- Email: [email protected]
Cyclin dependent kinase inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme
Journal Pre-proof Cyclin dependent kinase inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme
Tayyebali Salmani, Sayyed Mohammad Hossein Ghaderian, Mohammadreza Hajiesmaeili, Omidvar Rezaei Mirghaed, Azadeh Rakhshan, Mohammad Javad Nasiri, Mahan Mohammadi PII:
S2452-0144(20)30034-0
DOI:
https://doi.org/10.1016/j.genrep.2020.100620
Reference:
GENREP 100620
To appear in:
Gene Reports
Received date:
13 November 2019
Revised date:
25 January 2020
Accepted date:
3 February 2020
Please cite this article as: T. Salmani, S.M.H. Ghaderian, M. Hajiesmaeili, et al., Cyclin dependent kinase inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme, Gene Reports (2020), https://doi.org/10.1016/j.genrep.2020.100620
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier.
Journal Pre-proof Cyclin Dependent Kinase Inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme
Tayyebali Salmani1, Sayyed Mohammad Hossein Ghaderian1,2*, Mohammadreza Hajiesmaeili3, Omidvar Rezaei Mirghaed4, Azadeh Rakhshan5, Mohammad Javad Nasiri6, Mahan Mohammadi7
1. Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran
of
2. Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
ro
3. Department of Anesthesiology research center, Loghman Hakim Hospital, Shahid Beheshti University
-p
of Medical Sciences, Tehran, Iran
4. Skull Base Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical
re
Sciences, Tehran, Iran.
lP
5. Cancer research center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 6. Department of Microbiology, Shahid Beheshti University of Medical Sciences, Tehran, Iran
University, Tehran, Iran
ur
*Corresponding Author
na
7. Department Of Molecular Genetics, Faculty of Science, Science and Research Branch, Islamic Azad
Jo
Sayyed Mohammad Hossein Ghaderian E-mail address: [email protected] Postal address: Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran 1985717443, Iran. Declarations of interest: The authors declare that there is no conflict of interest
Journal Pre-proof Abstract Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor which necessitates a search for biomarkers to provide targeted therapies. The dysfunction of microRNA (miRNA) is associated with tumorigenic processes. So, they may be used as potential biomarkers for cancer management. We aim to investigate the expression levels of Cyclin Dependent Kinase Inhibitor 2A (CDKN2A) and miR-671-5p in formalin-fixed, paraffin-embedded (FFPE) GBM compared
of
to normal tissues. CDKN2A and miR-671-5p expression levels were evaluated using Real-time
ro
RT-PCR in 50 GBM and 50 normal FFPE tissue samples. Our data showed that CDKN2A
-p
significantly low expressed and miR-671-5p overexpressed in tumor tissues compared with
re
normal. In addition, a significant negative correlation also found between these gene expressions. Our finding suggests that miR-671-5p may function as a potential oncomiR that directly targets
lP
CDKN2A in GBM. Moreover CDKN2A and miR-671-5p could be used as a discriminatory
na
means to categorize subjects as healthy or patient. We observed a significant association between CDKN2A and miR-671-5p expression in GBM, which can be concluded that they have a
ur
promising potential to use as primary cancer biomarkers.
Jo
Keywords: CDKN2A, glioblastoma multiforme, miR-671-5p, real-time RT-PCR
Journal Pre-proof 1 Introduction Glioblastoma is the most malignant and most common primary brain tumor (1). It has a high mortality rate due to its stability and resistance to treatment (2, 3). Also, given the changing prognosis of the disease, histopathological tests alone are not sufficient to detect the risk of the disease (4). Although recent advances in neuroradiology, radiotherapy, and chemotherapy have increased the survival time of patients, however, tumor recurrence has been observed in patients (5, 6). Therefore, due to the hardness of the tumor, despite the use of diagnostic procedures and necessary treatments, the existence of new
of
diagnostic methods and ongoing therapies such as molecular methods seems essential (6, 7). MicroRNAs
ro
are a non-coding class of single-stranded RNAs containing 22 nucleotides that are involved in the
-p
regulation of genes in the post transcriptional stage, and many studies have demonstrated that the
re
miRNAs dysfunction associated with GBM progression (8, 9). In the present study, we have focused on Cyclin Dependent Kinase Inhibitor 2A (CDKN2A) gene that functions as tumor suppressor in Rb1
lP
signaling pathway (10). CDKN2A is functionally similar to the p53 tumor suppressor gene. Therefore, it is a cell cycle regulator, and various studies have revealed that this gene is mutated or inactivated in many
na
cancers (11). We performed preliminary screening by bioinformatics tools and predicted mir-671-5p,
ur
which can potentially target CDKN2A and then experimentally investigated the expression pattern of them in GBM compared to normal brain FFPE tissues. Formalin fixation is a standard way of storing
Jo
patient samples (12). Of course, DNA and RNA may be affected (13), but due to the greater stability of microRNAs, it’s a good way to extract microRNAs from paraffin-embedded samples and evaluate their expressions to find suitable biomarkers for GBM diagnosis and treatment. We found that expression of CDKN2A and mir-671-5p significantly was decreased and increased respectively in GBM compared to normal FFPE tissue samples.
