cells showed that focal adhesion,4 mitogen-activated protein kinases,5 cyclooxygenase-26 and some mechanical responsive genes7 were
* Corresponding authors at: Department of Prosthodontics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, 639 Zhizaoju Road, Shanghai 200011, China. Tel.: +86 21 23271699x5691; fax: +86 21 63162608. E-mail addresses: [email protected] (C. Xu), [email protected] (F. Zhang). d
These authors contributed equally to this work. Abbreviations: PDL, periodontal ligament; GJIC, gap junction intercellular communication; Cx43, connexin 43; FBS, foetal bovine serum; CSU, cell strain unit; PBS, phosphate buffered saline; PCR, polymerase chain reaction; ANOVA, analysis of variance. 0003–9969/$ – see front matter # 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.archoralbio.2012.07.002
archives of oral biology 57 (2012) 1602–1608
involved in the mechanical signal transduction. Our recent researches also demonstrated that cyclic stretch induced apoptosis in human PDL cells.8–10 Intercellular communication is critical for the evolution of organs and tissues, as well as the regulation of cell proliferation and apoptosis, and maintaining tissue homeostasis.11 Several forms of intercellular communication have been uncovered in animals, including communication with releasing soluble factors locally or distantly through receptors or nonreceptor mechanisms, communication through synapses, tight junctions, desmosomes, adherent junctions, and gap junctions.11 Gap junction is the only membrane channel in vertebrates which provides an enclosed conduct for direct diffusional exchange of ions and small molecules with molecular weights as high as 1000 Da between cells.12 This cell-cell diffusion is known as gap junction intercellular communication (GJIC), which is important for maintaining tissue homeostasis, the synchronization of cellular activities, and the regulation of cell proliferation and apoptosis.11 A gap junction is formed by two coupled hemichannels, or connexons, from two adjacent cells. Six connexins associate to form a connexon. Among the 21 connexins having been characterized in mammalian species, connexin 43 (Cx43) appears to be the most abundant and widespread.13 Specialized junction complexes including gap junctions have already been identified in PDL cells.14–16 The response of PDL tissue to mechanical stress in preserving periodontal homeostasis and in periodontal remodelling involves coordinated actions by different cell populations in PDL.3 It is reasonable to suppose that GJIC intermediated by gap junction proteins such as Cx43 may play a role in the mechanotransduction of PDL cells. Previous researches have already shown that mechanical stimulations influenced the Cx43 expression in osteocytes,17 vascular endothelium cells, vascular smooth muscle cells18 and cardiomyocytes19,20. Su et al. reported that the expressions of Cx43 protein and mRNA in rat PDL cells were changed after exposure to force during experimental tooth movement.21 To our knowledge, this is the only report to date on the relationship between gap junction and mechanical stimulation in PDL cells. As noted above, few researches have probed into the relationship between gap junction and mechanotransduction of PDL cells. The role of GJIC in mechanotransduction of PDL cells remains largely unknown. Based on previous findings on PDL cell’s mechanotransduction, we bring forward the hypothesis that the expression of Cx43 in PDL cell is responsive to mechanical stress. The present study examined the influence of cyclic stretch on the expression of membrane gap junction protein Cx43 in cultured human PDL cells through an in vitro cell stretch system (cell strain unit, CSU).
2.
Materials and methods
2.1.
Culture of human PDL cells
Human PDL cells were obtained from healthy premolars of two donors: one 12-year-old (female) and one 15-year-old (male) donor, after obtaining informed consents from their parents. 4 teeth, two from each donor were obtained. The protocol was
1603
approved by the Ethics Committee of Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine. Pieces of PDL were obtained from the middle of the roots with a sterile scalpel and were rinsed five times with Dulbecco’s modified Eagle media (DMEM; Gibco, Grand Island, NY, USA). Pieces of PDL were attached to a cell culture flask and cultured in DMEM supplemented with 20% (v/v) foetal bovine serum (FBS; Hyclone, Logan, Utah, USA) and five-fold reinforced antibiotics (500 U/ml penicillin, 500 mg/ml streptomycin, Sigma, St. Louis, MO, USA) at 37 8C in a humidified atmosphere of 5% CO2. Cells that grew out from the extracts were passaged in DMEM supplemented with 10% (v/v) FBS and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin).22 PDL cells at passage 4–6 were used in the present study.
2.2.
Stretch loading
Human PDL cells were stretched by using a cell strain unit (CSU) which has been described previously.9 The CSU includes a strainer, a controller and a personal computer. Cells were seeded in a flexible-bottomed culture dish (diameter 60 mm) whose bottom is made of elastic silicon rubber (Q7-4750, Dow Corning Co., Midland, MI, USA). A spherical cap moves up and down repeatedly and stretches cells attached on the bottom of culture dish by deforming the elastic silicon bottom. All changes in stretching strain and movement of the spherical cap are controlled by the controller and computer. Cells were seeded in the flexible-bottomed culture dishes at a concentration of 1.5 106 cells per dish and reached confluence following 3 days of culture, and then were exposed to 1%, 10% and 20% stretch strains for 0.5 h, 1 h and 24 h respectively (totally 12 groups including controls), at a frequency of 6 cycles/min, each cycle consisting of a 5 s stretch period followed by a 5 s relaxation period. The treatments were repeated 3 times in each group. Cells cultured in flexiblebottomed culture dishes placed in similar conditions but without stretch served as controls.
2.3.
Morphological observation
The morphological changes of cells were observed under an inverted phase-contrast microscope (Leica DMRIRB, Bensheim, Germany) before and after stretch.
2.4. Measurement of membrane Cx43 protein by flow cytometry After stretch, cells were gently trypsinized and washed once with cold phosphate buffered saline (PBS) and collected by centrifugation. Cells were then incubated in PBS containing 5% (w/v) bovine serum albumin (Fraction V, Sigma, St. Louis, MO, USA) for 30 min to block nonspecific binding sites. After three washes with PBS, cells were incubated with an IgG1 monoclonal mouse anti-Cx43 antibody (mAb 3068, Chemicon, Temecula, CA, USA) at a dilution of 1:300 for 1 h at room temperature. Cx43 antibody was detected by incubating with fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody (Jackson Immunoresearch, West Grove, PA, USA) at a dilution of 1:150 for 45 min at room temperature. Each step was followed by two washes with PBS. Flow cytometry was
1604
archives of oral biology 57 (2012) 1602–1608
performed on a FACSCalibur machine (Becton Dickinson, Franklin Lakes, NJ, USA). Data were analyzed using Cell Quest software. Compensation settings on the fluorescence-activated cell sorter were determined by using isotype controls (Serotec, Oxford, U.K.).
