Cyr61 participates in the pathogenesis of rheumatoid arthritis by promoting proIL-1β production by fibroblast-like synoviocytes through an AKT-dependent NF-κB signaling pathway

Clinical Immunology (2015) 157, 187–197

available at www.sciencedirect.com

Clinical Immunology www.elsevier.com/locate/yclim

Cyr61 participates in the pathogenesis of rheumatoid arthritis by promoting proIL-1β production by fibroblast-like synoviocytes through an AKT-dependent NF-κB signaling pathway Xianjin Zhu a,b,1 , Yanfang Song c,1 , Rongfen Huo a , Jie Zhang a , Songtao Sun d , Yong He d , Huali Gao d , Miaojia Zhang e , Xiaoxuan Sun e , Tianhang Zhai a , Huidan Li a , Yue Sun a , Zhou Zhou a , Baihua Shen a , Lianbo Xiao d,⁎,2 , Ningli Li a,⁎⁎,2 a

Shanghai Institute of Immunology, Institute of Medical Sciences, Shanghai Jiao Tong University School of Medicine, Shanghai, PR China b Affiliated Union Hospital of Fujian Medical University, Fuzhou, PR China c Affiliated Renmin Hospital of Fujian University of Traditional Chinese Medicine, Fuzhou, PR China d Institute of Arthritis Research, Shanghai Academy of Chinese Medical Sciences, Shanghai, PR China e Department of Rheumatology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, PR China

Received 21 August 2014; accepted with revision 17 February 2015 Available online 27 February 2015 KEYWORDS Rheumatoid arthritis; Cyr61; IL-1β;

Abstract IL-1β plays a major role in the development of rheumatoid arthritis (RA). We previously showed that Cyr61 participates in RA pathogenesis as a proinflammatory factor. Here, we found that the levels of IL-1β and Cyr61 were higher in RA SF than in osteoarthritis (OA) SF. IL-1β mRNA and proIL-1β protein levels were remarkably increased in Cyr61-stimulated FLS; however, IL-1β was

Abbreviations: RA, rheumatoid arthritis; OA, osteoarthritis; FLS, fibroblast-like synoviocytes; RT-PCR, real-time PCR; IL-1β, interleukin-1β; proIL-1β, precursor IL-1β; ATP, adenosine triphosphate; CIA, collagen-induced arthritis; ST, synovial tissues; SF, synovial fluid; ECM, extracellular matrix; PBS, phosphate-buffered saline; siRNA, small interfering RNA; PDTC, pyrrolidine dithiocarbamate; HSFs, human skin fibroblasts; ChIP, chromatin immunoprecipitation; MAPK, mitogen-activated protein kinase. ⁎ Correspondence to: L. Xiao, Institute of Arthritis Research, Shanghai Academy of Chinese Medical Sciences, 540 Xinhua Road, Shanghai 200025, PR China. ⁎⁎ Correspondence to: N. Li, Shanghai Institute of Immunology, Institute of Medical Sciences, Shanghai Jiao Tong University School of Medicine, 280 South Chongqing Road, Shanghai 200025, PR China. Fax: +86 21 63846383. E-mail addresses: [email protected] (L. Xiao), [email protected] (N. Li). 1 These two authors contributed equally to this work. 2 Both corresponding authors contributed equally to this work.

http://dx.doi.org/10.1016/j.clim.2015.02.010 1521-6616/ © 2015 Elsevier Inc. All rights reserved.

188 Fibroblast-like synoviocyte

X. Zhu et al. hardly detectable in the supernatant. We also found that the level of adenosine triphosphate (ATP) in SF and ST was significantly increased in RA patients and that the level of IL-1β in supernatants from Cyr61-activated FLS increased significantly when we added exogenous ATP to the culture. Mechanistically, Cyr61 induced proIL-1β production in FLS via the AKT-dependent NF-κB signaling pathway, and ATP caused Cyr61-induced proIL-1β to generate IL-1β in a caspase-1-dependent manner. Our results reveal a novel role of Cyr61 in RA that involves the promotion of proIL-1β production in FLS. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Human rheumatoid arthritis (RA), which occurs in approximately 1% of the population, is a complex chronic inflammatory disease that involves hyperplasia of synovial tissues (ST) and structural damage to tissue [1,2]. Although the etiology and pathogenesis of RA are still unclear, there is increasing evidence suggesting that cytokines contribute to the activation of fibroblast-like synoviocytes (FLS), which in turn leads to joint inflammation and erosion of cartilage and bone [3]. It is believed that IL-1β is one of the primary cytokines involved in the progression of chronic joint inflammation and the concomitant erosive changes in cartilage and bone [4,5]. IL-1β is essential for the control of infections or self-danger signals, but its uncontrolled production could be harmful. Earlier studies found that the level of IL-1β is significantly increased in synovial tissues (ST) and synovial fluid (SF) of RA patients [6,7]. In RA, increased expression of IL-1β can induce the production of chemokines such as MCP-1 and MIP-3α and of cytokines such as IL-6 and IL-8 at the site of inflammation, promoting the recruitment and activation of inflammatory cells such as neutrophils, macrophages and Th17 cells [8–10]. IL-1β also triggers the expression of matrix metalloproteinases (MMP) such as collagenases and elastase and the secretion of prostaglandin E2 (PGE2), all of which are involved in tissue destruction and in the resulting disability of RA patients [5,11,12]. In animal models, injection of IL-1β into joints or expression of IL-1β by local gene transfer can lead to a severe, highly aggressive form of arthritis that shares some of the features of RA in humans [13–16]. The level of IL-1β in plasma is clearly related to the severity of inflammation and joint destruction in RA, and further analysis found that the erosion of bone and cartilage is highly dependent on IL-1β [17,18]. Interestingly, in TNF-α-deficient mice, a collagen-induced arthritis (CIA) murine model can be established, while blockage of IL-1β function with anti-IL-1RI antibodies protects mice from CIA [19,20]. In IL-1β-deficient CIA mice, inflammation and joint destruction are ameliorated [21]. Targeting pathways triggered by IL-1β may represent a promising therapeutic opportunity for RA [22,23]. Anakinra, a recombinant human IL-1 receptor antagonist, blocks the biological activity of IL-1, including the inflammation and cartilage degradation associated with RA. Biological therapy with anakinra in RA has been approved by the U.S. Food and Drug Administration (FDA) for use in clinical phase IV trials [24]. Because the effects of anakinra on disease activity are weaker than those obtained with anti-TNF agents and because