Journal Pre-proof 2 Material and methods 2.1 Tissue samples
50 GBM FFPE tissue blocks were collected from Shohadaye Tajrish Hospital in Tehran, Iran (samples for during 2015-2017). Also, the control group includes 50 normal brains FFPE sample, were collected from the Legal Medicine Organization in Tehran, Iran. Our study method was based on the Helsinki declaration and approved by the Shahid Beheshti University of Medical
of
Science Ethical Committee (IR.SBMU.MSP.REC.1397.477). A pathologist was performed
ro
histopathological confirmation to ensure that tumor samples have not any normal tissue content.
-p
Patients who received radiotherapy or adjuvant chemotherapy were excluded from the study.
re
2.2 RNA extraction
According to the manufacturer’s data sheet, four 10-μm thick paraffin sections were
lP
deparaffinised with xylene (Merck, Germany). QIAzol Lysis Reagent (Qiagen, Germany)
na
according to the manufacturer’s recommendation was used for total RNA extraction. RNA concentrations were measured by using a Nano Drop™ 2000c Spectrophotometer (Thermo
ur
Fisher Scientific, USA). The extracted total RNA was stored at -70 °C until use.
Jo
2.3 Expression quantification
To cDNA synthesis, we add a commercially available stem loop to generate cDNA from specific miRNA(14). We applied PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). 1 µl of the cDNA was used for real-time polymerase chain reaction on the StepOnePlus™ Real-Time PCR System using the RealQ Plus 2x Master Mix Green, High ROXTM (AmpliQon, Denmark). The PCR was done in duplicate based on the kit’s data sheet. Table 1 shows the sequence of the primers that were applied in this study. The miRNAs expression results were normalized to the expression level of miR-103a-3p. Beta-2- microglobulin (B2M) was used as mRNA expression
Journal Pre-proof normalizer. LinRegPCR software (http://www.hartfaalcentrum.nl/; subject: LinRegPCR), was used for PCR efficiency evaluation, and the 2-ΔΔCT method was used for relative gene expression data analysis.
2.4 Statistical analysis In this study, statistical analyses were performed by SPSS Statistical Software Package v.18.0 (SPSS Inc., Chicago, IL). Student’s t-test for the normally distributed data or Mann-Whitney U test for the nonparametric were used for evaluation of the miRNAs expression levels between
of
two groups. ROC curve analysis was then performed to the diagnostic value evaluation of
re
-p
less than 0.05 were defined as statistically significant.
ro
miRNAs by means of Graphpad-Prism-7 (RRID: SCR_002798). Probability values (p-values)
3 RESULTS
lP
3.1 Subjects
na
Table 2 summarizes the demographics feature of the samples. We matched our groups based on age and sex. 3.2 CDKN2A and miR-671-5p expression
ur
CDKN2A and miR-671-5p expression levels were evaluated in GBM compared to normal
Jo
samples. We found that CDKN2A was significantly downregulated and miR-671-5p was significantly upregulated in GBM samples (p < 0.0001) (Fig 1). 3.3. Correlation between CDKN2A and miR-671-5p expression levels Among each set of samples, relative expression of CDKN2A and miR-671-5p was compared. The results showed that the correlation between CDKN2A and miR-671-5p expressions was significantly negative (Pearson correlation r= -0.51, P < 0.0001) (Fig. 2). 3.4 ROC curve analysis of the CDKN2A and miR-671-5p
Journal Pre-proof The receiver operating characteristic (ROC) curve was applied to define whether the expression of CDKN2A and miR-671-5p could be used as a discriminatory means to categorize subjects as healthy or patient. ROC analysis of CDKN2A demonstrated the area under the ROC curve of 0.89 (95% CI: 0.82 to 0.95, p < 0.0001). The CDKN2A model showed a sensitivity of 94% (95% CI: 83.78% to 98.36%) and specificity of 82% (95% CI: 69.20% to 90.23%) to correctly classified individuals into two healthy and patient groups (Figure 3A). ROC analysis of miR-
of
671-5p determined the AUC of 0.91 (95% CI: 0.86 – 0.96, p < 0.0001). We found that the model
ro
of miR-671-5p has a sensitivity of 78% (95% CI: 64.76% to 87.25%) and specificity of 90%
re
-p
(95% CI: 78.64% to 95.65%) to differentiate healthy from patients individuals (Figure 3B).
lP
4 Discussion
GBM is the highest-grade glioma tumor (grade IV), so the introduction of novel therapeutic
na
biomarkers seems necessary for GBM treatment. CDKN2A is one of the well-studied tumor suppressor genes that dysregulated in 70% of glioblastoma (10, 15). Several studies reveal that CDKN2A
ur
might serve as a potential target for altered miRNAs and induces invasion and cancer cell growth. In this
Jo
study we used miRWalk and TargetScan databases to prediction CDKN2A as a target gene for miR-6715p, then experimentally, we assessed CDKN2A and miR-671-5p expression in GBM FFPE tissues. We found significantly CDKN2A downregulation and miR-671-5p upregulation in tumors than controls. CDKN2A expression pattern in our experiment is similar to the results of the Sibin study. Notably, Sibin and coworkers, performed mRNA quantification analysis on 48 high-grade glioma tissues and checked for a possible prognostic role. The decreased expression of CDKN2A was observed in the majority of the tumour tissues (57.1 %) when compared to control tissues (16). Some studies have shown that miR-6715p functions as a tumor suppressor and its expression, reduces cell proliferation and migration. For example, Qiu et al. showed that miR-671-5p upregulation in gastric cancer leads to the protective function
Journal Pre-proof through inducing cell apoptosis and inhibiting cell proliferation by targeting URGCP (17). Moreover, Xin et al. found that miR-671-5p inhibits tumor proliferation by targeting CCND1 and CDC34 in osteosarcoma (18). MiR-671-5p has been proposed as an oncomiR in other studies. Jin et al revealed in colon cancer cells, miR-671-5p promotes proliferation and migration of cancerous cells by targeting TRIM67 (19). Besides, Barbagallo and colleagues analyzed the biopsies from a cohort of forty-five GBM patients and from five GBM cell lines. Their data showed significant overexpression of miR-671-5p in
of
both biopsies and cell lines. Moreover, they demonstrated that miR-671-5p overexpression significantly increases migration and to a less extent proliferation rates of GBM cells (20). Moreover, they reported
ro
that miR-671-5p increased proliferation, migration, and invasion and decreased apoptosis in GBM cells.
