- Email: [email protected]
Cys 786 and Cys 776 in the Posttranslational Processing of the Insulin and IGF-I Receptors
Biochemical and Biophysical Research Communications 280, 836 – 841 (2001) doi:10.1006/bbrc.2000.4224, available online at http://www.idealibrary.com on
Cys 786 and Cys 776 in the Posttranslational Processing of the Insulin and IGF-I Receptors Davide Maggi and Renzo Cordera 1 Department of Endocrinology and Metabolism, University of Genova, Genova, Italy
Received December 26, 2000
The extracellular regions of insulin and IGF-I receptors (IR and IGF-IR) contain fibronectin type III repeats with cysteine residues potentially involved in SAS bond. In this report we show that Cys 786 in the IR and the corresponding Cys 776 in the IGF-IR regulate proreceptor dimerization with high specificity. Both C786S insulin and C776S IGF-I proreceptors reach the monomeric 210-kDa step, but do not proceed further. Mature IR C786S and IGF-IR C776S expression on plasmamembrane is abolished. No retention of C786S IR precursor was detected in the endoplasmic reticulum, which is degraded by a nonlysosomal mechanism. The rearrangement of the remaining cysteines in the insulin receptor  subunit ectodomain does not rescue dimerization of C786S insulin proreceptor. As observed in other transmembrane receptors, iuxtamembrane cysteines, specifically Cys 786 in the IR and Cys 776 in the IGF-IR, are critical for correct processing of proreceptors. © 2001 Academic Press Key Words: insulin receptor; IGF-I receptor;  subunit ectodomain; dimerization; extracellular cysteine.
IR and IGF-IR are transmembrane glycoproteins composed by two ␣ and two  subunits linked together by disulfide bonds (1, 2). The disulfide bonds formation is an early event in Insulin Proreceptor maturation process. In the ER, Insulin Proreceptor monomers undergo covalent association to produce a dimer that later is converted to the mature IR tetramer by proteolityc cleavage and glycosilation (3). It has been established that two ␣ subunits are associated together by at least two disulfide bonds, while only a single SAS is responsible for ␣- linkage (4 – 6). The C terminal portion of the ␣ subunit contains four Cys. Cys 647 in the ␣ subunit has been indicated as a part of the SAS bond between the ␣ and  subunit (5, 6). Also the IR  subunit extracellular region contains four Cys residues 1
To whom correspondence should be addressed at Di.S.E.M. Viale Benedetto XV, 6, 16132 Genova, Italy. Fax: 39103538977. E-mail: [email protected]. 0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
potentially involved in a ␣- linkage. Cysteine residues in the C terminal IR ectodomain reside in three fibronectin type III (FnIII) domains (7, 8). It has been shown that FnIII repeats in the IR ectodomain are required for the association of two monomers to produce a dimeric Insulin Proreceptor complex (9, 10). We have previously shown that Ser for Cys substitutions at position 795, 860 and 872 do not affect this process and do not prevent the IR tetramer formation (11). Aim of the present work was to investigate the role of Cys 786 in IR biosynthesis. Here we show that the C786S substitution prevents the maturation of IRs: C786S Insulin Proreceptor biosynthesis proceeds to monomer formation only, which is probably degraded, since we did not observe any accumulation of 210 Kd products nor its transition to tetrameric structure. Cysteine distribution is highly conserved among IR superfamily members (1, 2). In particular, IGF-IR  subunit extracellular domain contains three Cys at positions 776, 785, 849 corresponding to IR Cys 786, 795, 860. Such homology suggests a conserved functional role. Here we also show that C776S substitution blocks maturation of IGF-IR C776S at a proreceptor step resulting in the absence of IGF-IRs on the cell surface. These findings support the functional relevance of IR  subunit ectodomain and assign a specific role to a single cysteine residues in the FnIII organization of IR and IGF-IR ectodomains. MATERIALS AND METHODS Materials. COS1 cells were obtained from American Types Culture Collection and R ⫺ cells were kindly provided by Dr. R. Baserga (Thomas Jefferson University, Philadelphia). Anti GRP78 polyclonal and anti IGF-IR  subunit polyclonal antibodies were purchased from Santa Cruz Biotechnology while anti calnexin antibody was obtained from StressGen Biotechnology. Anti IR polyclonal antibody was kindly provided by Dr. G. Sesti (Universita` Tor Vergata, Roma). cDNA coding for human IR WT and IGF-IR WT were kindly provided by Dr. D. Accili (Columbia University, New York). Site-directed mutagenesis and construction of expression vector. Cys 786 to Ser substitution in IR and the corresponding Cys 776 to Ser mutation in IGF-IR were obtained using QuickChange sitedirected mutagenesis kit (Stratagene). For C786S substitution the
836
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS The gels were dried and exposed for autoradiography. Radioactivity of the bands of interest, excised under autoradiographic guide, was assessed in a -scintillation counter.
RESULTS
FIG. 1. IRs immunoblot. Confluent monolayers of COS1 (A), COS-IR WT (B), and COS-IR C786S (C) cells were solubilized and total cellular protein was separated on 8% SDS–PAGE in the presence of 100 mM DTT, electrophoretically transferred to nitrocellulose, and probed with an anti-IR  subunit antibody. Immunoblot presented is representative of three different experiments. Bands of interest were quantitated by scanning densitometry.
oligonucleotide was 5⬘ CATCGAGCTGCAGGCTTCCAACCAGGACACCCCTGAGGAA; for C776S mutation the oligonucleotide was 5⬘ CGCATCGATATCCACAGCTCCAACCACGAGGCTGAGAAG. cDNAs coding for IR C795S, IR C860S, IR C872S, in pCMV vector, have been obtained as previously described (11). Cell culture and transfection. COS1 and R ⫺ cells were cultured at 5% CO 2 in DMEM supplemented with 2 mM glutamine, 10% FCS, 100 units/ml penicillin G, 100 g/ml streptomycin sulphate. Subconfluent cells were transfected with wild type or mutant expression vector by calcium phosphate precipitation. Experiments were performed after 48 h. Insulin and IGF-I binding. Confluent cells, grown in 6 well plates, were washed twice with PBS and incubated for 2 h at 16°C in Hepes buffer (11) in the presence of 125I-Insulin or IGF-I tracer amounts (AmerhamPharmacia Biotech). The non specific binding, determined in the presence of 1 g Insulin or IGF-I, was subtracted.