2.5.
RNA isolation and cDNA synthesis
Total RNA from cells in each group was isolated using the Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol and was quantified using ultraviolet spectrophotometry. The cDNA was synthesized using SuperScript VILO cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instruction.
2.6. (PCR)
the standard curve method.23 A standard curve with predetermined concentrations and serial diluted PCR amplification products was constructed for Cx43 gene and b-actin gene respectively, with the dilution of PCR amplification products from 1 100 to 1 104 for Cx43 gene or from 1 100 to 1 102 for b-actin gene. Cx43 gene expression was normalized to the internal control gene, b-actin.
2.7.
Statistical analysis
Results of flow cytometry analysis and real-time PCR analysis were presented as mean standard deviation of 3 separate experiments, and one-way analysis of variance (ANOVA) with least significance difference test comparison was used for statistical significance with P < 0.05.
Quantitative real-time polymerase chain reaction
Quantitative real-time PCR was used to measure the mRNA level of Cx43. The mRNA level of b-actin served as internal control. Primer sequences were as follows (F/R): Cx43 (50 CGCCTATGTCTCCTCCTGGGTA30 / b-actin 50 TCTGCTTGAAGGTCGCTGGTC30 ); (50 CCTGTACGCCAACACAGTGC30 / 50 ATACTCCTGCTTGCTGATCC30 ). Real-time PCR was performed in a Rotor-Gene 3000 real-time PCR system (Corbett Research, Sydney, Australia) with SyberGreen (Molecular Probes, Eugene, OR, USA). Amplification was performed as follows: 35 cycles of denaturation at 94 8C for 20 s, annealing at 60 8C for 20 s, and extension at 72 8C for 20 s. The reaction products of both Cx43 and b-actin mRNA were quantified by
3.
Results
3.1.
Stretch induced realignment of human PDL cells
Realignment of human PDL cells induced by stretch was observed by using an inverted phase-contrast microscope. After being stretched, human PDL cells inclined parallel to each other and aligned their long axis perpendicular to the stretching force vector. This phenomenon is more and more transparent with the extension of stretch duration and strain magnitude and is most transparent after 24 h stretch (Fig. 1). Almost all cells were parallel to each other, perpendicular to the stretching force vector and were elongated remarkably after being stretched with 20% strain for 24 h (Fig. 1d).
Fig. 1 – Stretch induced realignment of human PDL cells. Cells in control group (non-stretch, 24 h) aligned multidirectionally (a). After 24 h stretch with 1% strain, some cells were parallel to each other (b, as the red arrow shows). More cells were parallel to each other and aligned their long axis perpendicular to the direction of stretching force vector (represented by the white arrow) after 24 h stretch with 10% strain (c, as the red arrow shows). Almost all cells aligned unidirectionally, and aligned their long axis perpendicular to the stretching force vector after 24 h stretch with 20% strain (d, as the red arrow shows). Scale bars = 50 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
archives of oral biology 57 (2012) 1602–1608
1605
Fig. 2 – Represented diagrams of membrane Cx43 protein positive cell percentage after 24 h stretch measured by flow cytometry. Twenty four hour stretch with 10% strain decreased positive cell percentage from control’s 73.14% to 60.96%, while 24 h stretch with 20% strain decreased positive cell percentage further to 27.79%.
3.2. Stretch influenced the membrane Cx43 protein expression in human PDL cells As a functional gap junction is formed by a couple of connexons on the cytomembranes of adjacent two cells, we measured the percentage of membrane Cx43 protein positive human PDL cells
to examine the influence of cyclic stretch on gap junctions in PDL cells. Our data showed that 0.5 h and 1 h stretch with 1%, 10% and 20% strains did not change the membrane Cx43 protein positive cell percentage, while 24 h stretch with 10% and 20% strain decreased the positive cell percentage in a strain magnitude-dependent manner (Figs. 2 and 3).
Fig. 3 – Stretch influenced the membrane Cx43 protein expression in human PDL cells. After 0.5 h and 1 h stretch with 1%, 10% and 20% strains, there was no significant difference among membrane Cx43 protein positive cell percentages of stretch groups and control groups (P > 0.05). After 24 h stretch, the positive cell percentages of 10%–24 h group and 20%–24 h group were significantly lower than those of control group and 1%–24 h group (*P < 0.05, **P < 0.01). The positive cell percentage of 20%–24 h group was further lower than that of 10%–24 h group (**P < 0.01). There was no significant difference between the positive cell percentages of 1%–24 h group and control group (P > 0.05). Error bars stand for standard deviations (n = 3).
1606
archives of oral biology 57 (2012) 1602–1608
Fig. 4 – Stretch changed Cx43 mRNA level of human PDL cells. Error bars stand for standard deviations (n = 3).
3.3.
Stretch changed Cx43 mRNA level of human PDL cells
To investigate whether the change of membrane Cx43 protein expression in response to stretch showed in the present study is associated with the change of the synthesis of new Cx43 protein, we measured the Cx43 mRNA level with quantitative real-time PCR. Our data showed that cyclic stretch changed Cx43 mRNA level of human PDL cells (Fig. 4). Half hour stretch with 1%, 10% and 20% strains dramatically decreased the Cx43 mRNA level in PDL cells. After 1 h stretch with 1% strain, the Cx43 mRNA level increased dramatically and nearly doubled the control level, and then recovered to the control level after 24 h stretch. Cx43 mRNA level in 10%–1 h group also increased comparing with 0.5 h stretch group, but was still lower than control level, and then recovered to the control level after 24 h stretch. Cx43 mRNA of 20%–1 h group remained the same level with that of 0.5 h stretch group, but increased after 24 h stretch and was higher than control level.
4.