-p
This study confirmed that miR-671-5p pathway modulates the development of GBM, and this pathway
re
might be a promising target for the development of therapeutics for GBM (21). A possible explanation for inconsistency in studies for the tumor-suppressive or oncogenic function of miR-671-5p, is the existence
lP
of a tissue-specific role for miR-671-5p. Following Barbagallo and Li, our study showed the miR-671-5p
na
overexpression in GBM tissues and there was a negative significant correlation between miR-671-5p and CDKN2A expression levels. ROC curve analysis of the miR-671-5p and CDKN2A demonstrated that
ur
their expression levels could be applied as a potential biomarker for subjects classifying as
Jo
healthy or patient groups. MiR-671-5p and CDKN2A have been separately proposed as candidate genes in cancers but no data have been published on their potential correlation between them in GBM. MiR-671-5p overexpression and association with CDKN2A downregulation put forward to the investigation of new pathways involved in GBM pathogenesis. CDKN2A downregulation (likely linked to miR-671-5p-dependent CDKN2A degradation) may truly contribute to neoplastic transformation. On the other hand, the downregulation of CDKN2A by miR-671-5p may lead to increased cell proliferation in GBM.
5 Conclusion
Journal Pre-proof In conclusion, this study is one of the first studies to assess the CDKN2A and miR-671-5p expression in FFPE GBM tissues, and our results showed down-regulation of CDKN2A and upregulation of miR-6715p in GBM compared to the normal group. This finding suggests that miR-671-5p may function as a potential oncomiR that directly targets CDKN2A in GBM. Hence miR-671-5p may serve as a novel therapeutic target for GBM management. But most studies need to decode the functional mechanism of
Jo
ur
na
lP
re
-p
ro
of
miR-671-5p and its effect on CDKN2A in GBM.
Journal Pre-proof References:
Jo
ur
na
lP
re
-p
ro
of
1. Ozdemir-Kaynak E, Qutub AA, Yesil-Celiktas O. Advances in glioblastoma multiforme treatment: new models for nanoparticle therapy. Frontiers in physiology. 2018;9:170. 2. Lara-Velazquez M, Al-Kharboosh R, Jeanneret S, Vazquez-Ramos C, Mahato D, Tavanaiepour D, et al. Advances in brain tumor surgery for glioblastoma in adults. Brain sciences. 2017;7(12):166. 3. Wilson TA, Karajannis MA, Harter DH. Glioblastoma multiforme: State of the art and future therapeutics. Surgical neurology international. 2014;5. 4. van den Bent MJ, Weller M, Wen PY, Kros JM, Aldape K, Chang S. A clinical perspective on the 2016 WHO brain tumor classification and routine molecular diagnostics. Neuro-oncology. 2017;19(5):614-24. 5. van Linde ME, Brahm CG, de Witt Hamer PC, Reijneveld JC, Bruynzeel AM, Vandertop WP, et al. Treatment outcome of patients with recurrent glioblastoma multiforme: a retrospective multicenter analysis. Journal of neuro-oncology. 2017;135(1):183-92. 6. Gallego O. Nonsurgical treatment of recurrent glioblastoma. Current oncology. 2015;22(4):e273. 7. Silantyev AS, Falzone L, Libra M, Gurina OI, Kardashova KS, Nikolouzakis TK, et al. Current and Future Trends on Diagnosis and Prognosis of Glioblastoma: From Molecular Biology to Proteomics. Cells. 2019;8(8):863. 8. Tan W, Liu B, Qu S, Liang G, Luo W, Gong C. MicroRNAs and cancer: Key paradigms in molecular therapy. Oncology letters. 2018;15(3):2735-42. 9. Banelli B, Forlani A, Allemanni G, Morabito A, Pistillo MP, Romani M. MicroRNA in glioblastoma: an overview. International journal of genomics. 2017;2017. 10. Liu W, Lv G, Li Y, Wang B. Downregulation of CDKN2A and suppression of cyclin D1 gene expressions in malignant gliomas. Journal of Experimental & Clinical Cancer Research. 2011;30(1):76. 11. Zhao R, Choi BY, Lee M-H, Bode AM, Dong Z. Implications of genetic and epigenetic alterations of CDKN2A (p16INK4a) in cancer. EBioMedicine. 2016;8:30-9. 12. Nam SK, Im J, Kwak Y, Han N, Nam KH, Seo AN, et al. Effects of fixation and storage of human tissue samples on nucleic Acid preservation. Korean journal of pathology. 2014;48(1):36. 13. Jones W, Greytak S, Odeh H, Guan P, Powers J, Bavarva J, et al. Deleterious effects of formalinfixation and delays to fixation on RNA and miRNA-Seq profiles. Scientific reports. 2019;9(1):6980. 