COS-IR WT cells express 2.8 ⫾ 0.5 ⫻ 10 5 insulin binding sites on their surface while mock transfected COS1 and COS-IR C786S express only 3 ⫾ 0.6 ⫻ 10 3 insulin receptors, in spite the fact that the amounts of IR mRNA amount is superimposable in COS-IR WT and COS-IR C786S. When total cellular proteins, under reducing conditions, were immunoblotted with an anti IR  subunit antibody, in both COS-IR WT and COS-IR C786S, equal amounts of a discrete band at 210 kDa (corresponding to Insulin Proreceptor) were detected but only in COSIR WT, and not in COS-IR C786S, a band at 95 kDa (corresponding to  subunit) was present (Fig. 1). To investigate how C786S substitution could affect IR biosynthesis, 35S labelled transfected COS1 cells were pulse-chased. As shown in Fig. 2, in contrast with COS-IR C786S, in COS-IR WT cells, the Insulin Proreceptor proceeds to mature ␣ and  subunits. The small amount of ␣ and  subunits present in COS-IR C786S cells represents native COS1 IRs. The calculated half life of the 210 kDa protein, in both COS-IR WT and COSIR C786S, is about 3.5 h. C786S substitution does not affect N-glycosylation of mutated proreceptor, since the non glycosilated form of IR proreceptor is evident also in the C786S proreceptor. At early times of chase, only monomeric form of Insulin Proreceptor was recognized, both in COS-IR WT and COS-IR C786S. The rate of disappearance (about 30 min) is similar in wild type and
IR and IGF-IR immunoblot. Confluent cells were lysed as previously described (11). Cell lysates were resolved on 8% SDS-PAGE under reducing conditions. Protein were transferred to nitrocellulose (12). Nitrocellulose filters were blocked in PBS Tween 0.1 (PBS-T) 3% dry milk for 1 h at room temperature. Filters were incubated with anti IR or anti IGF-IR antibody for 1 h at room temperature, washed extensively in PBS-T and anti rabbit Ig horseradish-peroxidase linked was added for 1 h at room temperature. Following a final washing in PBS-T, bound antibodies were detected using ECL reagents (AmerhamPharmacia Biotech). Bands of interest were quantitated by densitometry using the NIH Image software. Metabolic labelling. Confluent cells were incubated in methionine and cysteine free DMEM for 30 min at 37°C in CO 2 incubator. The labelling reaction followed by addition of 200 Ci/well of Trans 35 S-label (ICN Flow) for 30 min. Then cells were incubated in DMEM 10% FCS containing 2 mM methionine and 0.5 mM cysteine for the indicated times. Finally, monolayers were lysed. For GRP78 immunoprecipitation experiments, lysis buffer was supplemented with 5 U/ml hexokinase plus 10 mM glucose to deplete intracellular ATP (13). Immunoprecipitation was carried out as described (11). Immunoprecipitated proteins were resolved on 8% SDS-PAGE. For experiments conducted under non reducing conditions, DTT was omitted in loading buffer and supernatants were resolved on 5% SDS-PAGE.
FIG. 2. Biosynthesis of IR WT and IR C786S in COS1 cells. COS-IR WT and COS-IR C786S cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for indicated times. Total cell proteins were immunoprecipitated with an anti-IR  subunit antibody, resolved on 8% SDS–PAGE. Gels were dried and exposed at ⫺80°C for 48 h.
837
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Monomer biosynthesis and tetramer formation. (Top) [ 35S]methionine-labelled COS-IR WT and COS-IR C786S were pulsed for 30 min and chased for the indicated times. Cell lysates were immunoprecipitated with an anti-IR antibody, resolved on 5% SDS–PAGE under nonreducing conditions. Gels were dried and exposed at ⫺80°C for 72 h. (Bottom) Mock transfected COS1 (A), COS-IR WT (B), and COS-IR C786S (C) cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for 4 h. Cell lysates were immunoprecipitated with an anti-IR antibody, resolved on 5% SDS–PAGE under nonreducing conditions. Gels were dried and exposed at ⫺80°C for 72 h.