Discussion
Periodontal ligament is exposed to forces during mastication, parafunction, speech and orthodontic tooth movement. PDL cells are widely dispersed throughout the periodontal ligament, with their long axes parallel to the collagen fibrils and contact with collagen fibrils directly through integrin and extracellular matrix, so they will sense the mechanical strain generated in periodontal ligament by external force applied to teeth.3 The response of periodontal cells to mechanical stimulations is important in maintaining periodontal homeostasis and in periodontal remodelling.3 Gap junction intercellular communication is important for tissue homeostasis.11 Therefore, in this study we used a cell strain unit to investigate the influence of cyclic stretch on the expression of membrane gap junction protein Cx43 in cultured human PDL cells. It is believed that a stretch strain no higher than 24% is reasonable for in vitro cultured PDL cells to mimic the strain which may be confronted by in vivo PDL cells.24 Therefore, we chose stretch strains of 1%, 10% and 20% to load the cells, attempting to find whether there is a strain magnitude-dependent effect on Cx43
expression in human PDL cells. According to previous report,24 10% and 20% stretch strains used in this study may simulate those produced by traumatic occlusion or orthodontic force, while the 1% stretch strain may simulate that produced by normal mastication. Because only the connexins on the cell membrane can form connexons and then the gap junctions, we focused on the expression of membrane gap junction protein Cx43 in cultured human PDL cells, not the whole Cx43 protein expression in the cells, in the present study. Based on this circumstance, we measured the percentage of membrane Cx43 protein positive human PDL cells with flow cytometry, to examine the influence of cyclic stretch on gap junction in PDL cells. Our data demonstrated that short term (0.5 h, 1 h) stretch strain up to 20% did not change the expression of membrane Cx43 protein in human PDL cells, while a relative long term (24 h) stretch showed an inhibition effect on the expression of membrane Cx43 protein in human PDL cells in a strain magnitude-dependent manner. To the best of our knowledge, this is the first evidence that stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. Previous researches on GJIC and mechanotransduction also showed that mechanical stretch influenced the Cx43 expression in cultured vascular smooth muscle cells and cardiomyocytes. Cowan et al. reported that static 20% stretch increased mRNA and total protein level of Cx43 in cultured vascular smooth muscle cells.18 Wang et al. also reported similar finding in cultured rat cardiomyocytes exposed to cyclic 20% stretch at a frequency of 60 cycles/min.19 Yamada et al. showed that 1 h cyclic 10% stretch at a frequency of 3 Hz increased total Cx43 protein level in cytoplasm as well as Cx43 immunoreactive signal at gap junctions in cultured rat ventricular myocytes, and suggested that increased synthesis and/or decreased degradation of Cx43 might have contributed to the change of membrane Cx43 protein expression in response to stretch.20 The difference between these previous reports and our present data may be attributed to the different frequencies of stretch and cell types used in these previous researches and our present research. However, a recently published ex vivo study by He and Schroff showing that 6 h and 24 h cyclic stretch decreased Cx43 protein level in ex vivo cultured rabbit thoracic aortas supports our results.25
archives of oral biology 57 (2012) 1602–1608
Su et al. reported that compression generated by experimental tooth movement resulted in the abundance of Cx43 proteins in the cytoplasm, but not on the plasma membrane, of rat PDL cells, and also induced the expression of Cx43 mRNA in cytoplasm, and suggested that new synthesis of Cx43 protein occurred in rat PDL cells in response to compression.21 In the present study, we measured the Cx43 mRNA level with quantitative real-time PCR and showed that cyclic stretch with 1%, 10% and 20% strains did change the Cx43 mRNA level in PDL cells (Fig. 4), but these changes of Cx43 mRNA level are not perfectly consistent with those of membrane Cx43 proteins expression, suggesting that synthesis of new Cx43 protein may not be the only reason for the stretch-induced change of membrane Cx43 protein expression in PDL cells. In the present study, we observed a realignment of human PDL cells induced by stretch, which is similar to results of previous researches carried out on human PDL cells under similar stretch conditions.22,26 Human PDL cells inclined parallel to each other and aligned their long axes perpendicular to the stretching force vector after being stretched (Fig. 1). Confluent cells were exposed to stretch or used as control in our present study, therefore there should be well established gap junctions on the plasma membranes of cells before stretch loading. The constant high percentage (>70%) of membrane Cx43 protein positive cells in the non-stretch control group (Fig. 3) suggested the presence of gap junctions on the plasma membranes. While the realignment of cells induced by stretch will inevitably result in the dissociation of existing gap junctions. Taking into account both the synthesis of new Cx43 protein and the dissociation of gap junction, it will be easier to explain the stretch-induced change of membrane Cx43 protein expression. During the 24 h observation period, the alignment of control cells did not change much (Fig. 1a) and the Cx43 mRNA level also remained stable, suggesting that the dissociation of gap junction and synthesis of new Cx43 protein might have reached a balance, which may explain the constant expression of the Cx43 proteins on their plasma membranes. Stretch with 1% strain only induced a few cells to realign (Fig. 1b), so the dissociation of the previously established gap junctions should be at a low level. What is more, the synthesis of new Cx43 protein suggested by increased Cx43 mRNA level after 1 h stretch with 1% strain might also have compensated the dissociation of gap junctions. These may explain the stable expression of membrane Cx43 protein in PDL cells stretched with 1% strain. The realignment in PDL cells stretched with 10% and 20% strains was prominent, especially after 24 h stretch (Fig. 1c and d), therefore many previously established gap junctions might have been dissociated during the realignment. Although their Cx43 mRNA level recovered from a lower level to the control level or even higher level after 24 h stretch, the synthesis of the new Cx43 protein might still cannot catch up with the dissociation of the gap junction. This might have resulted in the decreased membrane Cx43 proteins expression after 24 h stretch. Our recent research showed that 24 h stretch with 10% and 20% strains induced notable apoptosis in PDL cells in a strain magnitude-dependent manner.9 This finding and our present result both suggest the important role of gap junction in the mechanism of maintaining periodontal homeostasis by PDL cells in response to mechanical stimulations. High
1607
magnitude mechanical stimulations resulting from traumatic occlusion or excessive orthodontic force to teeth may interrupt the GJIC of PDL cells. Numerous studies of failing human myocardium due to long term unphysiological mechanical load demonstrating down-regulation of Cx43 and gap junctions also support our view from another point.27,28 In summary, we provided the first evidence that cyclic stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. Both the change in synthesis of new Cx43 protein and the dissociation of gap junction in response to stretch might have contributed to this stretch-induced change of the membrane Cx43 protein expression. Further studies are needed to probe into the signalling pathways regulating or regulated by the GJIC of PDL cells upon mechanical stimulations.
Funding None.
Competing interests None.
Ethical approval The experimental protocol was approved by the Ethics Committee, Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine. The relevant Judgement’s reference number: [2008]17.
Acknowledgements This research was supported by grants from National Natural Science Foundation of China (Project no. 30900282), Science and Technology Commission of Shanghai (Project nos. 10QA1404200, 08411961500, 07ZR14070), Shanghai Leading Academic Discipline Project (Project nos. S30206-sms02, T0202), and China Postdoctoral Science Foundation (Project no. 2005037137).
references
1. Pini M, Zysset P, Botsis J, Contro R. Tensile and compressive behavior of the bovine periodontal ligament. Journal of Biomechanics 2004;37:111–9. 2. Lekic P, McCulloch CA. Periodontal ligament cell population: the central role of fibroblasts in creating a unique tissue. Anatomical Record 1996;245:327–41. 3. McCulloch CA, Lekic P, McKee MD. Role of physical forces in regulating the form and function of the periodontal ligament. Periodontology 2000;24:56–72. 4. Molina T, Kabsch K, Alonso A, Kohl A, Komposch G, Tomakidi P. Topographic changes of focal adhesion components and modulation of p125FAK activation in
1608
5.