anakinra has a very short biological half-life (4–6 h) and must be administered subcutaneously once a day, the use of anakinra in the clinical treatment of RA may have some disadvantages. Nevertheless, anakinra has been used successfully in juvenile RA [25]. Together, these reports suggest that IL-1β is a key mediator in the development of RA [1]. Given that IL-1β production by FLS is induced by many inflammatory cytokines such as TNF-α [26] and TGF-β [27], it would be of interest to know whether there are other inducers of IL-1β expression. It is well known that IL-1β is first synthesized as a 31-kDa polypeptide (precursor IL-1β, proIL-1β) that is then cleaved to generate 17-kDa IL-1β (mature IL-1β) in a caspase-1-dependent manner [28,29]. Caspase-1, also known as interleukin-1converting enzyme (ICE), plays a key role in IL-1β production though its cleavage of proIL-1β [29,30]. Caspase-1 is initially expressed as an inactive zymogen that is then activated by numerous exogenous agents (for example, microbial components and asbestos) and endogenous agents (for example, ATP, monosodium urate and calcium pyrophosphate dihydrate crystals) [28]. As a secreted extracellular matrix (ECM) component, Cyr61/CCN1 is important for cell proliferation, adhesion, migration and differentiation [31,32]. Cyr61 is also considered a novel proinflammatory factor [33]. We first reported that the expression of Cyr61 is greatly enhanced in FLS from RA patients; this increased expression of Cyr61 in turn further stimulates FLS proliferation, induces Th17 differentiation by promoting IL-6 production, and promotes neutrophil infiltration by inducing IL-8 production in RA [34–36]. Blocking Cyr61 activity can ameliorate joint inflammation and erosion in CIA mice [35,36]. These results show that Cyr61 plays an important role in the development of RA. Recently, a study showed that Cyr61 can promote IL-1β mRNA expression in murine macrophages [37]. In chronically sun-exposed human skin, Cyr61 can induce IL-1β production by primary dermal fibroblasts [38]. However, whether Cyr61 has any effect on IL-1β production in RA FLS has not yet been explored. In the work reported here, we demonstrate that Cyr61 induces proIL-1β production in FLS through the AKTdependent NF-κB signaling pathway. We also show that increased ATP levels in SF and ST from RA patients promote Cyr61-induced cleavage of proIL-1β to generate IL-1β in a caspase-1-dependent manner. Taken together with the results of our previous work [34–36], these findings provide new evidence that Cyr61 enhances IL-1β-mediated inflammation and tissue damage in RA and that Cyr61 thus plays an important role in the development of RA.

Cyr61's role in RA inducing proIL-1β production by FLS via AKT-dependent NF-κB signaling pathway

2. Materials and methods

189

2.4. Probing of signaling pathways involved in Cyr61-induced IL-1β production

2.1. Patients and specimens A total of 43 RA patients (5 men and 36 women, age 30–82 years, the mean and SD 56 ± 15) were included in the study. The disease duration of the RA patients was 17 ± 8 years. The diagnosis of RA fulfilled the revised criteria of the American College of Rheumatology [39]. The control subjects were 29 osteoarthritis (OA) patients who fulfilled the diagnosis criteria of OA proposed by Altman [40]. ST were obtained from patients, and FLS were cultured and identified as reported previously [34,36]. Briefly, ST specimens were minced into small pieces and incubated for 2 h with 1 mg/ml type I collagenase (Sigma-Aldrich, Bornem, Belgium) in Dulbecco's modified Eagle's medium (DMEM) at 37 °C. Cells were collected by filtering the suspension through nylon mesh (70 μm). The cells were extensively washed and cultured in complete high-glucose DMEM supplemented with 10% fetal calf serum (FCS; Gibco, Grand Island, NY, USA), 2 mM L-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin in a humidified 5% CO2 incubator. FLS at passages 4–6 were used in our study and were overwhelmingly negative (N 99%) for CD14, CD11b, CD3, and CD19 surface markers as determined using a FACSCalibur flow cytometer (BD Biosciences, San Diego, CA, USA). Primary cultures of FLS from 24 RA patients were used in this study. SF and cell culture supernatants were collected as reported previously [34,36]. All study protocols and consent forms were approved by the Institutional Medical Ethics Review Board of the Shanghai Jiaotong University School of Medicine (2013028).

2.2. Real-time PCR analysis Total RNA was extracted from cells and real-time PCR was performed as previously reported [34,36]. Briefly, total RNA was extracted from specimens using Tripure isolation reagent (Roche Diagnostics, Indianapolis, IN, USA), according to the manufacturer's instruction. Real-time PCR was performed using SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. The primers used in this study were IL-1β—forward: 5′-TCTGCCCAGTTCCCCAACT-3′; IL-1β—reverse: 5′-TTGGTCC CTCCCAGG AAGA-3′. GAPDH—forward: 5′-CACATGGCCTCCAA GGAGTAA-3′; and GAPDH—reverse: 5′-TGAG G GTCTCTCTCTT CCTCTTGT-3′.

2.3. RNAi knockdown of gene expression Cyr61 small interfering RNAs were designed and synthesized at Shanghai GenePharma (Shanghai, China), and gene knockdowns were performed as previously reported [34–36]. In brief, FLS were cultured in 24-well plates. A transfection mixture of siRNA oligonucleotides and Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in serum-free medium was added to medium-aspirated cells for 4 h. Then, the medium was replaced with complete DMEM containing 10% fetal bovine serum for an additional 24 h.

Special inhibitors of the PI3K/AKT, NF-κB and MAPK signaling pathways were purchased from Sigma-Aldrich and used to analyze Cyr6-induced IL-1β production. Briefly, 20 μM LY294002 (an inhibitor of PI3K/AKT), 4 μM pyrrolidine dithiocarbamate (PDTC; an inhibitor of NF-κB activation), 10 μM SB203580 (an inhibitor of p38 MAPK), 1 μM PD98059 (an inhibitor of ERK1/2), or 20 μM SP600125 (an inhibitor of JNK) was added to the cell culture medium; 5 μg/ml Cyr61 was also added at the same time. The expression of proIL-1β/IL-1β mRNA was then determined using real-time PCR, the level of proIL-1β in FLS lysates was evaluated by western blotting, and the concentration of IL-1β in the culture supernatant was measured by ELISA. The activation of AKT and NF-κB was analyzed by western blotting with specific antibodies. In some experiments, a specific inhibitor of caspase-1 (YVAD, Sigma-Aldrich, Bornem, Belgium) was added to block IL-1β maturation.

2.5. ELISA The levels of IL-1β and Cyr61 in cell culture supernatants and SF were determined using a sandwich ELISA (sensitivity 3.9–250 pg/ml; R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions.

2.6. Western blot analysis Protein immune blotting was performed as described previously [34]. In brief, tissue or cell lysates were separated by SDS-PAGE electrophoresis followed by transfer to PVDF membranes (Millipore Corporation, Bedford, MA, USA) at 100 V for 90 min. The production of proIL-1β and the phosphorylation of AKT and NF-κB were analyzed using specific antibodies (Cell Signaling Technology Inc., Beverly, MA, USA). After washing with PBS, the membranes were incubated with HRP-conjugated goat anti-rabbit IgG at RT for 1 h followed by washing with PBS. The target proteins were examined using an ECL system (Millipore Corporation, Bedford, MA, USA) and visualized with autoradiography film.