mutated monomers (Fig. 3, top). However, tetramer formation was impaired by C786S substitution (Fig. 3, bottom). Different endoplasmic reticulum chaperones, such as GRP78 and calnexin, drive the correct folding of Insulin Proreceptor. It has been shown that naturally occurring mutations in the IR ectodomain impair insulin proreceptor-chaperones interaction so reducing IR biosynthetic rate (13–15). Total cellular lysates from 35S labelled COS-IR WT and COS-IR C786S have been immunoprecipitated with anti GRP78 or anti calnexin antibody. WT and C786S Insulin Proreceptors coimmunoprecipitate in equal amount with anti GRP78 or anti calnexin antibody (Fig. 4). Pulse-chase experiments, in COS-IR C795S, COSIR C860S, and COS-IR C872S, showed that IR biosynthesis was similar in all these cell lines to that observed in COS-IR WT (Fig. 5). Only in COS-IR C795S, a prolonged insulin proreceptor half-life was detected (about 6 h compared with 3.5 of WT Insulin Proreceptor). IR and IGF-IR show a high degree of homology and a similar spatial distribution of Cys suggesting conserved functional features of corresponding Cys. To test this hypothesis, we produced IGF-IR C776S by site directed mutagenesis. IGF-IR WT and IGF-IR C776S were transfected in R ⫺, mouse fibroblasts with a targeted disruption of IGF-IR gene (16), and COS1 cells. Consistently with the results obtained in COS-IR C786S cells, the transfection of cDNA coding for IGF-IR C776S did not produce any increase in 125I IGF-I binding activity compared to mock transfected R ⫺ (R-IGF-IR WT cells express 2.1 ⫾ 0.4 ⫻ 10 5 IGF-I receptors on their plasmamembrane while 125I-IGF-I binding is undetectable in mock transfected and R-IGF-IR C776S cells). This result was due to the same cellular mechanism observed for
FIG. 4. Immunoprecipitation of insulin proreceptors by antiGRP78 and anti-calnexin antibodies. Confluent monolayers of mocktransfected COS1 (A), COS-IR WT (B), and COS-IR C786S (C) were [ 35S]methionine labelled for 30 min and chased for 2 h. Cell lysates were immunoprecipitated with an anti-GRP78 (left) or anti-calnexin antibody (right). Immunoprecipitated proteins were resolved on 8% SDS–PAGE, dried, and exposed at ⫺80°C for 48 h. Bands of interest were cut under autoradiographic guide and counted in a -scintillation counter. The bands at 78, 90, and 210 M r correspond to GRP78, calnexin, and insulin proreceptor, respectively.
IR C786S. In fact, as shown in Fig. 6 (left), both in R-IGFIR WT and R-IGF-IR C776S cells, IGF-IR precursor was detected. However dimer formation is greatly reduced in R-IGF-IR C776S compared to R-IGF-IR WT (Fig. 6, right) resulting in the absence of mature ␣ and  subunits. Similar results were obtained in transiently transfected COS1 cell (data not shown). DISCUSSION
 subunit extracellular domain regulates several IR functions. First, it serves as an anchorage to the extracellular ␣ subunit (17). Different technical approaches established the disulfide bond organization of isolated
FIG. 5. Biosynthesis of IR C795S, IR C860S, and IR C872S. Experiments were carried out exactly as in the legend to Fig. 3.
838
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 6. Biosynthesis of IGF-I receptors in R-IGF-IR WT and R-IGF-IR C776S cells. Mock-transfected R ⫺ (A), R-IGF-IR WT (B), and R-IGF-IR C776S (C) cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for 4 h. Total cell proteins were immunoprecipitated with an anti-IGF-IR  subunit antibody, resolved on 8% SDS–PAGE under reducing conditions (left), or on 5% SDS–PAGE under nonreducing conditions (right). Gels were dried and exposed at ⫺80°C for 72 h.
IR ectodomain indicating the presence of a disulfide bond between Cys 647 and Cys 860 (5, 6). However contrasting results were obtained by direct alkylation or site directed mutagenesis of native IR (18, 11). It is possible that IR ectodomain folding differs from that of native IR as suggested also by the observation of different maturation efficiency of truncated proreceptor (9) and their different insulin binding affinity (19). Moreover, IR with a Cys to Ser substitution at position 860 is correctly processed to plasmamembrane suggesting that another Cys could play the role of the absent Cys 860 (11). Second,  subunit ectodomain regulates IR internalization and signal transduction. Modification of N-glycosylation site of  subunit extracellular portion reduces transmembrane signalling (20) as well as the C860S mutation does (11). Finally,  subunit extracellular region is important for the IR post-translational processing. Deletion of exon 13 greatly reduces IR precursor maturation (21) as well as the loss of Cys 786 results in the rapid intracellular degradation of truncated IR (9). Also fusion of IR ectodomain to the immunoglobulin constant domains suggested a role of  subunit extracellular region in stabilizing ectodomain dimers (22). Recently, it has been demonstrated that IR dimerization is dependent to the Fn type III domains of extracellular  subunit (10). To determine the functional role of cysteine residues in the FnIII1 and FnIII2 repeats of native IR  subunit, we have mutated each cysteine to serine and we have expressed the corresponding cDNA in COS1 cells. Here we have shown that Cys 786 has an unique role and is critical for IR biosynthesis. Infact, C786S substitution prevents Insulin Proreceptor dimerization, a step necessary to proceed to IR tetramer forma-