6.
7.
8.
9.
10.
11. 12. 13.
14.
15.
16.
17.
archives of oral biology 57 (2012) 1602–1608
stretched human periodontal ligament fibroblasts. Journal of Dental Research 2001;80:1984–9. Matsuda N, Morita N, Matsuda K, Watanabe M. Proliferation and differentiation of human osteoblastic cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochemical and Biophysical Research Communications 1998;24:9350–4. Shimizu N, Ozawa Y, Yamaguchi M, Goseki T, Ohzeki K, Abiko Y. Induction of COX-2 expression by mechanical tension force in human periodontal ligament cells. Journal of Periodontology 1998;69:670–7. Myokai F, Oyama M, Nishimura F, Ohira T, Yamamoto T, Arai H, et al. Unique genes induced by mechanical stress in periodontal ligament cells. Journal of Periodontal Research 2003;38:255–61. Zhong W, Xu C, Zhang F, Zhang X, Jiang X, Ye D. Cyclic stretching force-induced early apoptosis in human periodontal ligament cells. Oral Diseases 2008;14:270–6. Hao Y, Xu C, Sun SY, Zhang FQ. Cyclic stretching force induces apoptosis in human periodontal ligament cells via caspase-9. Archives of Oral Biology 2009;54:864–70. Xu C, Hao Y, Wei B, Ma J, Li J, Huang Q, et al. Apoptotic gene expression by human periodontal ligament cells following cyclic stretch. Journal of Periodontal Research 2011;46:742–8. Ruch RJ. Intercellular communication, homeostasis, and toxicology. Toxicological Sciences 2002;68:265–6. Spray DC. Gap junction proteins: where they live and how they die. Circulation Research 1998;83:679–81. Laing JG, Chou BC, Steinberg TH. ZO-1 alters the plasma membrane localization and function of Cx43 in osteoblastic cells. Journal of Cell Science 2005;118:2167–76. Beertsen W, Everts V. Junctions between fibroblasts in mouse periodontal ligament. Journal of Periodontal Research 1980;15:524–41. Shore RC, Berkovitz BK, Moxham BJ. Intercellular contacts between fibroblasts in the periodontal connective tissues of the rat. Journal of Anatomy 1981;133:67–76. Yamaoka Y, Sawa Y, Ebata N, Ibuki N, Yoshida S, Kawasaki T. Double expressions of connexin 43 and 32 in human periodontal ligament fibroblasts. Tissue and Cell 2000;32: 328–35. Cherian PP, Siller-Jackson AJ, Gu S, Wang X, Bonewald LF, Sprague E, et al. Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
release of prostaglandin. Molecular Biology of the Cell 2005;16:3100–6. Cowan DB, Lye SJ, Langille BL. Regulation of vascular connexin43 gene expression by mechanical loads. Circulation Research 1998;82:786–93. Wang TL, Tseng YZ, Chang H. Regulation of connexin 43 gene expression by cyclical mechanical stretch in neonatal rat cardiomyocytes. Biochemical and Biophysical Research Communications 2000;267:551–7. Yamada K, Green KG, Samarel AM, Saffitz JE. Distinct pathways regulate expression of cardiac electrical and mechanical junction proteins in response to stretch. Circulation Research 2005;97:346–53. Su M, Borke JL, Donahue HJ, Li Z, Warshawsky NM, Russell CM, et al. Expression of connexin 43 in rat mandibular bone and periodontal ligament (PDL) cells during experimental tooth movement. Journal of Dental Research 1997;76:1357–66. Chiba M, Mitani H. Cytoskeletal changes and the system of regulation of alkaline phosphatase activity in human periodontal ligament cells induced by mechanical stress. Cell Biochemistry and Function 2004;22:249–56. Muthukuru M, Jotwani R, Cutler CW. Oral mucosal endotoxin tolerance induction in chronic periodontitis. Infection and Immunity 2005;73:687–94. Yamaguchi M, Shimizu N, Goseki T, Shibata Y, Takiguchi H, Iwasawa T, et al. Effect of different magnitudes of tension force on prostaglandin E2 production by human periodontal ligament cells. Archives of Oral Biology 1994;39:877–84. He Y, Shroff SG. Cyclic stretch downregulates arterial vascular connexin43 protein expression: an ex vivo study. Biomechanics and Modeling in Mechanobiology 2010;9:203–11. Matsuda N, Yokoyama K, Takeshita S, Watanabe M. Role of epidermal growth factor and its receptor in mechanical stress-induced differentiation of human periodontal ligament cells in vitro. Archives of Oral Biology 1998;43: 987–97. Kostin S, Rieger M, Dammer S, Hein S, Richter M, Klo¨vekorn WP, et al. Gap junction remodeling and altered connexin43 expression in the failing human heart. Molecular and Cellular Biochemistry 2003;242:135–44. Kostin S, Dammer S, Hein S, Klo¨vekorn WP, Bauer EP, Schaper J. Connexin 43 expression and distribution in compensated and decompensated cardiac hypertrophy in patients with aortic stenosis. Cardiovascular Research 2004;62:426–36.
Available online at www.sciencedirect.com
journal homepage: http://www.elsevier.com/locate/aob
Cyclic stretch influenced expression of membrane connexin 43 in human periodontal ligament cell Chun Xu a,b,d,*, Zhen Fan c,d, Wenting Shan a,b, Yi Hao a,b, Jiayin Ma a,b, Qingfeng Huang a,b, Fuqiang Zhang a,b,* a
Department of Prosthodontics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Shanghai Key Laboratory of Stomatology & Shanghai Research Institute of Stomatology, Shanghai, China c Department of Implantology, The Affiliated Stomatology Hospital of Tongji University, Shanghai, China b
article info
abstract
Article history:
Objective: Periodontal ligament (PDL) cells play an important role in preserving periodontal
Accepted 13 July 2012
homeostasis and periodontal remodelling in response to mechanical stimulations. Gap junction intercellular communication (GJIC) is essential for homeostasis and many other
Keywords:
biological processes of multicellular organisms. While the role of GJIC in mechanotransduc-
Connexin 43
tion of PDL cells remains largely unknown. In the present study, we examined the influence
Periodontal ligament cell
of cyclic stretch on the expression of membrane gap junction protein connexin 43 (Cx43) in cultured human PDL cells.