14. Kramer MF. Stem‐loop RT‐qPCR for miRNAs. Current protocols in molecular biology. 2011;95(1):15.0. 1-.0. . 15. Jiao Y, Feng Y, Wang X. Regulation of tumor suppressor gene CDKN2A and encoded p16-INK4a protein by covalent modifications. Biochemistry (Moscow). 2018;83(11):1289-98. 16. Sibin M, Bhat DI, Narasingarao K, Lavanya C, Chetan G. CDKN2A (p16) mRNA decreased expression is a marker of poor prognosis in malignant high-grade glioma. Tumor Biology. 2015;36(10):7607-14. 17. Qiu T, Wang K, Li X, Jin J. miR‑671‑5p inhibits gastric cancer cell proliferation and promotes cell apoptosis by targeting URGCP. Experimental and therapeutic medicine. 2018;16(6):4753-8. 18. Xin C, Lu S, Li Y, Zhang Y, Tian J, Zhang S, et al. miR-671-5p Inhibits Tumor Proliferation by Blocking Cell Cycle in Osteosarcoma. DNA and Cell Biology. 2019;38(9):996-1004. 19. Jin W, Shi J, Liu M. Overexpression of miR-671-5p indicates a poor prognosis in colon cancer and accelerates proliferation, migration, and invasion of colon cancer cells. OncoTargets and therapy. 2019;12:6865. 20. Barbagallo D, Condorelli A, Ragusa M, Salito L, Sammito M, Banelli B, et al. Dysregulated miR671-5p/CDR1-AS/CDR1/VSNL1 axis is involved in glioblastoma multiforme. Oncotarget. 2016;7(4):4746.
Journal Pre-proof 21. Li X, Diao H. Circular RNA circ_0001946 acts as a competing endogenous RNA to inhibit glioblastoma progression by modulating miR‐671‐5p and CDR1. Journal of cellular physiology. 2019;234(8):13807-19.
Legend:
of
Fig.1 The expression levels of CDKN2A (A) and miR-671-5p (B) in GBM FFPE tissues compared to normal brain FFPE tissues. (Relative expression based on 2-ΔΔCT) (GBM:
ro
Glioblastoma multiforme, CTRL: Control).
-p
Fig. 2 Correlation of CDKN2A with miR-671-5p expression level in GBM FFPE tissues (n=50).
re
Fig. 3 ROC analysis was performed on CDKN2A (A) and miR-671-5p (B) expression levels in
lP
GBM FFPE tissues (n=50) compared to normal brain FFPE tissues (n=50) to determine the
na
optimal cutoff values. (GBM: Glioblastoma multiforme, CTRL: Control). Table 1. Sequence of the primers applied at this study.
Jo
ur
Table 2. Demographic and histological features of the samples.
Journal Pre-proof Table 1. Sequence of the primers applied at this study Sequence (5’ 3’)
Gene
(F) CTTCGGCTGACTGGCTGG CDKN2A
(R) TCATCATGACCTGGATCGGC (F) AGATGAGTATGCCTGCCGTG (R) CGGCATCTTCAAACCTCCA
miR-671-5p
(F) TGGTTTAGGAAGCCCTGGAG
miR-671-5p stem-loop
GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAAC CTCCAG
miR-103a-3p
(F) GTAGCAGCATTGTACAGGG
miR-103a-3p stem-loop
GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAAC TCATAG
Universal
(R) GTGCAGGGTCCGAGGT
Jo
ur
na
lP
re
-p
ro
of
B2M
Journal Pre-proof Table 2. Demographic and histological features of the samples parameter
GBM (n=50)
Age (y)
CTRL (n=50)
52.41 ± 5.32
51.11±9.22
0.78
29/21
28/22
0.57
ur
na
lP
re
-p
ro
of
Sex (male/female)
Jo
p value
Journal Pre-proof List of Abbreviations: Glioblastoma multiforme (GBM) Cyclin dependent kinase inhibitor 2A (CDKN2A) Formalin-fixed paraffin-embedded (FFPE) MicroRNAs (miRNAs) 3'-untranslated region (3'-UTR) World Health Organization (WHO)
of
Complementary DNA (cDNA) Beta-2-microlobulin (B2M)
ro
Receiver operating characteristic (ROC)
Jo
ur
na
lP
re
-p
Area under the ROC curve (AUC)
Journal Pre-proof Author contributions Tayyebali Salmani: Methodology, Software, Writing- Reviewing and Editing; Sayyed Mohammad Hossein Ghaderian: Conceptualization, Methodology, Data curation, Reviewing and Editing, Supervision, Validation; Mohammadreza Hajiesmaeili, Omidvar Rezaei Mirghaed: Neurological assessment, sampling; Azadeh Rakhshan; Pathological assessment, sampling; Mahan Mohammadi:
Jo
ur
na
lP
re
-p
ro
of
Writing-Original draft preparation and Mohammad Javad Nasiri: advising over the study.
Journal Pre-proof Graphical abstract
Highlights Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor
of
MiRNAs involved in cell signaling pathways, can be used as therapeutic markers in GBM
ro
CDKN2A and miR-671-5p expression had a significant difference in Iranian GBM patients
-p
CDKN2A and miR-671-5p may serve as a novel therapeutic target for GBM management
Jo
ur
na
lP
re
FFPE tissue samples are valuable resources for retrospective biomarker discovery.