2.7. ATP bioluminescence assay The levels of ATP in SF and ST were determined using an ATP bioluminescence assay kit (Beyotime, Haimen, JS, China). In brief, fresh SF was centrifuged at 1000 ×g for 10 min, and supernatants were collected. Fresh ST were disrupted in 400 μl of lysis buffer and centrifuged at 12,000 ×g for 10 min, and the supernatant was collected. An aliquot (100 μl) of ATP detection working solution was added to each well of a black 96-well culture plate, and the plate was incubated for 3 min at room temperature. Then, 100 μl samples from supernatants of SF and ST were added to the wells, and the luminescence was measured immediately.

2.8. Construction of luciferase reporter plasmids The IL-1β promoter sequences (− 3791 to + 48) were PCR amplified from human genomic DNA using the following

190 primers: pGL3-IL-1β (− 3791)—forward: 5′-GGGGTACCTCTAG ACCAGGGAGGAGA-3′, containing an artificial KpnI site, and pGL3-IL-1β (− 3791)—reverse: 5′-GAAGATCTGAGCAATGAAGA TTGGCTG-3′, which contains an artificial BglII site. To generate pGL3-IL-1β (−474), the primer pGL3-IL-1β (−474)—forward: 5′-GGGGTACCTATTGG CCCTTCATTGTA-3′, which contains an artificial KpnI site, was used together with pGL3-IL-1β (− 3791)—reverse. The PCR products were digested with KpnI/BglII and inserted into the corresponding restriction sites of the luciferase reporter plasmid pGL3-Basic (Promega, Fitchburg, Wisconsin, USA) to generate pGL3-IL-1β (−3791) Luc and pGL3-IL-1β (−474). The pGL3-IL-1β mutants were constructed by deleting CCC from GGAATGTCCCTTGGACTCT GCATGTCC (M1), TCC from GCTGGAGCATCCT GGCATTTCC AGCTCCCCAT (M2), and CCC from TACGTCAGGGGGCATT GCCCCATGGCTCCAAAATTTC (M3) [41]. These promoter fragments were sequenced and confirmed by automated sequencing.

2.9. Cell culture, transfection, and reporter assay Transfection and reporter assays were performed as described previously [36]. In brief, human skin fibroblasts (HSFs) were cultured in DMEM supplemented with 10% fetal bovine serum. For transient transfections, the cells were grown to 70–80% confluence in 24-well dishes and maintained serum-free prior to transfection, then transfected with GL3-IL-1β (− 3791), pGL3-IL-1β (− 474), pGL3-IL-1β (M1), pGL3-IL-1β (M2), or pGL3-IL-1β (M3) along with pRL-TK using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After a 24-h incubation period, the cells were treated with Cyr61 (5 μg/ml) for an additional 2 h, at which time luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega, Fitchburg, Wisconsin, USA) according to the manufacturer's instructions.

2.10. Chromatin immunoprecipitation (ChIP) assay ChIP assays were performed as described previously [36,42]. In brief, FLS cells treated with or without Cyr61 protein (5 μg/ml) were cross-linked by formaldehyde fixation. Following cellular and nuclear lysis, isolated chromatin was sheared by sonication and incubated overnight at 4 °C with antibody against NF-κB p65 (Cell Signaling Technology Inc., Danvers, MA, USA) or control rabbit IgG (PeproTech, Rocky Hill, NJ, USA). Immune complexes were subjected to cross-linking reversal, extracted, and precipitated as described in the manufacturer's protocol. The eluted DNA and the aliquots of chromatin prepared prior to immunoprecipitation (input) were subjected to semi-quantitative PCR. The PCR primers used to amplify the IL-1β promoters were: forward (− 3115): 5′-TGGAGCATCCTGGCATTTC-3′ and reverse (− 3022), 5′-GGAGTGGA AGAGTGATGATGATGT-3′. The PCR conditions were as follows: 1 cycle at 95 °C for 5 min; 34 cycles at 95 °C for 30 s; 60 °C for 30 s; 72 °C for 1 min; and 1 cycle at 72 °C for 5 min. The PCR products were separated on 3% agarose gels containing ethidium bromide. Densitometry was used to quantify the PCR results, and all results were normalized to their respective input values.

X. Zhu et al.

2.11. Statistical analysis All experiments were performed in triplicate. Differences among groups were determined by ANOVA analysis, and comparison between two groups was analyzed by the t-test using GraphPad Prism 4.0 software (GraphPad Software, Inc., San Diego, CA, USA). A value of P b 0.05 was considered to indicate statistical significance.

3. Results 3.1. IL-1β and Cyr61 levels are increased in RA synovial fluid (SF) Numerous studies have demonstrated that IL-1β is an important inflammatory cytokine that plays a key role in the pathogenesis of RA [4,5], and our previous studies have shown that Cyr61 induces IL-6 production in FLS, which further drives Th17 differentiation and enhances inflammation associated with RA [35]. Cyr61 also induces IL-8 production and promotes neutrophil infiltration in joints of RA [36]. To explore the role of Cyr61 in IL-1β production by FLS in RA, we examined IL-1β and Cyr61 concentrations in SF from RA and osteoarthritis (OA) patients. The results showed that the levels of IL-1β and Cyr61 were increased in RA SF compared with SF derived from OA patients (Figs. 1A and B).

3.2. Cyr61 induces proIL-1β production in FLS of RA patients Next, we analyzed the potential effect of Cyr61 on the expression of IL-1β in FLS of RA patients using primary cultured FLS. We found that Cyr61 significantly stimulated IL-1β mRNA expression in FLS (Fig. 2A). To identify the role of Cyr61 in IL-1β expression by FLS, we used specific siRNAs (small interfering RNAs) to knock down Cyr61 expression in FLS. The results showed that IL-1β mRNA expression was markedly reduced in Cyr61-knockdown FLS (Fig. 2B). These data indicate that Cyr61 can induce IL-1β mRNA expression by RA FLS. In addition, we stimulated RA FLS with exogenous Cyr61 (5 μg/ml) for different times and measured IL-1β

Figure 1 IL-1β and Cyr61 levels are increased in SF from RA patients. IL-1β (A) and Cyr61 (B) levels in SF from RA patients (n = 21) and OA patients (n = 11) were detected by ELISA. The data represent the mean ± SEM. * P b 0.05, ** P b 0.01.