tion. This finding confirms, in the insulin holoreceptor, the results obtained with truncated IRs (9, 10). It is interesting to note that IR precursor carrying a deletion of exon 13 (which does not change Cys number in the  subunit extracellular region) dimerize correctly (21). These observations suggest that Cys 786 is critical for dimerization process. The role of Cys 786 in IR biosynthesis is highly specific. Infact IR C795S, IR C860S and IR C872S precursors are correctly processed and expressed on plasmamembrane. It has been previously shown that mutated Insulin Proreceptor are retained in the ER by a chaperone mediated mechanism (13, 15, 23). C786S mutation does not impair Insulin Proreceptor interaction with GRP78 and calnexin, which catalyze the initial steps in IR biosynthetic pathway. These findings agree with the proposed model of IR biosynthesis. Infact, Insulin Proreceptors dimerize only after interaction with GRP 78 and calnexin (16). On the other hand, the kinetic of Insulin Proreceptor disappearance is superimposable in COS-IR WT and COSIR C786S. These findings suggest that IR C786S precursor is not retained in the ER compartment but it is targeted to degradation. Recently, it has been shown that two different mutations target Insulin Proreceptor to a proteasome-dependent degradation by interaction with the cytosolic chaperone Hsp 90 (23, 24). By using lysosomal proteases inhibitors, we could not rescue IR C786S precursor from degradation (data not shown). Then it should be hypothesized that C786S Insulin Proreceptor is delivered to a lysosomal alternative degradation pathway, possibly to a proteasome dependent one. Cysteine organization is largely conserved across IR superfamily. In particular, IGF-IR  subunit extracellular domain contains three cysteine residues: C776, C785, C849. This pattern of distribution is also present in the Insulin-like peptide Receptor in the Amphioxus, the putative common progenitor of IR and IGF-IR (25). Cys 786 in the IR and Cys 776 in the IGF-IR belong to a consensus sequence present in the iuxtamembrane FnIII domains of several tyrosine kinase receptors extracellular region (26). Here we have demonstrated that the corresponding Cys 776 is also critical for IGF-IR biosynthesis. Pulse-chase and 125I IGF-I binding experiments showed that IGF-IR C776S precursor maturation stops at the proreceptor step and no increase of 125I IGF-I binding could be detected on cell surface. Clusters of iuxtamembrane extracellular cysteines have been identified in several transmembrane receptors. In the epidermal growth factor receptor family, iuxtamembrane cysteines regulate receptor dimerization and activation (27). Similar results were obtained in several cytokine receptors (28, 29), atrial natriuretic peptide receptor (30) and fibroblast growth factor receptor (31). Interestingly, Cys to Ser substitution in position 609, 611, 618, 620 of Ret ectodomain, which
839
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
markedly decrease Ret expression on cell surface, can cause MEN 2A or Hirschsprung’s disease (32, 33). Together with these findings, our results strongly support the conserved functional role of the iuxtamembrane cysteine cluster in transmembrane receptors ectodomain. Insulin and IGF-I receptors are unique models to further investigate these processes in naturally occurring disulfide-linked dimers. ACKNOWLEDGMENTS This work was partially supported by AIRC, MURST, and University of Genova. The authors thank Mrs. Maria Rosa Dagnino for the skillful administrative assistance.
REFERENCES 1. Cheatham, B., and Kahn, C. R. (1995) Insulin action and insulin signaling network. Endocr. Rev. 16, 117–142. 2. LeRoith, D., Werner, H., Beitner-Johnson, D., and Roberts, C. T., Jr. (1995) Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr. Rev. 16, 143–163. 3. Olson, T. S., Bamberger, M. J., and Lane, M. D. (1988) Posttranslational changes in tertiary and quaternary structure of the insulin proreceptor: Correlation with acquisition of function. J. Biol. Chem. 263, 7342–7351. 4. Schaefer, L., and Ljungqvist, L. (1992) Identification of a disulfide bridge connecting the alpha-subunits of the extracellular domain of the insulin receptor. Biochem. Biophys. Res. Commun. 189, 650 – 653. 5. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1998) The disulfide bonds in the C-terminal domains of the human insulin receptor ectodomain. J. Biol. Chem. 272, 29460 –29467. 6. Cheatham, B., and Kahn, C. R. (1992) Cysteine 647 in the insulin receptor is required for normal covalent interaction between ␣ and  subunits and signal transduction. J. Biol. Chem. 267, 7108 –7115. 7. Mulhern, T. D., Booker, G. W., and Cosgrove, L. (1998) A third fibronectin type-III domain in the insulin family of receptors. Trends Biochem. Sci. 23, 465– 466. 8. Ward, C. W. (1999) Members of the insulin receptor family contain three fibronectin type III domains. Growth Factors 16, 315–322. 9. Schaefer, E. M., Siddle, K., and Ellis, L. (1990) Deletion analysis of the human insulin receptor ectodomain reveals independently folded soluble subdomains and insulin binding by a monomeric ␣-subunit. J. Biol. Chem. 265, 13248 –13253. 10. Molina, L., Marino-Buslje, C., Quinn, D. R., and Siddle, K. (2000) Structural domains of the insulin receptor and IGF receptor required for dimerisation and ligand binding. FEBS Lett. 467, 226 –230. 11. Maggi, D., Andraghetti, G., Carpentier, J.-L., and Cordera, R. (1998) Cys 860 in the extracellular domain of Insulin Receptor -subunit is critical for internalization and signal transduction in transfected CHO cells. Endocrinology 139, 496 –502. 12. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, pp. 139 –243, Cold Spring Harbor Laboratory Publications, Cold Spring Harbor, NY. 13. Accili, D., Kadowaki, T., Kadowaki, H., Mosthaf, L., Ullrich, A., and Taylor, S. I. (1992) Immunoglobulin heavy chain-binding protein binds to misfolded mutant insulin receptors with mutations in the extracellular domain. J. Biol. Chem. 267, 586 –590.