Figure 1
Figure 2
Figure 3
Tayyebali Salmani, Sayyed Mohammad Hossein Ghaderian, Mohammadreza Hajiesmaeili, Omidvar Rezaei Mirghaed, Azadeh Rakhshan, Mohammad Javad Nasiri, Mahan Mohammadi PII:
S2452-0144(20)30034-0
DOI:
https://doi.org/10.1016/j.genrep.2020.100620
Reference:
GENREP 100620
To appear in:
Gene Reports
Received date:
13 November 2019
Revised date:
25 January 2020
Accepted date:
3 February 2020
Please cite this article as: T. Salmani, S.M.H. Ghaderian, M. Hajiesmaeili, et al., Cyclin dependent kinase inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme, Gene Reports (2020), https://doi.org/10.1016/j.genrep.2020.100620
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier.
Journal Pre-proof Cyclin Dependent Kinase Inhibitor 2A and miR-671-5p expression profile in Iranian glioblastoma multiforme
Tayyebali Salmani1, Sayyed Mohammad Hossein Ghaderian1,2*, Mohammadreza Hajiesmaeili3, Omidvar Rezaei Mirghaed4, Azadeh Rakhshan5, Mohammad Javad Nasiri6, Mahan Mohammadi7
1. Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran
of
2. Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
ro
3. Department of Anesthesiology research center, Loghman Hakim Hospital, Shahid Beheshti University
-p
of Medical Sciences, Tehran, Iran
4. Skull Base Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical
re
Sciences, Tehran, Iran.
lP
5. Cancer research center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 6. Department of Microbiology, Shahid Beheshti University of Medical Sciences, Tehran, Iran
University, Tehran, Iran
ur
*Corresponding Author
na
7. Department Of Molecular Genetics, Faculty of Science, Science and Research Branch, Islamic Azad
Jo
Sayyed Mohammad Hossein Ghaderian E-mail address: [email protected] Postal address: Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran 1985717443, Iran. Declarations of interest: The authors declare that there is no conflict of interest
Journal Pre-proof Abstract Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor which necessitates a search for biomarkers to provide targeted therapies. The dysfunction of microRNA (miRNA) is associated with tumorigenic processes. So, they may be used as potential biomarkers for cancer management. We aim to investigate the expression levels of Cyclin Dependent Kinase Inhibitor 2A (CDKN2A) and miR-671-5p in formalin-fixed, paraffin-embedded (FFPE) GBM compared
of
to normal tissues. CDKN2A and miR-671-5p expression levels were evaluated using Real-time
ro
RT-PCR in 50 GBM and 50 normal FFPE tissue samples. Our data showed that CDKN2A
-p
significantly low expressed and miR-671-5p overexpressed in tumor tissues compared with
re
normal. In addition, a significant negative correlation also found between these gene expressions. Our finding suggests that miR-671-5p may function as a potential oncomiR that directly targets
lP
CDKN2A in GBM. Moreover CDKN2A and miR-671-5p could be used as a discriminatory
na
means to categorize subjects as healthy or patient. We observed a significant association between CDKN2A and miR-671-5p expression in GBM, which can be concluded that they have a
ur
promising potential to use as primary cancer biomarkers.
Jo
Keywords: CDKN2A, glioblastoma multiforme, miR-671-5p, real-time RT-PCR
Journal Pre-proof 1 Introduction Glioblastoma is the most malignant and most common primary brain tumor (1). It has a high mortality rate due to its stability and resistance to treatment (2, 3). Also, given the changing prognosis of the disease, histopathological tests alone are not sufficient to detect the risk of the disease (4). Although recent advances in neuroradiology, radiotherapy, and chemotherapy have increased the survival time of patients, however, tumor recurrence has been observed in patients (5, 6). Therefore, due to the hardness of the tumor, despite the use of diagnostic procedures and necessary treatments, the existence of new
of
diagnostic methods and ongoing therapies such as molecular methods seems essential (6, 7). MicroRNAs
ro
are a non-coding class of single-stranded RNAs containing 22 nucleotides that are involved in the
-p
regulation of genes in the post transcriptional stage, and many studies have demonstrated that the
re
miRNAs dysfunction associated with GBM progression (8, 9). In the present study, we have focused on Cyclin Dependent Kinase Inhibitor 2A (CDKN2A) gene that functions as tumor suppressor in Rb1
lP
signaling pathway (10). CDKN2A is functionally similar to the p53 tumor suppressor gene. Therefore, it is a cell cycle regulator, and various studies have revealed that this gene is mutated or inactivated in many
na
cancers (11). We performed preliminary screening by bioinformatics tools and predicted mir-671-5p,
ur
which can potentially target CDKN2A and then experimentally investigated the expression pattern of them in GBM compared to normal brain FFPE tissues. Formalin fixation is a standard way of storing
Jo
patient samples (12). Of course, DNA and RNA may be affected (13), but due to the greater stability of microRNAs, it’s a good way to extract microRNAs from paraffin-embedded samples and evaluate their expressions to find suitable biomarkers for GBM diagnosis and treatment. We found that expression of CDKN2A and mir-671-5p significantly was decreased and increased respectively in GBM compared to normal FFPE tissue samples.