Stretch
Design: Cultured human PDL cells were exposed to 1%, 10% and 20% stretch strains for 0.5 h, 1 h and 24 h. Then the membrane Cx43 protein expression was measured by flow cytometry and the Cx43 mRNA level was measured by real-time polymerase chain reaction. Results: Half hour and 1 h cyclic stretches with strains up to 20% did not change the expression of membrane Cx43 protein, while 24 h cyclic stretches with 10% and 20% strains down-regulated the expression of membrane Cx43 protein in a strain magnitude-dependent manner. Furthermore, cyclic stretch also changed the Cx43 mRNA level and induced realignment in cells. Conclusion: The present research provide the first evidence that cyclic stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. # 2012 Elsevier Ltd. All rights reserved.
1.
Introduction
Periodontal ligament (PDL) is a specialized connective tissue that connects cementum and alveolar bone, and acts as the major element in tooth mobility and stress distribution to the supporting tissues.1 The predominant cell type in PDL is the PDL cell, which is generally believed to play an important role
in the process of preserving periodontal homeostasis and periodontal remodelling.2 During occlusal function or orthodontic tooth movement, PDL cells are directly subject to mechanical stress.3 Many studies have shown that mechanical stress induced biological changes in PDL cells and recent researches on mechanotransduction in PDL cells showed that focal adhesion,4 mitogen-activated protein kinases,5 cyclooxygenase-26 and some mechanical responsive genes7 were
* Corresponding authors at: Department of Prosthodontics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, 639 Zhizaoju Road, Shanghai 200011, China. Tel.: +86 21 23271699x5691; fax: +86 21 63162608. E-mail addresses: [email protected] (C. Xu), [email protected] (F. Zhang). d
These authors contributed equally to this work. Abbreviations: PDL, periodontal ligament; GJIC, gap junction intercellular communication; Cx43, connexin 43; FBS, foetal bovine serum; CSU, cell strain unit; PBS, phosphate buffered saline; PCR, polymerase chain reaction; ANOVA, analysis of variance. 0003–9969/$ – see front matter # 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.archoralbio.2012.07.002
archives of oral biology 57 (2012) 1602–1608
involved in the mechanical signal transduction. Our recent researches also demonstrated that cyclic stretch induced apoptosis in human PDL cells.8–10 Intercellular communication is critical for the evolution of organs and tissues, as well as the regulation of cell proliferation and apoptosis, and maintaining tissue homeostasis.11 Several forms of intercellular communication have been uncovered in animals, including communication with releasing soluble factors locally or distantly through receptors or nonreceptor mechanisms, communication through synapses, tight junctions, desmosomes, adherent junctions, and gap junctions.11 Gap junction is the only membrane channel in vertebrates which provides an enclosed conduct for direct diffusional exchange of ions and small molecules with molecular weights as high as 1000 Da between cells.12 This cell-cell diffusion is known as gap junction intercellular communication (GJIC), which is important for maintaining tissue homeostasis, the synchronization of cellular activities, and the regulation of cell proliferation and apoptosis.11 A gap junction is formed by two coupled hemichannels, or connexons, from two adjacent cells. Six connexins associate to form a connexon. Among the 21 connexins having been characterized in mammalian species, connexin 43 (Cx43) appears to be the most abundant and widespread.13 Specialized junction complexes including gap junctions have already been identified in PDL cells.14–16 The response of PDL tissue to mechanical stress in preserving periodontal homeostasis and in periodontal remodelling involves coordinated actions by different cell populations in PDL.3 It is reasonable to suppose that GJIC intermediated by gap junction proteins such as Cx43 may play a role in the mechanotransduction of PDL cells. Previous researches have already shown that mechanical stimulations influenced the Cx43 expression in osteocytes,17 vascular endothelium cells, vascular smooth muscle cells18 and cardiomyocytes19,20. Su et al. reported that the expressions of Cx43 protein and mRNA in rat PDL cells were changed after exposure to force during experimental tooth movement.21 To our knowledge, this is the only report to date on the relationship between gap junction and mechanical stimulation in PDL cells. As noted above, few researches have probed into the relationship between gap junction and mechanotransduction of PDL cells. The role of GJIC in mechanotransduction of PDL cells remains largely unknown. Based on previous findings on PDL cell’s mechanotransduction, we bring forward the hypothesis that the expression of Cx43 in PDL cell is responsive to mechanical stress. The present study examined the influence of cyclic stretch on the expression of membrane gap junction protein Cx43 in cultured human PDL cells through an in vitro cell stretch system (cell strain unit, CSU).
2.
Materials and methods
2.1.
Culture of human PDL cells
Human PDL cells were obtained from healthy premolars of two donors: one 12-year-old (female) and one 15-year-old (male) donor, after obtaining informed consents from their parents. 4 teeth, two from each donor were obtained. The protocol was
1603
approved by the Ethics Committee of Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine. Pieces of PDL were obtained from the middle of the roots with a sterile scalpel and were rinsed five times with Dulbecco’s modified Eagle media (DMEM; Gibco, Grand Island, NY, USA). Pieces of PDL were attached to a cell culture flask and cultured in DMEM supplemented with 20% (v/v) foetal bovine serum (FBS; Hyclone, Logan, Utah, USA) and five-fold reinforced antibiotics (500 U/ml penicillin, 500 mg/ml streptomycin, Sigma, St. Louis, MO, USA) at 37 8C in a humidified atmosphere of 5% CO2. Cells that grew out from the extracts were passaged in DMEM supplemented with 10% (v/v) FBS and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin).22 PDL cells at passage 4–6 were used in the present study.
2.2.
Stretch loading
Human PDL cells were stretched by using a cell strain unit (CSU) which has been described previously.9 The CSU includes a strainer, a controller and a personal computer. Cells were seeded in a flexible-bottomed culture dish (diameter 60 mm) whose bottom is made of elastic silicon rubber (Q7-4750, Dow Corning Co., Midland, MI, USA). A spherical cap moves up and down repeatedly and stretches cells attached on the bottom of culture dish by deforming the elastic silicon bottom. All changes in stretching strain and movement of the spherical cap are controlled by the controller and computer. Cells were seeded in the flexible-bottomed culture dishes at a concentration of 1.5 106 cells per dish and reached confluence following 3 days of culture, and then were exposed to 1%, 10% and 20% stretch strains for 0.5 h, 1 h and 24 h respectively (totally 12 groups including controls), at a frequency of 6 cycles/min, each cycle consisting of a 5 s stretch period followed by a 5 s relaxation period. The treatments were repeated 3 times in each group. Cells cultured in flexiblebottomed culture dishes placed in similar conditions but without stretch served as controls.
2.3.