14. Bass, J., Chiu, G., Argon, Y., and Steiner, D. F. (1998) Folding of insulin receptor monomers is facilitated by the molecular chaperones calnexin and calreticulin and impaired by rapid dimerization. J. Cell Biol. 141, 637– 646. 15. Maggi, D., Barbetti, F., and Cordera, R. (1999) Role of proline 193 in the insulin receptor post-translational processing. Diabetologia 42, 435– 442. 16. Sell, C., Rubini, M., Rubin, R., Liu, J.-P., Efstratiadis, A., and Baserga, R. (1993) Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulinlike growth factor receptor. Proc. Natl. Acad. Sci. 90, 11217– 11221. 17. Massague, J., Pilch, P. F., and Czech, M. P. (1980) Electrophoretic resolution of three major insulin receptor structures with unique subunit stoichiometries. J. Biol. Chem. 77, 7137– 7141. 18. Finn, F. M., Ridge, K. D., and Hofmann, K. (1990) Labile disulfide bonds in placental insulin receptor. Proc. Natl. Acad. Sci. 87, 419 – 423. 19. Whittaker, J., Garcia, P., Yu, G. Q., and Mynarcik, D. C. (1994) Transmembrane domain interactions are necessary for negative cooperativity of the insulin receptor. Mol. Endocrinol. 8, 1521– 1527. 20. Leconte, I., Carpentier, J.-L., and Clauser, E. (1994) The functions of the human insulin receptor are affected in different ways by mutation of each of the four N-glycosylation sites in the  subunit. J. Biol. Chem. 269, 18062–18071. 21. Haruta, T., Sawa, T., Takata, Y., Imamura, T., Takada, Y., Morioka, H., Yang, G. H., and Kobayashi, M. (1995) An extracellular domain of the  subunit is essential for processing, transport and kinase activity of insulin receptor. Biochem. J. 305, 599 – 604. 22. Bass, J., Kurose, T., Pashmforoush, M., and Steiner, D. F. (1996) Fusion of insulin receptor ectodomains to immunoglobulin constant domains reproduces high-affinity insulin binding in vitro. J. Biol. Chem. 19367–19375. 23. Sawa, T., Imamura, T., Haruta, T., Sasaoka, T., Ishiki, M., Takata, Y., Takada, Y., Morioka, H., Ishihara, H., Usui, I., and Kobayashi, M. (1996) Hsp70 family molecular chaperones and mutant insulin receptor: Differential binding specificities of BiP and Hsp70/Hsc70 determines accumulation or degradation of insulin receptor. Biochem. Biophys. Res. Commun. 218, 449 – 453. 24. Imamura, T., Haruta, T., Takata, Y., Usui, I., Iwata, M., Ishihara, H., Ishiki, M., Ishibashi, O., Ueno, E., Sasaoka, T., and Kobayashi, M. (1998) Involvement of heat shock protein 90 in the degradation of mutant insulin receptors by the proteasome. J. Biol. Chem. 273, 11183–1118. 25. Pashmforoush, M., Chan, S. J., and Steiner, D. F. (1996) Structure and expression of the Insulin-like peptide receptor from Amphioxus. Mol. Endocr. 10, 857– 866. 26. O’Bryan, J. P., Frye, R. A., Cogswell, P. C., Neubauer, A., Kitch, B., Prokop, C., Espinosa, R., III, Le Beau, M. M., Earp, H. S., and Liu, E. T. (1991) Ax1, a transforming gene isolated from primary human myeloid leukemia cells, encodes a novel receptor tyrosine kinase. Mol. Cell. Biol. 11, 5016 –5031. 27. Siegel, P. M., and Muller, W. J. (1996) Mutation affecting conserved cysteine residues within the extracellular domain of Neu promote receptor dimerization and activation. Proc. Natl. Acad. Sci. 93, 8878 – 8883. 28. de Vos, A. M., Ultsch, M., and Kossiakoff, A. A. (1994) Human growth hormone and extracellular domain of its receptor: Crystal structure of the complex. Science 255, 306 –312. 29. Watowich, S. S., Hilton, D. J., and Lodish, H. F. (1994) Activa-
840
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
tion and inhibition of erythropoietin receptor function: Role of receptor dimerization. Mol. Cell. Biol. 14, 3535–3549. 30. Labrecque, J., McNicoll, N., Marquis, M., and De Le´an, A. (1999) A disulfide-bridged mutant of natriuretic peptide receptor-A displays costitutive activity. J. Biol. Chem. 274, 9752–9759. 31. d’Avis, P. Y., Robertson, S. C., Meyer, A. N., Bardwell, W. M., Webster, M. K., and Donoghue, D. J. (1998) Constitutive activation of fibroblast growth factor receptor 3 by mutations responsible for the lethal skeletal dysplasia thanatophoric dysplasia type I. Cell Growth Differ. 9, 71–78.
32. Ito, S., Iwashita, T., Asai, N., Murakami, H., Iwata, Y., Sobue, G., and Takahashi, M. (1997) Biological properties of Ret with cysteine mutations correlate with multiple endocrine neoplasia type 2A, familial medullary thyroid carcinoma and Hirschsprung’s disease phenotype. Cancer Res. 57, 2870 –2872. 33. Chappuis-Flament, S., Pasini, A., De Vita, G., Se´gouffin-Cariou, C., Fusco, A., Attie´, T., Lenoir, G. M., Santoro, M., and Billaud, M. (1998) Dual effect on the Ret receptor of MEN 2 mutations affecting specific extracytoplasmic cysteines. Oncogene 17, 2851– 2861.
841
Cys 786 and Cys 776 in the Posttranslational Processing of the Insulin and IGF-I Receptors Davide Maggi and Renzo Cordera 1 Department of Endocrinology and Metabolism, University of Genova, Genova, Italy
Received December 26, 2000
The extracellular regions of insulin and IGF-I receptors (IR and IGF-IR) contain fibronectin type III repeats with cysteine residues potentially involved in SAS bond. In this report we show that Cys 786 in the IR and the corresponding Cys 776 in the IGF-IR regulate proreceptor dimerization with high specificity. Both C786S insulin and C776S IGF-I proreceptors reach the monomeric 210-kDa step, but do not proceed further. Mature IR C786S and IGF-IR C776S expression on plasmamembrane is abolished. No retention of C786S IR precursor was detected in the endoplasmic reticulum, which is degraded by a nonlysosomal mechanism. The rearrangement of the remaining cysteines in the insulin receptor  subunit ectodomain does not rescue dimerization of C786S insulin proreceptor. As observed in other transmembrane receptors, iuxtamembrane cysteines, specifically Cys 786 in the IR and Cys 776 in the IGF-IR, are critical for correct processing of proreceptors. © 2001 Academic Press Key Words: insulin receptor; IGF-I receptor;  subunit ectodomain; dimerization; extracellular cysteine.