Journal Pre-proof 2 Material and methods 2.1 Tissue samples
50 GBM FFPE tissue blocks were collected from Shohadaye Tajrish Hospital in Tehran, Iran (samples for during 2015-2017). Also, the control group includes 50 normal brains FFPE sample, were collected from the Legal Medicine Organization in Tehran, Iran. Our study method was based on the Helsinki declaration and approved by the Shahid Beheshti University of Medical
of
Science Ethical Committee (IR.SBMU.MSP.REC.1397.477). A pathologist was performed
ro
histopathological confirmation to ensure that tumor samples have not any normal tissue content.
-p
Patients who received radiotherapy or adjuvant chemotherapy were excluded from the study.
re
2.2 RNA extraction
According to the manufacturer’s data sheet, four 10-μm thick paraffin sections were
lP
deparaffinised with xylene (Merck, Germany). QIAzol Lysis Reagent (Qiagen, Germany)
na
according to the manufacturer’s recommendation was used for total RNA extraction. RNA concentrations were measured by using a Nano Drop™ 2000c Spectrophotometer (Thermo
ur
Fisher Scientific, USA). The extracted total RNA was stored at -70 °C until use.
Jo
2.3 Expression quantification
To cDNA synthesis, we add a commercially available stem loop to generate cDNA from specific miRNA(14). We applied PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). 1 µl of the cDNA was used for real-time polymerase chain reaction on the StepOnePlus™ Real-Time PCR System using the RealQ Plus 2x Master Mix Green, High ROXTM (AmpliQon, Denmark). The PCR was done in duplicate based on the kit’s data sheet. Table 1 shows the sequence of the primers that were applied in this study. The miRNAs expression results were normalized to the expression level of miR-103a-3p. Beta-2- microglobulin (B2M) was used as mRNA expression
Journal Pre-proof normalizer. LinRegPCR software (http://www.hartfaalcentrum.nl/; subject: LinRegPCR), was used for PCR efficiency evaluation, and the 2-ΔΔCT method was used for relative gene expression data analysis.
2.4 Statistical analysis In this study, statistical analyses were performed by SPSS Statistical Software Package v.18.0 (SPSS Inc., Chicago, IL). Student’s t-test for the normally distributed data or Mann-Whitney U test for the nonparametric were used for evaluation of the miRNAs expression levels between
of
two groups. ROC curve analysis was then performed to the diagnostic value evaluation of
re
-p
less than 0.05 were defined as statistically significant.
ro
miRNAs by means of Graphpad-Prism-7 (RRID: SCR_002798). Probability values (p-values)
3 RESULTS
lP
3.1 Subjects
na
Table 2 summarizes the demographics feature of the samples. We matched our groups based on age and sex. 3.2 CDKN2A and miR-671-5p expression
ur
CDKN2A and miR-671-5p expression levels were evaluated in GBM compared to normal
Jo
samples. We found that CDKN2A was significantly downregulated and miR-671-5p was significantly upregulated in GBM samples (p < 0.0001) (Fig 1). 3.3. Correlation between CDKN2A and miR-671-5p expression levels Among each set of samples, relative expression of CDKN2A and miR-671-5p was compared. The results showed that the correlation between CDKN2A and miR-671-5p expressions was significantly negative (Pearson correlation r= -0.51, P < 0.0001) (Fig. 2). 3.4 ROC curve analysis of the CDKN2A and miR-671-5p
Journal Pre-proof The receiver operating characteristic (ROC) curve was applied to define whether the expression of CDKN2A and miR-671-5p could be used as a discriminatory means to categorize subjects as healthy or patient. ROC analysis of CDKN2A demonstrated the area under the ROC curve of 0.89 (95% CI: 0.82 to 0.95, p < 0.0001). The CDKN2A model showed a sensitivity of 94% (95% CI: 83.78% to 98.36%) and specificity of 82% (95% CI: 69.20% to 90.23%) to correctly classified individuals into two healthy and patient groups (Figure 3A). ROC analysis of miR-
of
671-5p determined the AUC of 0.91 (95% CI: 0.86 – 0.96, p < 0.0001). We found that the model
ro
of miR-671-5p has a sensitivity of 78% (95% CI: 64.76% to 87.25%) and specificity of 90%
re
-p
(95% CI: 78.64% to 95.65%) to differentiate healthy from patients individuals (Figure 3B).
lP
4 Discussion
GBM is the highest-grade glioma tumor (grade IV), so the introduction of novel therapeutic
na
biomarkers seems necessary for GBM treatment. CDKN2A is one of the well-studied tumor suppressor genes that dysregulated in 70% of glioblastoma (10, 15). Several studies reveal that CDKN2A
ur
might serve as a potential target for altered miRNAs and induces invasion and cancer cell growth. In this
Jo
study we used miRWalk and TargetScan databases to prediction CDKN2A as a target gene for miR-6715p, then experimentally, we assessed CDKN2A and miR-671-5p expression in GBM FFPE tissues. We found significantly CDKN2A downregulation and miR-671-5p upregulation in tumors than controls. CDKN2A expression pattern in our experiment is similar to the results of the Sibin study. Notably, Sibin and coworkers, performed mRNA quantification analysis on 48 high-grade glioma tissues and checked for a possible prognostic role. The decreased expression of CDKN2A was observed in the majority of the tumour tissues (57.1 %) when compared to control tissues (16). Some studies have shown that miR-6715p functions as a tumor suppressor and its expression, reduces cell proliferation and migration. For example, Qiu et al. showed that miR-671-5p upregulation in gastric cancer leads to the protective function
Journal Pre-proof through inducing cell apoptosis and inhibiting cell proliferation by targeting URGCP (17). Moreover, Xin et al. found that miR-671-5p inhibits tumor proliferation by targeting CCND1 and CDC34 in osteosarcoma (18). MiR-671-5p has been proposed as an oncomiR in other studies. Jin et al revealed in colon cancer cells, miR-671-5p promotes proliferation and migration of cancerous cells by targeting TRIM67 (19). Besides, Barbagallo and colleagues analyzed the biopsies from a cohort of forty-five GBM patients and from five GBM cell lines. Their data showed significant overexpression of miR-671-5p in
of
both biopsies and cell lines. Moreover, they demonstrated that miR-671-5p overexpression significantly increases migration and to a less extent proliferation rates of GBM cells (20). Moreover, they reported
ro
that miR-671-5p increased proliferation, migration, and invasion and decreased apoptosis in GBM cells.