Cyr61's role in RA inducing proIL-1β production by FLS via AKT-dependent NF-κB signaling pathway

191

Figure 2 Cyr61 induces IL-1β mRNA expression in RA FLS. IL-1β mRNA expression was determined by real-time PCR using a housekeeping gene as an endogenous control. (A) Left panel, IL-1β expression in RA FLS stimulated by 5 μg/ml Cyr61 (0, 2, 4, 6, 8 h). Right panel, IL-1β mRNA expression in RA FLS stimulated by Cyr61 (0.62, 1.25, 2.5, 5, 10 μg/ml) for 2 h. (B) Expression of IL-1β mRNA in Cyr61-knockdown FLS. The data represent the mean ± SEM. ** P b 0.01.

concentration in the supernatants by ELISA. In these supernatants, no IL-1β was detected (results not shown). IL-1β is first synthesized as biologically inactive proIL-1β (31 kDa), which is then processed into mature, biologically active IL-1β (17 kDa) and subsequently released into the extracellular milieu [28,29]. Because we found that Cyr61 induced IL-1β mRNA expression but did not induce the secretion of IL-1β protein, we explored whether Cyr61 could induce proIL-1β production by FLS. We found that proIL-1β was significantly increased in Cyr61-treated FLS lysates, as determined by Western blotting (Fig. 3A). Consistently, a reduction in proIL-1β levels in FLS upon Cyr61 knockdown was also found (Fig. 3B). We then treated FLS with the anti-Cyr61 monoclonal antibody 093G9. The results showed that 093G9 blocked the effect of Cyr61 on proIL-1β production by FLS (Fig. 3C). These data indicate that Cyr61 induces proIL-1β but that it does not induce IL-1β production.

3.3. ATP promotes the conversion of Cyr61-induced proIL-1β to IL-1β in FLS Studies have demonstrated that caspase-1 plays a key role in the conversion of proIL-1β into IL-1β [28–30]. ATP acts as a major agonist of caspase-1 and is involved in proIL-1β

post-translational processing [43,44], and RA FLS have been shown to express functional P2X7, an ATP receptor [45]. We therefore analyzed whether ATP can induce IL-1β in Cyr61-treated FLS. We found that the level of ATP was significantly increased in RA SF and ST (Fig. 4A). Next, we tested the potential effect of exogenous ATP on the production of IL-1β by Cyr61-treated FLS. In the supernatant from untreated FLS or from FLS treated with Cyr61 alone, no IL-1β was found, whereas a low level of IL-1β was detectable in the supernatant from FLS treated with ATP alone (Fig. 4B). However, when FLS were stimulated with Cyr61 for 5 h and then treated with ATP for an additional 1 h, the level of IL-1β in the supernatant was increased (Fig. 4B). Furthermore, we found that Cyr61-induced proIL-1β production decreased significantly in FLS co-cultured with Cyr61 and ATP (Fig. 4C), suggesting that, in RA FLS, ATP can convert the Cyr61-induced proIL-1β into IL-1β, which is subsequently released into the extracellular milieu. Because previous studies have shown that ATP increases proIL-1β post-translational processing through activation of the caspase-1 pathway [43,44], we further explored the role of caspase-1 in Cyr61-induced IL-1β production. We added the caspase-1 inhibitor YVAD to FLS cultures together with Cyr61 and ATP and examined the proIL-1β and IL-1β profile

Figure 3 Cyr61 promotes proIL-1β production in RA FLS. ProIL-1β production in RA FLS was determined by western blotting. (A) ProIL-1β production in RA FLS stimulated with Cyr61 (5 μg/ml) for 5 h. (B) ProIL-1β production in Cyr61-knockdown FLS. FLS were transfected with siCyr61 or siNC as described in the Materials and methods section. (C) An anti-Cyr61 monoclonal antibody (093G9) inhibited Cyr61-induced proIL-1β production by FLS. FLS were pretreated with 20 μg/ml anti-Cyr61 monoclonal antibody (named 093G9) or with control IgG for 1 h. After pretreatment, the FLS were stimulated with Cyr61 (5 μg/ml) for 5 h and cell lysates were analyzed for production of proIL-1β by western blotting.

192

X. Zhu et al.

Figure 4 ATP promotes Cyr61-induced proIL-1β conversion into IL-1β in FLS. (A) The levels of ATP in SF (left panel) and ST (left panel) from RA and OA patients were measured as described in the Materials and methods section. (B) IL-1β in supernatants of FLS co-cultured with Cyr61 and ATP was detected by ELISA. FLS were stimulated with Cyr61 for 5 h, then treated with or without ATP for an additional 1 h. (C) ATP promoted Cyr61-induced proIL-1β conversion into IL-1β in FLS in a caspase-1-dependent manner. FLS were stimulated with 5 μg/ml Cyr61 for 5 h, then treated with 5 mM ATP in the presence or absence of 100 μM YVAD (a caspase-1 inhibitor) for an additional 1 h. Left panel, proIL-1β expression in RA FLS lysates were analyzed by western blotting. Right panel, IL-1β in the supernatants was detected by ELISA.

of the cells. The results showed that proIL-1β was increased in FLS lysates (Fig. 4C) and that IL-1β was decreased in the supernatant (Fig. 4D), suggesting that the caspase-1 inhibitor could block the effect of ATP on the conversion of proIL-1β to IL-1β in Cyr61-treated FLS.

3.4. Cyr61 induces proIL-1β production in FLS through the AKT/NF-κB signaling pathway Because our results showed that Cyr61 induces proIL-1β production in FLS, we probed downstream signaling pathway(s) using known inhibitors of several pathways, including Ly294002 (an inhibitor of the PI3K/AKT pathway), PDTC (an inhibitor of NF-κB activation), SP600125 (an inhibitor of JNK), PD98059 (an inhibitor of ERK1/2), and SB203580 (an inhibitor of p38 MAPK). The results showed that Cyr61-stimulated IL-1β mRNA expression and proIL-1β production in FLS were markedly decreased in the presence of the PI3K/AKT and NF-κB inhibitors. In contrast, inhibition of JNK, ERK1/2 and p38 MAPK activities had no effect on Cyr61-induced proIL-1β production (Figs. 5A and 6B). Consistent with these observations, the results of ELISA assays showed that the concentration of IL-1β in FLS culture supernatant was significantly decreased in the presence of the PI3K/AKT and NF-κB inhibitors (Fig. 5C). Further analysis showed that Cyr61 treatment led to a dramatic increase in the phosphorylation of the AKT and NF-κB p65 subunit in FLS (Fig. 5D), a finding

that is consistent with previous reports [35,36]. Given that previous studies have shown that Cyr61 induces NF-κB activation via the PI3K/AKT pathway in breast cancer cells [46–48], we determined whether this pathway was also activated during proIL-1β production by FLS upon Cyr61 stimulation. Indeed, we found that PI3K/AKT inhibitors strongly decreased the phosphorylated (activated) forms of AKT and NF-κB p65 in response to Cyr61 treatment in FLS (Fig. 5D). Based on these results, we suggest that Cyr61 induction of proIL-1β production in FLS is dependent on the AKT/NF-κB signaling pathway.