Morphological observation
The morphological changes of cells were observed under an inverted phase-contrast microscope (Leica DMRIRB, Bensheim, Germany) before and after stretch.
2.4. Measurement of membrane Cx43 protein by flow cytometry After stretch, cells were gently trypsinized and washed once with cold phosphate buffered saline (PBS) and collected by centrifugation. Cells were then incubated in PBS containing 5% (w/v) bovine serum albumin (Fraction V, Sigma, St. Louis, MO, USA) for 30 min to block nonspecific binding sites. After three washes with PBS, cells were incubated with an IgG1 monoclonal mouse anti-Cx43 antibody (mAb 3068, Chemicon, Temecula, CA, USA) at a dilution of 1:300 for 1 h at room temperature. Cx43 antibody was detected by incubating with fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody (Jackson Immunoresearch, West Grove, PA, USA) at a dilution of 1:150 for 45 min at room temperature. Each step was followed by two washes with PBS. Flow cytometry was
1604
archives of oral biology 57 (2012) 1602–1608
performed on a FACSCalibur machine (Becton Dickinson, Franklin Lakes, NJ, USA). Data were analyzed using Cell Quest software. Compensation settings on the fluorescence-activated cell sorter were determined by using isotype controls (Serotec, Oxford, U.K.).
2.5.
RNA isolation and cDNA synthesis
Total RNA from cells in each group was isolated using the Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol and was quantified using ultraviolet spectrophotometry. The cDNA was synthesized using SuperScript VILO cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instruction.
2.6. (PCR)
the standard curve method.23 A standard curve with predetermined concentrations and serial diluted PCR amplification products was constructed for Cx43 gene and b-actin gene respectively, with the dilution of PCR amplification products from 1 100 to 1 104 for Cx43 gene or from 1 100 to 1 102 for b-actin gene. Cx43 gene expression was normalized to the internal control gene, b-actin.
2.7.
Statistical analysis
Results of flow cytometry analysis and real-time PCR analysis were presented as mean standard deviation of 3 separate experiments, and one-way analysis of variance (ANOVA) with least significance difference test comparison was used for statistical significance with P < 0.05.
Quantitative real-time polymerase chain reaction
Quantitative real-time PCR was used to measure the mRNA level of Cx43. The mRNA level of b-actin served as internal control. Primer sequences were as follows (F/R): Cx43 (50 CGCCTATGTCTCCTCCTGGGTA30 / b-actin 50 TCTGCTTGAAGGTCGCTGGTC30 ); (50 CCTGTACGCCAACACAGTGC30 / 50 ATACTCCTGCTTGCTGATCC30 ). Real-time PCR was performed in a Rotor-Gene 3000 real-time PCR system (Corbett Research, Sydney, Australia) with SyberGreen (Molecular Probes, Eugene, OR, USA). Amplification was performed as follows: 35 cycles of denaturation at 94 8C for 20 s, annealing at 60 8C for 20 s, and extension at 72 8C for 20 s. The reaction products of both Cx43 and b-actin mRNA were quantified by
3.
Results
3.1.
Stretch induced realignment of human PDL cells
Realignment of human PDL cells induced by stretch was observed by using an inverted phase-contrast microscope. After being stretched, human PDL cells inclined parallel to each other and aligned their long axis perpendicular to the stretching force vector. This phenomenon is more and more transparent with the extension of stretch duration and strain magnitude and is most transparent after 24 h stretch (Fig. 1). Almost all cells were parallel to each other, perpendicular to the stretching force vector and were elongated remarkably after being stretched with 20% strain for 24 h (Fig. 1d).
Fig. 1 – Stretch induced realignment of human PDL cells. Cells in control group (non-stretch, 24 h) aligned multidirectionally (a). After 24 h stretch with 1% strain, some cells were parallel to each other (b, as the red arrow shows). More cells were parallel to each other and aligned their long axis perpendicular to the direction of stretching force vector (represented by the white arrow) after 24 h stretch with 10% strain (c, as the red arrow shows). Almost all cells aligned unidirectionally, and aligned their long axis perpendicular to the stretching force vector after 24 h stretch with 20% strain (d, as the red arrow shows). Scale bars = 50 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
archives of oral biology 57 (2012) 1602–1608
1605
Fig. 2 – Represented diagrams of membrane Cx43 protein positive cell percentage after 24 h stretch measured by flow cytometry. Twenty four hour stretch with 10% strain decreased positive cell percentage from control’s 73.14% to 60.96%, while 24 h stretch with 20% strain decreased positive cell percentage further to 27.79%.
3.2. Stretch influenced the membrane Cx43 protein expression in human PDL cells As a functional gap junction is formed by a couple of connexons on the cytomembranes of adjacent two cells, we measured the percentage of membrane Cx43 protein positive human PDL cells
to examine the influence of cyclic stretch on gap junctions in PDL cells. Our data showed that 0.5 h and 1 h stretch with 1%, 10% and 20% strains did not change the membrane Cx43 protein positive cell percentage, while 24 h stretch with 10% and 20% strain decreased the positive cell percentage in a strain magnitude-dependent manner (Figs. 2 and 3).
Fig. 3 – Stretch influenced the membrane Cx43 protein expression in human PDL cells. After 0.5 h and 1 h stretch with 1%, 10% and 20% strains, there was no significant difference among membrane Cx43 protein positive cell percentages of stretch groups and control groups (P > 0.05). After 24 h stretch, the positive cell percentages of 10%–24 h group and 20%–24 h group were significantly lower than those of control group and 1%–24 h group (*P < 0.05, **P < 0.01). The positive cell percentage of 20%–24 h group was further lower than that of 10%–24 h group (**P < 0.01). There was no significant difference between the positive cell percentages of 1%–24 h group and control group (P > 0.05). Error bars stand for standard deviations (n = 3).
1606
archives of oral biology 57 (2012) 1602–1608
Fig. 4 – Stretch changed Cx43 mRNA level of human PDL cells. Error bars stand for standard deviations (n = 3).
3.3.
Stretch changed Cx43 mRNA level of human PDL cells
To investigate whether the change of membrane Cx43 protein expression in response to stretch showed in the present study is associated with the change of the synthesis of new Cx43 protein, we measured the Cx43 mRNA level with quantitative real-time PCR. Our data showed that cyclic stretch changed Cx43 mRNA level of human PDL cells (Fig. 4). Half hour stretch with 1%, 10% and 20% strains dramatically decreased the Cx43 mRNA level in PDL cells. After 1 h stretch with 1% strain, the Cx43 mRNA level increased dramatically and nearly doubled the control level, and then recovered to the control level after 24 h stretch. Cx43 mRNA level in 10%–1 h group also increased comparing with 0.5 h stretch group, but was still lower than control level, and then recovered to the control level after 24 h stretch. Cx43 mRNA of 20%–1 h group remained the same level with that of 0.5 h stretch group, but increased after 24 h stretch and was higher than control level.