-p
This study confirmed that miR-671-5p pathway modulates the development of GBM, and this pathway
re
might be a promising target for the development of therapeutics for GBM (21). A possible explanation for inconsistency in studies for the tumor-suppressive or oncogenic function of miR-671-5p, is the existence
lP
of a tissue-specific role for miR-671-5p. Following Barbagallo and Li, our study showed the miR-671-5p
na
overexpression in GBM tissues and there was a negative significant correlation between miR-671-5p and CDKN2A expression levels. ROC curve analysis of the miR-671-5p and CDKN2A demonstrated that
ur
their expression levels could be applied as a potential biomarker for subjects classifying as
Jo
healthy or patient groups. MiR-671-5p and CDKN2A have been separately proposed as candidate genes in cancers but no data have been published on their potential correlation between them in GBM. MiR-671-5p overexpression and association with CDKN2A downregulation put forward to the investigation of new pathways involved in GBM pathogenesis. CDKN2A downregulation (likely linked to miR-671-5p-dependent CDKN2A degradation) may truly contribute to neoplastic transformation. On the other hand, the downregulation of CDKN2A by miR-671-5p may lead to increased cell proliferation in GBM.
5 Conclusion
Journal Pre-proof In conclusion, this study is one of the first studies to assess the CDKN2A and miR-671-5p expression in FFPE GBM tissues, and our results showed down-regulation of CDKN2A and upregulation of miR-6715p in GBM compared to the normal group. This finding suggests that miR-671-5p may function as a potential oncomiR that directly targets CDKN2A in GBM. Hence miR-671-5p may serve as a novel therapeutic target for GBM management. But most studies need to decode the functional mechanism of
Jo
ur
na
lP
re
-p
ro
of
miR-671-5p and its effect on CDKN2A in GBM.
Journal Pre-proof References:
Jo
ur
na
lP
re
-p
ro
of
1. Ozdemir-Kaynak E, Qutub AA, Yesil-Celiktas O. Advances in glioblastoma multiforme treatment: new models for nanoparticle therapy. Frontiers in physiology. 2018;9:170. 2. Lara-Velazquez M, Al-Kharboosh R, Jeanneret S, Vazquez-Ramos C, Mahato D, Tavanaiepour D, et al. Advances in brain tumor surgery for glioblastoma in adults. Brain sciences. 2017;7(12):166. 3. Wilson TA, Karajannis MA, Harter DH. Glioblastoma multiforme: State of the art and future therapeutics. Surgical neurology international. 2014;5. 4. van den Bent MJ, Weller M, Wen PY, Kros JM, Aldape K, Chang S. A clinical perspective on the 2016 WHO brain tumor classification and routine molecular diagnostics. Neuro-oncology. 2017;19(5):614-24. 5. van Linde ME, Brahm CG, de Witt Hamer PC, Reijneveld JC, Bruynzeel AM, Vandertop WP, et al. Treatment outcome of patients with recurrent glioblastoma multiforme: a retrospective multicenter analysis. Journal of neuro-oncology. 2017;135(1):183-92. 6. Gallego O. Nonsurgical treatment of recurrent glioblastoma. Current oncology. 2015;22(4):e273. 7. Silantyev AS, Falzone L, Libra M, Gurina OI, Kardashova KS, Nikolouzakis TK, et al. Current and Future Trends on Diagnosis and Prognosis of Glioblastoma: From Molecular Biology to Proteomics. Cells. 2019;8(8):863. 8. Tan W, Liu B, Qu S, Liang G, Luo W, Gong C. MicroRNAs and cancer: Key paradigms in molecular therapy. Oncology letters. 2018;15(3):2735-42. 9. Banelli B, Forlani A, Allemanni G, Morabito A, Pistillo MP, Romani M. MicroRNA in glioblastoma: an overview. International journal of genomics. 2017;2017. 10. Liu W, Lv G, Li Y, Wang B. Downregulation of CDKN2A and suppression of cyclin D1 gene expressions in malignant gliomas. Journal of Experimental & Clinical Cancer Research. 2011;30(1):76. 11. Zhao R, Choi BY, Lee M-H, Bode AM, Dong Z. Implications of genetic and epigenetic alterations of CDKN2A (p16INK4a) in cancer. EBioMedicine. 2016;8:30-9. 12. Nam SK, Im J, Kwak Y, Han N, Nam KH, Seo AN, et al. Effects of fixation and storage of human tissue samples on nucleic Acid preservation. Korean journal of pathology. 2014;48(1):36. 13. Jones W, Greytak S, Odeh H, Guan P, Powers J, Bavarva J, et al. Deleterious effects of formalinfixation and delays to fixation on RNA and miRNA-Seq profiles. Scientific reports. 2019;9(1):6980. 