3.5. Cyr61 increases p65 binding to the response element in the IL-1β promoter Previous studies have shown that IL-1β expression is regulated by a sequence spanning nucleotides −1 to −4000 of upstream DNA flanking the IL-1β gene and that there are 4 NF-κB binding sites in the promoter region of the gene. The most distal NF-κB binding site is at − 3771 to −3762 bp, the second is at − 3105 to − 3096 bp, the third is at −2787 to − 2778 bp, and the most proximal site is at − 308 to − 249 bp [41,49]. To identify the binding site of NF-κB stimulated by Cyr61 in IL-1β expression, we constructed two IL-1β promoters [pGL3-IL-1β (−3791), which includes 4 NF-κB binding sites and pGL3-IL-1β (− 474), which includes only one NF-κB binding site, the one located at the most proximal promoter region of IL-1β] and placed these

Cyr61's role in RA inducing proIL-1β production by FLS via AKT-dependent NF-κB signaling pathway

193

Figure 5 Signaling pathways involved in Cyr61-induced proIL-1β production in RA FLS. (A) Effect of inhibitors of signaling pathways on Cyr61-induced proIL-1β/IL-1β mRNA expression. FLS were treated with 20 μM LY294002, 4 μM PDTC, 20 μM SP600125, 1 μM PD98059 or 10 μM SB203580 in combination with Cyr61 (5 μg/ml) (shadowed bars) for 2 h, and proIL-1β/IL-1β mRNA relative expression was evaluated by real-time PCR. Control (open bar), Cyr61 (no inhibitors, black bar). (B) Effect of inhibitors of signaling pathways on Cyr61-induced proIL-1β production. Cyr61-induced proIL-1β production in RA FLS lysates treated with 20 μM LY294002, 4 μM PDTC, 20 μM SP600125, 1 μM PD98059 or 10 μM SB203580 for 5 h was detected by western blotting. (C) Effect of inhibitors of signaling pathways on IL-1β protein expression in Cyr61-stimulated FLS. The shadowed bars indicate RA FLS treated simultaneously with Cyr61 (5 μg/ml) and an inhibitor (20 μM LY294002, 4 μM PDTC, 20 μM SP600125, 1 μM PD98059 or 10 μM SB203580) for 5 h, then with ATP for an additional 1 h. IL-1β concentration in the supernatants was analyzed by ELISA. Control (open bar), Cyr61 (no inhibitors, black bar). The data represent the mean ± SEM of at least 3 independent experiments. * P b 0.05, ** P b 0.01. (D) Phosphorylation of AKT and NF-κB was detected by western blotting. Lane 1: unstimulated FLS; lane 2: FLS stimulated with Cyr61 (5 μg/ml) for 30 min; lane 3: FLS stimulated with Cyr61 (5 μg/ml) and 20 μM LY294002 for 30 min.

promoters upstream of the luciferase gene. We transfected the plasmid containing the two IL-1β promoters into human skin fibroblasts (HSFs) and treated the HSFs with Cyr61. The results showed that Cyr61 increased pGL3-IL-1β (− 3791) promoter activity (Fig. 6A). In contrast, pGL3-IL-1β (−474), which corresponds to the most proximal NF-κB site (−474), showed no effect on exposure to Cyr61 (Fig. 6A), suggesting that three of the NF-κB binding sites present at the distal promoter region of IL-1β are important for responsiveness to Cyr61-induced IL-1β. To further analyze the role of the 3 NF-κB binding sites in the distal promoter region of the IL-1β gene in the control of Cyr61-induced IL-1β expression, we constructed three IL-1β promoters corresponding to deletion mutants of the NF-κB binding sites; these we called M1, M2 and M3, respectively (Fig. 6B). We transfected these mutated IL-1β promoters

into HSFs and treated the HSFs with 5 μg/ml Cyr61 for 2 h. The results showed that M2 was most effective in the loss of responsiveness to Cyr61, followed by M1 and M3 in that order (Fig. 6B). These data indicate that the site (−3105 to −3096 bp) is the most important of the three promoter regions for Cyr61-induced IL-1β gene expression in RA FLS. To measure the binding of p65 to the IL-1β promoter following Cyr61 challenge in vitro, we performed ChIP assays in FLS stimulated with exogenous Cyr61. The results showed that p65 binding to the IL-1β promoter was significantly increased in Cyr61-stimulated FLS cells compared with controls (Fig. 6C). In contrast, treatment with 093G9 resulted in significantly reduced binding of p65 to the IL-1β promoter region (Fig. 6C). Together, these results indicate that Cyr61 induces p65 binding to the corresponding response elements in the IL-1β promoter and thereby increases the transcriptional

194

X. Zhu et al.

Figure 6 Identification of binding sites essential for the transcription of the IL-1β gene in Cyr61-treated FLS. (A) pGL3-IL-1β (−3791), pGL3-IL-1β (−474), and control vector pRL-TK plasmids were transfected into HSF for 4 h; the cells were then cultured for 20 h and incubated for 2 h in the presence or absence of Cyr61 (5 μg/ml). (B) pGL3-IL-1β (−3791), their mutants, and control vector pRL-TK plasmids were transfected into HSF cells. The hatched box indicates the mutation site. After 4 h of transfection, the cells were cultured for 20 h, incubated for an additional 2 h in the presence or absence of Cyr61 (5 μg/ml), and luciferase activity was measured. The luciferase activity relative to control after normalization to Renilla luciferase activity is indicated. The data represent the mean ± SEM of at least 3 independent experiments. * P b 0.05, ** P b 0.01. (C) FLS were stimulated with Cyr61 (5 μg/ml), and p65 bound to the response element in the IL-1β promoter was detected by ChIP assay. It is noted that pre-incubation of the cells with 093G9 (20 μg/ml) or control IgG (20 μg/ml) for 1 h prior to Cyr61 stimulation suppressed p65 DNA binding. The relative amounts of IL-1β promoter DNA bound to p65 were detected by PCR and quantified by densitometric scanning.

activity of the IL-1β promoter. Based on these findings, we suggest that Cyr61 induces IL-1β gene expression in FLS via AKT-dependent NF-κB activation.