IR and IGF-IR are transmembrane glycoproteins composed by two ␣ and two  subunits linked together by disulfide bonds (1, 2). The disulfide bonds formation is an early event in Insulin Proreceptor maturation process. In the ER, Insulin Proreceptor monomers undergo covalent association to produce a dimer that later is converted to the mature IR tetramer by proteolityc cleavage and glycosilation (3). It has been established that two ␣ subunits are associated together by at least two disulfide bonds, while only a single SAS is responsible for ␣- linkage (4 – 6). The C terminal portion of the ␣ subunit contains four Cys. Cys 647 in the ␣ subunit has been indicated as a part of the SAS bond between the ␣ and  subunit (5, 6). Also the IR  subunit extracellular region contains four Cys residues 1
To whom correspondence should be addressed at Di.S.E.M. Viale Benedetto XV, 6, 16132 Genova, Italy. Fax: 39103538977. E-mail: [email protected]. 0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
potentially involved in a ␣- linkage. Cysteine residues in the C terminal IR ectodomain reside in three fibronectin type III (FnIII) domains (7, 8). It has been shown that FnIII repeats in the IR ectodomain are required for the association of two monomers to produce a dimeric Insulin Proreceptor complex (9, 10). We have previously shown that Ser for Cys substitutions at position 795, 860 and 872 do not affect this process and do not prevent the IR tetramer formation (11). Aim of the present work was to investigate the role of Cys 786 in IR biosynthesis. Here we show that the C786S substitution prevents the maturation of IRs: C786S Insulin Proreceptor biosynthesis proceeds to monomer formation only, which is probably degraded, since we did not observe any accumulation of 210 Kd products nor its transition to tetrameric structure. Cysteine distribution is highly conserved among IR superfamily members (1, 2). In particular, IGF-IR  subunit extracellular domain contains three Cys at positions 776, 785, 849 corresponding to IR Cys 786, 795, 860. Such homology suggests a conserved functional role. Here we also show that C776S substitution blocks maturation of IGF-IR C776S at a proreceptor step resulting in the absence of IGF-IRs on the cell surface. These findings support the functional relevance of IR  subunit ectodomain and assign a specific role to a single cysteine residues in the FnIII organization of IR and IGF-IR ectodomains. MATERIALS AND METHODS Materials. COS1 cells were obtained from American Types Culture Collection and R ⫺ cells were kindly provided by Dr. R. Baserga (Thomas Jefferson University, Philadelphia). Anti GRP78 polyclonal and anti IGF-IR  subunit polyclonal antibodies were purchased from Santa Cruz Biotechnology while anti calnexin antibody was obtained from StressGen Biotechnology. Anti IR polyclonal antibody was kindly provided by Dr. G. Sesti (Universita` Tor Vergata, Roma). cDNA coding for human IR WT and IGF-IR WT were kindly provided by Dr. D. Accili (Columbia University, New York). Site-directed mutagenesis and construction of expression vector. Cys 786 to Ser substitution in IR and the corresponding Cys 776 to Ser mutation in IGF-IR were obtained using QuickChange sitedirected mutagenesis kit (Stratagene). For C786S substitution the
836
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS The gels were dried and exposed for autoradiography. Radioactivity of the bands of interest, excised under autoradiographic guide, was assessed in a -scintillation counter.
RESULTS
FIG. 1. IRs immunoblot. Confluent monolayers of COS1 (A), COS-IR WT (B), and COS-IR C786S (C) cells were solubilized and total cellular protein was separated on 8% SDS–PAGE in the presence of 100 mM DTT, electrophoretically transferred to nitrocellulose, and probed with an anti-IR  subunit antibody. Immunoblot presented is representative of three different experiments. Bands of interest were quantitated by scanning densitometry.
oligonucleotide was 5⬘ CATCGAGCTGCAGGCTTCCAACCAGGACACCCCTGAGGAA; for C776S mutation the oligonucleotide was 5⬘ CGCATCGATATCCACAGCTCCAACCACGAGGCTGAGAAG. cDNAs coding for IR C795S, IR C860S, IR C872S, in pCMV vector, have been obtained as previously described (11). Cell culture and transfection. COS1 and R ⫺ cells were cultured at 5% CO 2 in DMEM supplemented with 2 mM glutamine, 10% FCS, 100 units/ml penicillin G, 100 g/ml streptomycin sulphate. Subconfluent cells were transfected with wild type or mutant expression vector by calcium phosphate precipitation. Experiments were performed after 48 h. Insulin and IGF-I binding. Confluent cells, grown in 6 well plates, were washed twice with PBS and incubated for 2 h at 16°C in Hepes buffer (11) in the presence of 125I-Insulin or IGF-I tracer amounts (AmerhamPharmacia Biotech). The non specific binding, determined in the presence of 1 g Insulin or IGF-I, was subtracted.