4.
Discussion
Periodontal ligament is exposed to forces during mastication, parafunction, speech and orthodontic tooth movement. PDL cells are widely dispersed throughout the periodontal ligament, with their long axes parallel to the collagen fibrils and contact with collagen fibrils directly through integrin and extracellular matrix, so they will sense the mechanical strain generated in periodontal ligament by external force applied to teeth.3 The response of periodontal cells to mechanical stimulations is important in maintaining periodontal homeostasis and in periodontal remodelling.3 Gap junction intercellular communication is important for tissue homeostasis.11 Therefore, in this study we used a cell strain unit to investigate the influence of cyclic stretch on the expression of membrane gap junction protein Cx43 in cultured human PDL cells. It is believed that a stretch strain no higher than 24% is reasonable for in vitro cultured PDL cells to mimic the strain which may be confronted by in vivo PDL cells.24 Therefore, we chose stretch strains of 1%, 10% and 20% to load the cells, attempting to find whether there is a strain magnitude-dependent effect on Cx43
expression in human PDL cells. According to previous report,24 10% and 20% stretch strains used in this study may simulate those produced by traumatic occlusion or orthodontic force, while the 1% stretch strain may simulate that produced by normal mastication. Because only the connexins on the cell membrane can form connexons and then the gap junctions, we focused on the expression of membrane gap junction protein Cx43 in cultured human PDL cells, not the whole Cx43 protein expression in the cells, in the present study. Based on this circumstance, we measured the percentage of membrane Cx43 protein positive human PDL cells with flow cytometry, to examine the influence of cyclic stretch on gap junction in PDL cells. Our data demonstrated that short term (0.5 h, 1 h) stretch strain up to 20% did not change the expression of membrane Cx43 protein in human PDL cells, while a relative long term (24 h) stretch showed an inhibition effect on the expression of membrane Cx43 protein in human PDL cells in a strain magnitude-dependent manner. To the best of our knowledge, this is the first evidence that stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. Previous researches on GJIC and mechanotransduction also showed that mechanical stretch influenced the Cx43 expression in cultured vascular smooth muscle cells and cardiomyocytes. Cowan et al. reported that static 20% stretch increased mRNA and total protein level of Cx43 in cultured vascular smooth muscle cells.18 Wang et al. also reported similar finding in cultured rat cardiomyocytes exposed to cyclic 20% stretch at a frequency of 60 cycles/min.19 Yamada et al. showed that 1 h cyclic 10% stretch at a frequency of 3 Hz increased total Cx43 protein level in cytoplasm as well as Cx43 immunoreactive signal at gap junctions in cultured rat ventricular myocytes, and suggested that increased synthesis and/or decreased degradation of Cx43 might have contributed to the change of membrane Cx43 protein expression in response to stretch.20 The difference between these previous reports and our present data may be attributed to the different frequencies of stretch and cell types used in these previous researches and our present research. However, a recently published ex vivo study by He and Schroff showing that 6 h and 24 h cyclic stretch decreased Cx43 protein level in ex vivo cultured rabbit thoracic aortas supports our results.25
archives of oral biology 57 (2012) 1602–1608
Su et al. reported that compression generated by experimental tooth movement resulted in the abundance of Cx43 proteins in the cytoplasm, but not on the plasma membrane, of rat PDL cells, and also induced the expression of Cx43 mRNA in cytoplasm, and suggested that new synthesis of Cx43 protein occurred in rat PDL cells in response to compression.21 In the present study, we measured the Cx43 mRNA level with quantitative real-time PCR and showed that cyclic stretch with 1%, 10% and 20% strains did change the Cx43 mRNA level in PDL cells (Fig. 4), but these changes of Cx43 mRNA level are not perfectly consistent with those of membrane Cx43 proteins expression, suggesting that synthesis of new Cx43 protein may not be the only reason for the stretch-induced change of membrane Cx43 protein expression in PDL cells. In the present study, we observed a realignment of human PDL cells induced by stretch, which is similar to results of previous researches carried out on human PDL cells under similar stretch conditions.22,26 Human PDL cells inclined parallel to each other and aligned their long axes perpendicular to the stretching force vector after being stretched (Fig. 1). Confluent cells were exposed to stretch or used as control in our present study, therefore there should be well established gap junctions on the plasma membranes of cells before stretch loading. The constant high percentage (>70%) of membrane Cx43 protein positive cells in the non-stretch control group (Fig. 3) suggested the presence of gap junctions on the plasma membranes. While the realignment of cells induced by stretch will inevitably result in the dissociation of existing gap junctions. Taking into account both the synthesis of new Cx43 protein and the dissociation of gap junction, it will be easier to explain the stretch-induced change of membrane Cx43 protein expression. During the 24 h observation period, the alignment of control cells did not change much (Fig. 1a) and the Cx43 mRNA level also remained stable, suggesting that the dissociation of gap junction and synthesis of new Cx43 protein might have reached a balance, which may explain the constant expression of the Cx43 proteins on their plasma membranes. Stretch with 1% strain only induced a few cells to realign (Fig. 1b), so the dissociation of the previously established gap junctions should be at a low level. What is more, the synthesis of new Cx43 protein suggested by increased Cx43 mRNA level after 1 h stretch with 1% strain might also have compensated the dissociation of gap junctions. These may explain the stable expression of membrane Cx43 protein in PDL cells stretched with 1% strain. The realignment in PDL cells stretched with 10% and 20% strains was prominent, especially after 24 h stretch (Fig. 1c and d), therefore many previously established gap junctions might have been dissociated during the realignment. Although their Cx43 mRNA level recovered from a lower level to the control level or even higher level after 24 h stretch, the synthesis of the new Cx43 protein might still cannot catch up with the dissociation of the gap junction. This might have resulted in the decreased membrane Cx43 proteins expression after 24 h stretch. Our recent research showed that 24 h stretch with 10% and 20% strains induced notable apoptosis in PDL cells in a strain magnitude-dependent manner.9 This finding and our present result both suggest the important role of gap junction in the mechanism of maintaining periodontal homeostasis by PDL cells in response to mechanical stimulations. High
1607
magnitude mechanical stimulations resulting from traumatic occlusion or excessive orthodontic force to teeth may interrupt the GJIC of PDL cells. Numerous studies of failing human myocardium due to long term unphysiological mechanical load demonstrating down-regulation of Cx43 and gap junctions also support our view from another point.27,28 In summary, we provided the first evidence that cyclic stretch influenced the membrane Cx43 protein expression in cultured human PDL cells. Both the change in synthesis of new Cx43 protein and the dissociation of gap junction in response to stretch might have contributed to this stretch-induced change of the membrane Cx43 protein expression. Further studies are needed to probe into the signalling pathways regulating or regulated by the GJIC of PDL cells upon mechanical stimulations.