4. Discussion Although the etiology and pathogenesis of RA are still unclear, there is increasing evidence suggesting that IL-1β exerts strong proinflammatory activity and plays an important role in the development of RA [1,4,5,12,24,28]. As a secreted extracellular matrix (ECM) protein, Cyr61 is now considered a novel proinflammatory factor [33]. In previous studies, we found that the expression of Cyr61 is greatly enhanced in FLS from RA patients; this increased expression of Cyr61 in turn acts to induce IL-6 and IL-8 production in FLS, both of which promote the development of joint inflammation [34–36]. FLS play a critical role as a source of inflammatory cytokines in joint disease [50–52]; however, whether Cyr61 is involved in IL-1β production by FLS remains unknown. In this study, we examined the level of IL-1β in RA SF and found it to be increased in RA SF patients, a finding that is consistent with our previous reports [35]. Furthermore, we found that Cyr61 is able to induce IL-1β mRNA expression and increase proIL-1β synthesis but that it does not induce mature IL-1β production in FLS from RA patients. This finding suggests that proIL-1β can be induced by Cyr61 but that the induced proIL-1β is not converted to the mature form, indicating that Cyr61 does not directly cleave 31-kDa proIL-1β in RA FLS.

Numerous observations support the idea that caspase-1 plays a pivotal role in the cleavage of 31-kDa proIL-1β to generate the 17-kDa mature form of IL-1β. ATP acts as a major agonist of caspase-1 and is involved in the post-translational processing of proIL-1β [29,30]. Given that RA FLS have been shown to express functional P2X7, an ATP receptor [45], we evaluated whether ATP can activate caspase-1 and promote the Cyr61-induced proIL-1β into mature IL-1β in FLS of RA. We found that the level of ATP was significantly increased in RA SF and ST from RA patients and that ATP indeed has the ability to stimulate the conversion of Cyr61-induced proIL-1β into mature IL-1β, which is subsequently released into the extracellular milieu after activation by caspase-1. Our data indicate that two signals are required for IL-1β production from Cyr61-induced FLS: first, Cyr61 promotes the transcription and translation of mRNA for proIL-1β; and second, extracellular ATP induces IL-1β processing and release in a caspase-1-dependent manner. Although FLS produce lower amounts of IL-1β than macrophages, there is a very large number of FLS in RA joints, and their higher numbers at inflammatory joint sites make them an important source of IL-1β. Our previous studies have shown that the elevated Cyr61 in RA FLS plays an important role in Th17 differentiation and in FLS proliferation in joints [35]. Given that some studies found that IL-1β contributes to Th17 differentiation in mice and humans [28,53], our present results showed that in addition to promoting Th17 differentiation by inducing IL-6 in FLS, Cyr61 also stimulates Th17 development by upregulating IL-1β production in FLS. Thus, Cyr61 acts as an

Cyr61's role in RA inducing proIL-1β production by FLS via AKT-dependent NF-κB signaling pathway important bridge between Th17 activity and FLS proliferation, creating a malicious “inflammation–tissue damage” cycle and promoting the development of RA pathogenesis. How does Cyr61 induce proIL-1β production in FLS? To address the signaling pathway through which Cyr61 promotes proIL-1β production in FLS, we evaluated the profiles of AKT/NF-κB, a well-known Cyr61/integrin pathway [31], and of three well-defined MAPK pathways (JNK, ERK and p38). As expected, the AKT/NF-κB pathway contributed to Cyr61-induced proIL-1β production in FLS. However, the MAPK pathways (JNK, ERK and p38) did not contribute to Cyr61-induced proIL-1β production in FLS. A previous report has shown that there are four NF-κB binding sites spanning nucleotides −1 to −4000 of DNA upstream of the IL-1β gene [41]. That study showed that in the RA patient-derived synovial fibroblast cell line MH7A, the NF-κB binding site at − 3771 to −3762 bp is most critical for IL-1β gene activation by cigarette smoke condensate extracts, followed by the NF-κB binding site at −3105 to − 3096 bp. However, we found that the NF-κB site at − 3105 to − 3096 bp in the IL-1β promoter was most important for the responsiveness to Cyr61 in RA FLS. This may be due to the different inducing factors studied (Cyr61 versus cigarette smoke condensate extracts) and to differences in the cells used (primary FLS versus RA patient-derived synovial fibroblast cell line MH7A). Cyr61 elicits diverse functions in its target cells by binding to different types of integrin molecules such as αvβ3, αvβ5, αIIbβ3, and α6β1, which are expressed by different cells [31,32]. In RA FLS, we have shown that ανβ5 is the Cyr61 receptor involved in proinflammatory cytokine production and FLS proliferation [34,35]. Based on our previous studies and on the work presented here, we suggest that Cyr61 is able to

195

induce proIL-1β production in FLS via the αvβ5/Akt/NF-κB signaling pathway (Fig. 7).

5. Conclusions It is increasingly understood that ECM plays an important role in maintaining the inflammatory microenvironment in disease and that targeting ECM might therefore be an effective strategy for the treatment of some diseases [54]. Our study demonstrates for the first time that Cyr61 has a novel role inducing IL-1β production by FLS and that it might be involved in the development of RA (Fig. 7). Together with the results of previous studies, the work presented here suggests that Cyr61, as an ECM and proinflammatory factor, plays an important role in the development of RA. Cyr61 might represent a novel potential target in RA treatment.

Financial support This work was supported by the National Basic Research Program of China (2010CB529103), the Jiangsu Province Special Program of Medical Science (BL 2013034), the National Natural Science Foundation of China (81172856), the Shanghai Municipal Science and Technology Commission (12JC1407700, 12DZ1941802, and 12401903700/2), and the Shanghai Municipal Education Commission (J50207).

Conflict of interest statement The authors declare that they have no competing interests.

Figure 7 Schematic model for Cyr61-stimulated IL-1β production. As the first signal in IL-1β production by RA FLS, over-secretion of Cyr61 stimulates proIL-1β production in an autocrine manner via the AKT-dependent NF-κB signaling pathway. In Cyr61-mediated NF-κB activation, site 2 of the IL-1β promoter (−3105, −3096) is the most effective, followed by site 1 (−3771, −3762) and site 3 (−2787, −2778), respectively. As a secondary signal, extracellular ATP induces proIL-1β cleavage to generate IL-1β in a caspase-1-dependent manner. Finally, IL-1β is released and mediates inflammatory responses and tissue damage in RA.