COS-IR WT cells express 2.8 ⫾ 0.5 ⫻ 10 5 insulin binding sites on their surface while mock transfected COS1 and COS-IR C786S express only 3 ⫾ 0.6 ⫻ 10 3 insulin receptors, in spite the fact that the amounts of IR mRNA amount is superimposable in COS-IR WT and COS-IR C786S. When total cellular proteins, under reducing conditions, were immunoblotted with an anti IR  subunit antibody, in both COS-IR WT and COS-IR C786S, equal amounts of a discrete band at 210 kDa (corresponding to Insulin Proreceptor) were detected but only in COSIR WT, and not in COS-IR C786S, a band at 95 kDa (corresponding to  subunit) was present (Fig. 1). To investigate how C786S substitution could affect IR biosynthesis, 35S labelled transfected COS1 cells were pulse-chased. As shown in Fig. 2, in contrast with COS-IR C786S, in COS-IR WT cells, the Insulin Proreceptor proceeds to mature ␣ and  subunits. The small amount of ␣ and  subunits present in COS-IR C786S cells represents native COS1 IRs. The calculated half life of the 210 kDa protein, in both COS-IR WT and COSIR C786S, is about 3.5 h. C786S substitution does not affect N-glycosylation of mutated proreceptor, since the non glycosilated form of IR proreceptor is evident also in the C786S proreceptor. At early times of chase, only monomeric form of Insulin Proreceptor was recognized, both in COS-IR WT and COS-IR C786S. The rate of disappearance (about 30 min) is similar in wild type and
IR and IGF-IR immunoblot. Confluent cells were lysed as previously described (11). Cell lysates were resolved on 8% SDS-PAGE under reducing conditions. Protein were transferred to nitrocellulose (12). Nitrocellulose filters were blocked in PBS Tween 0.1 (PBS-T) 3% dry milk for 1 h at room temperature. Filters were incubated with anti IR or anti IGF-IR antibody for 1 h at room temperature, washed extensively in PBS-T and anti rabbit Ig horseradish-peroxidase linked was added for 1 h at room temperature. Following a final washing in PBS-T, bound antibodies were detected using ECL reagents (AmerhamPharmacia Biotech). Bands of interest were quantitated by densitometry using the NIH Image software. Metabolic labelling. Confluent cells were incubated in methionine and cysteine free DMEM for 30 min at 37°C in CO 2 incubator. The labelling reaction followed by addition of 200 Ci/well of Trans 35 S-label (ICN Flow) for 30 min. Then cells were incubated in DMEM 10% FCS containing 2 mM methionine and 0.5 mM cysteine for the indicated times. Finally, monolayers were lysed. For GRP78 immunoprecipitation experiments, lysis buffer was supplemented with 5 U/ml hexokinase plus 10 mM glucose to deplete intracellular ATP (13). Immunoprecipitation was carried out as described (11). Immunoprecipitated proteins were resolved on 8% SDS-PAGE. For experiments conducted under non reducing conditions, DTT was omitted in loading buffer and supernatants were resolved on 5% SDS-PAGE.
FIG. 2. Biosynthesis of IR WT and IR C786S in COS1 cells. COS-IR WT and COS-IR C786S cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for indicated times. Total cell proteins were immunoprecipitated with an anti-IR  subunit antibody, resolved on 8% SDS–PAGE. Gels were dried and exposed at ⫺80°C for 48 h.
837
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Monomer biosynthesis and tetramer formation. (Top) [ 35S]methionine-labelled COS-IR WT and COS-IR C786S were pulsed for 30 min and chased for the indicated times. Cell lysates were immunoprecipitated with an anti-IR antibody, resolved on 5% SDS–PAGE under nonreducing conditions. Gels were dried and exposed at ⫺80°C for 72 h. (Bottom) Mock transfected COS1 (A), COS-IR WT (B), and COS-IR C786S (C) cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for 4 h. Cell lysates were immunoprecipitated with an anti-IR antibody, resolved on 5% SDS–PAGE under nonreducing conditions. Gels were dried and exposed at ⫺80°C for 72 h.
mutated monomers (Fig. 3, top). However, tetramer formation was impaired by C786S substitution (Fig. 3, bottom). Different endoplasmic reticulum chaperones, such as GRP78 and calnexin, drive the correct folding of Insulin Proreceptor. It has been shown that naturally occurring mutations in the IR ectodomain impair insulin proreceptor-chaperones interaction so reducing IR biosynthetic rate (13–15). Total cellular lysates from 35S labelled COS-IR WT and COS-IR C786S have been immunoprecipitated with anti GRP78 or anti calnexin antibody. WT and C786S Insulin Proreceptors coimmunoprecipitate in equal amount with anti GRP78 or anti calnexin antibody (Fig. 4). Pulse-chase experiments, in COS-IR C795S, COSIR C860S, and COS-IR C872S, showed that IR biosynthesis was similar in all these cell lines to that observed in COS-IR WT (Fig. 5). Only in COS-IR C795S, a prolonged insulin proreceptor half-life was detected (about 6 h compared with 3.5 of WT Insulin Proreceptor). IR and IGF-IR show a high degree of homology and a similar spatial distribution of Cys suggesting conserved functional features of corresponding Cys. To test this hypothesis, we produced IGF-IR C776S by site directed mutagenesis. IGF-IR WT and IGF-IR C776S were transfected in R ⫺, mouse fibroblasts with a targeted disruption of IGF-IR gene (16), and COS1 cells. Consistently with the results obtained in COS-IR C786S cells, the transfection of cDNA coding for IGF-IR C776S did not produce any increase in 125I IGF-I binding activity compared to mock transfected R ⫺ (R-IGF-IR WT cells express 2.1 ⫾ 0.4 ⫻ 10 5 IGF-I receptors on their plasmamembrane while 125I-IGF-I binding is undetectable in mock transfected and R-IGF-IR C776S cells). This result was due to the same cellular mechanism observed for
FIG. 4. Immunoprecipitation of insulin proreceptors by antiGRP78 and anti-calnexin antibodies. Confluent monolayers of mocktransfected COS1 (A), COS-IR WT (B), and COS-IR C786S (C) were [ 35S]methionine labelled for 30 min and chased for 2 h. Cell lysates were immunoprecipitated with an anti-GRP78 (left) or anti-calnexin antibody (right). Immunoprecipitated proteins were resolved on 8% SDS–PAGE, dried, and exposed at ⫺80°C for 48 h. Bands of interest were cut under autoradiographic guide and counted in a -scintillation counter. The bands at 78, 90, and 210 M r correspond to GRP78, calnexin, and insulin proreceptor, respectively.