Funding None.
Competing interests None.
Ethical approval The experimental protocol was approved by the Ethics Committee, Ninth People’s Hospital, Shanghai JiaoTong University School of Medicine. The relevant Judgement’s reference number: [2008]17.
Acknowledgements This research was supported by grants from National Natural Science Foundation of China (Project no. 30900282), Science and Technology Commission of Shanghai (Project nos. 10QA1404200, 08411961500, 07ZR14070), Shanghai Leading Academic Discipline Project (Project nos. S30206-sms02, T0202), and China Postdoctoral Science Foundation (Project no. 2005037137).
references
1. Pini M, Zysset P, Botsis J, Contro R. Tensile and compressive behavior of the bovine periodontal ligament. Journal of Biomechanics 2004;37:111–9. 2. Lekic P, McCulloch CA. Periodontal ligament cell population: the central role of fibroblasts in creating a unique tissue. Anatomical Record 1996;245:327–41. 3. McCulloch CA, Lekic P, McKee MD. Role of physical forces in regulating the form and function of the periodontal ligament. Periodontology 2000;24:56–72. 4. Molina T, Kabsch K, Alonso A, Kohl A, Komposch G, Tomakidi P. Topographic changes of focal adhesion components and modulation of p125FAK activation in
1608
5.
6.
7.
8.
9.
10.
11. 12. 13.
14.
15.
16.
17.
archives of oral biology 57 (2012) 1602–1608
stretched human periodontal ligament fibroblasts. Journal of Dental Research 2001;80:1984–9. Matsuda N, Morita N, Matsuda K, Watanabe M. Proliferation and differentiation of human osteoblastic cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochemical and Biophysical Research Communications 1998;24:9350–4. Shimizu N, Ozawa Y, Yamaguchi M, Goseki T, Ohzeki K, Abiko Y. Induction of COX-2 expression by mechanical tension force in human periodontal ligament cells. Journal of Periodontology 1998;69:670–7. Myokai F, Oyama M, Nishimura F, Ohira T, Yamamoto T, Arai H, et al. Unique genes induced by mechanical stress in periodontal ligament cells. Journal of Periodontal Research 2003;38:255–61. Zhong W, Xu C, Zhang F, Zhang X, Jiang X, Ye D. Cyclic stretching force-induced early apoptosis in human periodontal ligament cells. Oral Diseases 2008;14:270–6. Hao Y, Xu C, Sun SY, Zhang FQ. Cyclic stretching force induces apoptosis in human periodontal ligament cells via caspase-9. Archives of Oral Biology 2009;54:864–70. Xu C, Hao Y, Wei B, Ma J, Li J, Huang Q, et al. Apoptotic gene expression by human periodontal ligament cells following cyclic stretch. Journal of Periodontal Research 2011;46:742–8. Ruch RJ. Intercellular communication, homeostasis, and toxicology. Toxicological Sciences 2002;68:265–6. Spray DC. Gap junction proteins: where they live and how they die. Circulation Research 1998;83:679–81. Laing JG, Chou BC, Steinberg TH. ZO-1 alters the plasma membrane localization and function of Cx43 in osteoblastic cells. Journal of Cell Science 2005;118:2167–76. Beertsen W, Everts V. Junctions between fibroblasts in mouse periodontal ligament. Journal of Periodontal Research 1980;15:524–41. Shore RC, Berkovitz BK, Moxham BJ. Intercellular contacts between fibroblasts in the periodontal connective tissues of the rat. Journal of Anatomy 1981;133:67–76. Yamaoka Y, Sawa Y, Ebata N, Ibuki N, Yoshida S, Kawasaki T. Double expressions of connexin 43 and 32 in human periodontal ligament fibroblasts. Tissue and Cell 2000;32: 328–35. Cherian PP, Siller-Jackson AJ, Gu S, Wang X, Bonewald LF, Sprague E, et al. Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
release of prostaglandin. Molecular Biology of the Cell 2005;16:3100–6. Cowan DB, Lye SJ, Langille BL. Regulation of vascular connexin43 gene expression by mechanical loads. Circulation Research 1998;82:786–93. Wang TL, Tseng YZ, Chang H. Regulation of connexin 43 gene expression by cyclical mechanical stretch in neonatal rat cardiomyocytes. Biochemical and Biophysical Research Communications 2000;267:551–7. Yamada K, Green KG, Samarel AM, Saffitz JE. Distinct pathways regulate expression of cardiac electrical and mechanical junction proteins in response to stretch. Circulation Research 2005;97:346–53. Su M, Borke JL, Donahue HJ, Li Z, Warshawsky NM, Russell CM, et al. Expression of connexin 43 in rat mandibular bone and periodontal ligament (PDL) cells during experimental tooth movement. Journal of Dental Research 1997;76:1357–66. Chiba M, Mitani H. Cytoskeletal changes and the system of regulation of alkaline phosphatase activity in human periodontal ligament cells induced by mechanical stress. Cell Biochemistry and Function 2004;22:249–56. Muthukuru M, Jotwani R, Cutler CW. Oral mucosal endotoxin tolerance induction in chronic periodontitis. Infection and Immunity 2005;73:687–94. Yamaguchi M, Shimizu N, Goseki T, Shibata Y, Takiguchi H, Iwasawa T, et al. Effect of different magnitudes of tension force on prostaglandin E2 production by human periodontal ligament cells. Archives of Oral Biology 1994;39:877–84. He Y, Shroff SG. Cyclic stretch downregulates arterial vascular connexin43 protein expression: an ex vivo study. Biomechanics and Modeling in Mechanobiology 2010;9:203–11. Matsuda N, Yokoyama K, Takeshita S, Watanabe M. Role of epidermal growth factor and its receptor in mechanical stress-induced differentiation of human periodontal ligament cells in vitro. Archives of Oral Biology 1998;43: 987–97. Kostin S, Rieger M, Dammer S, Hein S, Richter M, Klo¨vekorn WP, et al. Gap junction remodeling and altered connexin43 expression in the failing human heart. Molecular and Cellular Biochemistry 2003;242:135–44. Kostin S, Dammer S, Hein S, Klo¨vekorn WP, Bauer EP, Schaper J. Connexin 43 expression and distribution in compensated and decompensated cardiac hypertrophy in patients with aortic stenosis. Cardiovascular Research 2004;62:426–36.