196

X. Zhu et al.

References [19] [1] C. Stehlik, Multiple interleukin-1beta-converting enzymes contribute to inflammatory arthritis, Arthritis Rheum. 60 (2009) 3524–3530. [2] G.S. Firestein, Evolving concepts of rheumatoid arthritis, Nature 423 (2003) 356–361. [3] S.M. Jung, K.W. Kim, C.W. Yang, S.H. Park, J.H. Ju, Cytokinemediated bone destruction in rheumatoid arthritis, J. Immunol. Res. 2014 (2014) 263625. [4] C.A. Dinarello, Interleukin-1 in the pathogenesis and treatment of inflammatory diseases, Blood 117 (2011) 3720–3732. [5] D. Burger, J.M. Dayer, G. Palmer, C. Gabay, Is IL-1 a good therapeutic target in the treatment of arthritis? Best Pract. Res. Clin. Rheumatol. 20 (2006) 879–896. [6] C.I. Westacott, J.T. Whicher, I.C. Barnes, D. Thompson, A.J. Swan, P.A. Dieppe, Synovial fluid concentration of five different cytokines in rheumatic diseases, Ann. Rheum. Dis. 49 (1990) 676–681. [7] G.S. Firestein, J.M. Alvaro-Gracia, R. Maki, Quantitative analysis of cytokine gene expression in rheumatoid arthritis, J. Immunol. 144 (1990) 3347–3353. [8] S. Ahmed, A. Pakozdi, A.E. Koch, Regulation of interleukin1beta-induced chemokine production and matrix metalloproteinase 2 activation by epigallocatechin-3-gallate in rheumatoid arthritis synovial fibroblasts, Arthritis Rheum. 54 (2006) 2393–2401. [9] M. Chabaud, G. Page, P. Miossec, Enhancing effect of IL-1, IL-17, and TNF-alpha on macrophage inflammatory protein-3alpha production in rheumatoid arthritis: regulation by soluble receptors and Th2 cytokines, J. Immunol. 167 (2001) 6015–6020. [10] J. Park, H.M. Choi, H.I. Yang, M.C. Yoo, K.S. Kim, Increased expression of IL-1 receptors in response to IL-1beta may produce more IL-6, IL-8, VEGF, and PGE(2) in senescent synovial cells induced in vitro than in presenescent cells, Rheumatol. Int. 32 (2012) 2005–2010. [11] M.B. Goldring, J. Birkhead, L.J. Sandell, T. Kimura, S.M. Krane, Interleukin 1 suppresses expression of cartilage-specific types II and IX collagens and increases types I and III collagens in human chondrocytes, J. Clin. Invest. 82 (1988) 2026–2037. [12] V. Strand, A.F. Kavanaugh, The role of interleukin-1 in bone resorption in rheumatoid arthritis, Rheumatology (Oxford) 43 (Suppl. 3) (2004) iii10–iii16. [13] E.R. Pettipher, G.A. Higgs, B. Henderson, Interleukin 1 induces leukocyte infiltration and cartilage proteoglycan degradation in the synovial joint, Proc. Natl. Acad. Sci. U. S. A. 83 (1986) 8749–8753. [14] S.C. Ghivizzani, E.R. Lechman, C. Tio, K.M. Mule, S. Chada, J.E. McCormack, C.H. Evans, P.D. Robbins, Direct retrovirusmediated gene transfer to the synovium of the rabbit knee: implications for arthritis gene therapy, Gene Ther. 4 (1997) 977–982. [15] S.C. Ghivizzani, R. Kang, H.I. Georgescu, E.R. Lechman, D. Jaffurs, J.M. Engle, S.C. Watkins, M.H. Tindal, M.K. Suchanek, L.R. McKenzie, C.H. Evans, P.D. Robbins, Constitutive intraarticular expression of human IL-1 beta following gene transfer to rabbit synovium produces all major pathologies of human rheumatoid arthritis, J. Immunol. 159 (1997) 3604–3612. [16] A.A. van de Loo, W.B. van den Berg, Effects of murine recombinant interleukin 1 on synovial joints in mice: measurement of patellar cartilage metabolism and joint inflammation, Ann. Rheum. Dis. 49 (1990) 238–245. [17] J.A. Eastgate, J.A. Symons, N.C. Wood, F.M. Grinlinton, F.S. di Giovine, G.W. Duff, Correlation of plasma interleukin 1 levels with disease activity in rheumatoid arthritis, Lancet 2 (1988) 706–709. [18] K.Y. Fong, M.L. Boey, W.H. Koh, P.H. Feng, Cytokine concentrations in the synovial fluid and plasma of rheumatoid arthritis

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28] [29] [30] [31] [32] [33]

[34]

[35]

[36]

[37]

patients: correlation with bony erosions, Clin. Exp. Rheumatol. 12 (1994) 55–58. W.B. van den Berg, Arguments for interleukin 1 as a target in chronic arthritis, Ann. Rheum. Dis. 59 (Suppl. 1) (2000) i81–i84. I.K. Campbell, K. O'Donnell, K.E. Lawlor, I.P. Wicks, Severe inflammatory arthritis and lymphadenopathy in the absence of TNF, J. Clin. Invest. 107 (2001) 1519–1527. S. Saijo, M. Asano, R. Horai, H. Yamamoto, Y. Iwakura, Suppression of autoimmune arthritis in interleukin-1-deficient mice in which T cell activation is impaired due to low levels of CD40 ligand and OX40 expression on T cells, Arthritis Rheum. 46 (2002) 533–544. X. Le Loet, D. Nordstrom, M. Rodriguez, A. Rubbert, P. SarziPuttini, J.M. Wouters, J.M. Woolley, N. Wright, C. Lawrence, B. Appleton, Effect of anakinra on functional status in patients with active rheumatoid arthritis receiving concomitant therapy with traditional disease modifying antirheumatic drugs: evidence from the OMEGA Trial, J. Rheumatol. 35 (2008) 1538–1544. A.A. den Broeder, E. de Jong, M.J. Franssen, M.E. Jeurissen, M. Flendrie, F.H. van den Hoogen, Observational study on efficacy, safety, and drug survival of anakinra in rheumatoid arthritis patients in clinical practice, Ann. Rheum. Dis. 65 (2006) 760–762. R. Zhao, H. Zhou, S.B. Su, A critical role for interleukin-1beta in the progression of autoimmune diseases, Int. Immunopharmacol. 17 (2013) 658–669. C. Sandborg, E.D. Mellins, A new era in the treatment of systemic juvenile idiopathic arthritis, N. Engl. J. Med. 367 (2012) 2439–2440. H. Xu, Y. He, X. Yang, L. Liang, Z. Zhan, Y. Ye, F. Lian, L. Sun, Anti-malarial agent artesunate inhibits TNF-alpha-induced production of proinflammatory cytokines via inhibition of NFkappaB and PI3 kinase/Akt signal pathway in human rheumatoid arthritis fibroblast-like synoviocytes, Rheumatology (Oxford) 46 (2007) 920–926. H. Cheon, S.J. Yu, D.H. Yoo, I.J. Chae, G.G. Song, J. Sohn, Increased expression of pro-inflammatory cytokines and metalloproteinase-1 by TGF-beta1 in synovial fibroblasts from rheumatoid arthritis and normal individuals, Clin. Exp. Immunol. 127 (2002) 547–552. C. Gabay, C. Lamacchia, G. Palmer, IL-1 pathways in inflammation and human diseases, Nat. Rev. Rheumatol. 6 (2010) 232–241. C. Eder, Mechanisms of interleukin-1beta release, Immunobiology 214 (2009) 543–553. M.J. Tocci, Structure and function of interleukin-1 beta converting enzyme, Vitam. Horm. 53 (1997) 27–63. Y. Chen, X.Y. Du, Functional properties and intracellular signaling of CCN1/Cyr61, J. Cell. Biochem. 100 (2007) 1337–1345. L.F. Lau, CCN1/CYR61: the very model of a modern matricellular protein, Cell. Mol. Life Sci. 68 (2011) 3149–3163. L. Kular, J. Pakradouni, P. Kitabgi, M. Laurent, C. Martinerie, The CCN family: a new class of inflammation modulators? Biochimie 93 (2011) 377–388. Q. Zhang, J. Wu, Q. Cao, L. Xiao, L. Wang, D. He, G. Ouyang, J. Lin, B. Shen, Y. Shi, Y. Zhang, D. Li, N. Li, A critical role of Cyr61 in interleukin-17-dependent proliferation of fibroblastlike synoviocytes in rheumatoid arthritis, Arthritis Rheum. 60 (2009) 3602–3612. J. Lin, Z. Zhou, R. Huo, L. Xiao, G. Ouyang, L. Wang, Y. Sun, B. Shen, D. Li, N. Li, Cyr61 induces IL-6 production by fibroblastlike synoviocytes promoting Th17 differentiation in rheumatoid arthritis, J. Immunol. 188 (2012) 5776–5784. X. Zhu, L. Xiao, R. Huo, J. Zhang, J. Lin, J. Xie, S. Sun, Y. He, Y. Sun, Z. Zhou, B. Shen, N. Li, Cyr61 is involved in neutrophil infiltration in joints by inducing IL-8 production by fibroblastlike synoviocytes in rheumatoid arthritis, Arthritis Res. Ther. 15 (2013) R187. T. Bai, C.C. Chen, L.F. Lau, Matricellular protein CCN1 activates a proinflammatory genetic program in murine macrophages, J. Immunol. 184 (2010) 3223–3232.