14. Kramer MF. Stem‐loop RT‐qPCR for miRNAs. Current protocols in molecular biology. 2011;95(1):15.0. 1-.0. . 15. Jiao Y, Feng Y, Wang X. Regulation of tumor suppressor gene CDKN2A and encoded p16-INK4a protein by covalent modifications. Biochemistry (Moscow). 2018;83(11):1289-98. 16. Sibin M, Bhat DI, Narasingarao K, Lavanya C, Chetan G. CDKN2A (p16) mRNA decreased expression is a marker of poor prognosis in malignant high-grade glioma. Tumor Biology. 2015;36(10):7607-14. 17. Qiu T, Wang K, Li X, Jin J. miR‑671‑5p inhibits gastric cancer cell proliferation and promotes cell apoptosis by targeting URGCP. Experimental and therapeutic medicine. 2018;16(6):4753-8. 18. Xin C, Lu S, Li Y, Zhang Y, Tian J, Zhang S, et al. miR-671-5p Inhibits Tumor Proliferation by Blocking Cell Cycle in Osteosarcoma. DNA and Cell Biology. 2019;38(9):996-1004. 19. Jin W, Shi J, Liu M. Overexpression of miR-671-5p indicates a poor prognosis in colon cancer and accelerates proliferation, migration, and invasion of colon cancer cells. OncoTargets and therapy. 2019;12:6865. 20. Barbagallo D, Condorelli A, Ragusa M, Salito L, Sammito M, Banelli B, et al. Dysregulated miR671-5p/CDR1-AS/CDR1/VSNL1 axis is involved in glioblastoma multiforme. Oncotarget. 2016;7(4):4746.
Journal Pre-proof 21. Li X, Diao H. Circular RNA circ_0001946 acts as a competing endogenous RNA to inhibit glioblastoma progression by modulating miR‐671‐5p and CDR1. Journal of cellular physiology. 2019;234(8):13807-19.
Legend:
of
Fig.1 The expression levels of CDKN2A (A) and miR-671-5p (B) in GBM FFPE tissues compared to normal brain FFPE tissues. (Relative expression based on 2-ΔΔCT) (GBM:
ro
Glioblastoma multiforme, CTRL: Control).
-p
Fig. 2 Correlation of CDKN2A with miR-671-5p expression level in GBM FFPE tissues (n=50).
re
Fig. 3 ROC analysis was performed on CDKN2A (A) and miR-671-5p (B) expression levels in
lP
GBM FFPE tissues (n=50) compared to normal brain FFPE tissues (n=50) to determine the
na
optimal cutoff values. (GBM: Glioblastoma multiforme, CTRL: Control). Table 1. Sequence of the primers applied at this study.
Jo
ur
Table 2. Demographic and histological features of the samples.
Journal Pre-proof Table 1. Sequence of the primers applied at this study Sequence (5’ 3’)
Gene
(F) CTTCGGCTGACTGGCTGG CDKN2A
(R) TCATCATGACCTGGATCGGC (F) AGATGAGTATGCCTGCCGTG (R) CGGCATCTTCAAACCTCCA
miR-671-5p
(F) TGGTTTAGGAAGCCCTGGAG
miR-671-5p stem-loop
GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAAC CTCCAG
miR-103a-3p
(F) GTAGCAGCATTGTACAGGG
miR-103a-3p stem-loop
GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAAC TCATAG
Universal
(R) GTGCAGGGTCCGAGGT
Jo
ur
na
lP
re
-p
ro
of
B2M
Journal Pre-proof Table 2. Demographic and histological features of the samples parameter
GBM (n=50)
Age (y)
CTRL (n=50)
52.41 ± 5.32
51.11±9.22
0.78
29/21
28/22
0.57
ur
na
lP
re
-p
ro
of
Sex (male/female)
Jo
p value
Journal Pre-proof List of Abbreviations: Glioblastoma multiforme (GBM) Cyclin dependent kinase inhibitor 2A (CDKN2A) Formalin-fixed paraffin-embedded (FFPE) MicroRNAs (miRNAs) 3'-untranslated region (3'-UTR) World Health Organization (WHO)
of
Complementary DNA (cDNA) Beta-2-microlobulin (B2M)
ro
Receiver operating characteristic (ROC)
Jo
ur
na
lP
re
-p
Area under the ROC curve (AUC)
Journal Pre-proof Author contributions Tayyebali Salmani: Methodology, Software, Writing- Reviewing and Editing; Sayyed Mohammad Hossein Ghaderian: Conceptualization, Methodology, Data curation, Reviewing and Editing, Supervision, Validation; Mohammadreza Hajiesmaeili, Omidvar Rezaei Mirghaed: Neurological assessment, sampling; Azadeh Rakhshan; Pathological assessment, sampling; Mahan Mohammadi:
Jo
ur
na
lP
re
-p
ro
of
Writing-Original draft preparation and Mohammad Javad Nasiri: advising over the study.
Journal Pre-proof Graphical abstract
Highlights Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor
of
MiRNAs involved in cell signaling pathways, can be used as therapeutic markers in GBM
ro
CDKN2A and miR-671-5p expression had a significant difference in Iranian GBM patients
-p
CDKN2A and miR-671-5p may serve as a novel therapeutic target for GBM management
Jo
ur
na
lP
re
FFPE tissue samples are valuable resources for retrospective biomarker discovery.
Figure 1
Figure 2
Figure 3