Cyr61's role in RA inducing proIL-1β production by FLS via AKT-dependent NF-κB signaling pathway [38] Z. Qin, T. Okubo, J.J. Voorhees, G.J. Fisher, T. Quan, Elevated cysteine-rich protein 61 (CCN1) promotes skin aging via upregulation of IL-1beta in chronically sun-exposed human skin, Age (Dordr.) 36 (2014) 353–364. [39] D. Aletaha, T. Neogi, A.J. Silman, J. Funovits, D.T. Felson, C.O. Bingham 3rd, N.S. Birnbaum, G.R. Burmester, V.P. Bykerk, M.D. Cohen, B. Combe, K.H. Costenbader, M. Dougados, P. Emery, G. Ferraccioli, J.M. Hazes, K. Hobbs, T.W. Huizinga, A. Kavanaugh, J. Kay, T.K. Kvien, T. Laing, P. Mease, H.A. Menard, L.W. Moreland, R.L. Naden, T. Pincus, J.S. Smolen, E. StanislawskaBiernat, D. Symmons, P.P. Tak, K.S. Upchurch, J. Vencovsky, F. Wolfe, G. Hawker, 2010 Rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative, Arthritis Rheum. 62 (2010) 2569–2581. [40] R. Altman, E. Asch, D. Bloch, G. Bole, D. Borenstein, K. Brandt, W. Christy, T.D. Cooke, R. Greenwald, M. Hochberg, et al., Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association, Arthritis Rheum. 29 (1986) 1039–1049. [41] M. Adachi, S. Okamoto, S. Chujyo, T. Arakawa, M. Yokoyama, K. Yamada, A. Hayashi, K. Akita, M. Takeno, S. Itoh, T. Takii, Y. Waguri-Nagaya, T. Otsuka, K. Hayakawa, K. Miyazawa, K. Onozaki, Cigarette smoke condensate extracts induce IL-1-beta production from rheumatoid arthritis patient-derived synoviocytes, but not osteoarthritis patient-derived synoviocytes, through aryl hydrocarbon receptor-dependent NF-kappa-B activation and novel NFkappa-B sites, J. Interferon Cytokine Res. 33 (2013) 297–307. [42] J. Lin, R. Huo, L. Xiao, X. Zhu, J. Xie, S. Sun, Y. He, J. Zhang, Y. Sun, Z. Zhou, P. Wu, B. Shen, D. Li, N. Li, A novel p53/microRNA22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis, Arthritis Rheumatol. 66 (2014) 49–59. [43] A. Piccini, S. Carta, S. Tassi, D. Lasiglie, G. Fossati, A. Rubartelli, ATP is released by monocytes stimulated with pathogen-sensing receptor ligands and induces IL-1beta and IL-18 secretion in

[44]

[45]

[46] [47] [48]

[49]

[50]

[51]

[52] [53] [54]

197

an autocrine way, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 8067–8072. D.G. Perregaux, P. McNiff, R. Laliberte, M. Conklyn, C.A. Gabel, ATP acts as an agonist to promote stimulus-induced secretion of IL-1 beta and IL-18 in human blood, J. Immunol. 165 (2000) 4615–4623. F. Caporali, P.L. Capecchi, A. Gamberucci, P.E. Lazzerini, G. Pompella, M. Natale, S. Lorenzini, E. Selvi, M. Galeazzi, F. Laghi Pasini, Human rheumatoid synoviocytes express functional P2X7 receptors, J. Mol. Med. (Berl.) 86 (2008) 937–949. M.S. Hayden, S. Ghosh, NF-kappaB in immunobiology, Cell Res. 21 (2011) 223–244. Q. Li, I.M. Verma, NF-kappaB regulation in the immune system, Nat. Rev. Immunol. 2 (2002) 725–734. J.A. Menendez, I. Mehmi, D.W. Griggs, R. Lupu, The angiogenic factor CYR61 in breast cancer: molecular pathology and therapeutic perspectives, Endocr. Relat. Cancer 10 (2003) 141–152. J.P. Cogswell, M.M. Godlevski, G.B. Wisely, W.C. Clay, L.M. Leesnitzer, J.P. Ways, J.G. Gray, NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site, J. Immunol. 153 (1994) 712–723. N. Bottini, G.S. Firestein, Duality of fibroblast-like synoviocytes in RA: passive responders and imprinted aggressors, Nat. Rev. Rheumatol. 9 (2013) 24–33. B. Bartok, G.S. Firestein, Fibroblast-like synoviocytes: key effector cells in rheumatoid arthritis, Immunol. Rev. 233 (2010) 233–255. M.T. Leech, E.F. Morand, Fibroblasts and synovial immunity, Curr. Opin. Pharmacol. 13 (2013) 565–569. C.A. Dinarello, IL-1: discoveries, controversies and future directions, Eur. J. Immunol. 40 (2010) 599–606. J. Padmanabhan, A.L. Gonzalez, The effects of extracellular matrix proteins on neutrophil–endothelial interaction—a roadway to multiple therapeutic opportunities, Yale J. Biol. Med. 85 (2012) 167–185.