IR C786S. In fact, as shown in Fig. 6 (left), both in R-IGFIR WT and R-IGF-IR C776S cells, IGF-IR precursor was detected. However dimer formation is greatly reduced in R-IGF-IR C776S compared to R-IGF-IR WT (Fig. 6, right) resulting in the absence of mature ␣ and  subunits. Similar results were obtained in transiently transfected COS1 cell (data not shown). DISCUSSION
 subunit extracellular domain regulates several IR functions. First, it serves as an anchorage to the extracellular ␣ subunit (17). Different technical approaches established the disulfide bond organization of isolated
FIG. 5. Biosynthesis of IR C795S, IR C860S, and IR C872S. Experiments were carried out exactly as in the legend to Fig. 3.
838
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 6. Biosynthesis of IGF-I receptors in R-IGF-IR WT and R-IGF-IR C776S cells. Mock-transfected R ⫺ (A), R-IGF-IR WT (B), and R-IGF-IR C776S (C) cells were pulsed for 30 min in the presence of 200 Ci [ 35S]methionine and chased for 4 h. Total cell proteins were immunoprecipitated with an anti-IGF-IR  subunit antibody, resolved on 8% SDS–PAGE under reducing conditions (left), or on 5% SDS–PAGE under nonreducing conditions (right). Gels were dried and exposed at ⫺80°C for 72 h.
IR ectodomain indicating the presence of a disulfide bond between Cys 647 and Cys 860 (5, 6). However contrasting results were obtained by direct alkylation or site directed mutagenesis of native IR (18, 11). It is possible that IR ectodomain folding differs from that of native IR as suggested also by the observation of different maturation efficiency of truncated proreceptor (9) and their different insulin binding affinity (19). Moreover, IR with a Cys to Ser substitution at position 860 is correctly processed to plasmamembrane suggesting that another Cys could play the role of the absent Cys 860 (11). Second,  subunit ectodomain regulates IR internalization and signal transduction. Modification of N-glycosylation site of  subunit extracellular portion reduces transmembrane signalling (20) as well as the C860S mutation does (11). Finally,  subunit extracellular region is important for the IR post-translational processing. Deletion of exon 13 greatly reduces IR precursor maturation (21) as well as the loss of Cys 786 results in the rapid intracellular degradation of truncated IR (9). Also fusion of IR ectodomain to the immunoglobulin constant domains suggested a role of  subunit extracellular region in stabilizing ectodomain dimers (22). Recently, it has been demonstrated that IR dimerization is dependent to the Fn type III domains of extracellular  subunit (10). To determine the functional role of cysteine residues in the FnIII1 and FnIII2 repeats of native IR  subunit, we have mutated each cysteine to serine and we have expressed the corresponding cDNA in COS1 cells. Here we have shown that Cys 786 has an unique role and is critical for IR biosynthesis. Infact, C786S substitution prevents Insulin Proreceptor dimerization, a step necessary to proceed to IR tetramer forma-
tion. This finding confirms, in the insulin holoreceptor, the results obtained with truncated IRs (9, 10). It is interesting to note that IR precursor carrying a deletion of exon 13 (which does not change Cys number in the  subunit extracellular region) dimerize correctly (21). These observations suggest that Cys 786 is critical for dimerization process. The role of Cys 786 in IR biosynthesis is highly specific. Infact IR C795S, IR C860S and IR C872S precursors are correctly processed and expressed on plasmamembrane. It has been previously shown that mutated Insulin Proreceptor are retained in the ER by a chaperone mediated mechanism (13, 15, 23). C786S mutation does not impair Insulin Proreceptor interaction with GRP78 and calnexin, which catalyze the initial steps in IR biosynthetic pathway. These findings agree with the proposed model of IR biosynthesis. Infact, Insulin Proreceptors dimerize only after interaction with GRP 78 and calnexin (16). On the other hand, the kinetic of Insulin Proreceptor disappearance is superimposable in COS-IR WT and COSIR C786S. These findings suggest that IR C786S precursor is not retained in the ER compartment but it is targeted to degradation. Recently, it has been shown that two different mutations target Insulin Proreceptor to a proteasome-dependent degradation by interaction with the cytosolic chaperone Hsp 90 (23, 24). By using lysosomal proteases inhibitors, we could not rescue IR C786S precursor from degradation (data not shown). Then it should be hypothesized that C786S Insulin Proreceptor is delivered to a lysosomal alternative degradation pathway, possibly to a proteasome dependent one. Cysteine organization is largely conserved across IR superfamily. In particular, IGF-IR  subunit extracellular domain contains three cysteine residues: C776, C785, C849. This pattern of distribution is also present in the Insulin-like peptide Receptor in the Amphioxus, the putative common progenitor of IR and IGF-IR (25). Cys 786 in the IR and Cys 776 in the IGF-IR belong to a consensus sequence present in the iuxtamembrane FnIII domains of several tyrosine kinase receptors extracellular region (26). Here we have demonstrated that the corresponding Cys 776 is also critical for IGF-IR biosynthesis. Pulse-chase and 125I IGF-I binding experiments showed that IGF-IR C776S precursor maturation stops at the proreceptor step and no increase of 125I IGF-I binding could be detected on cell surface. Clusters of iuxtamembrane extracellular cysteines have been identified in several transmembrane receptors. In the epidermal growth factor receptor family, iuxtamembrane cysteines regulate receptor dimerization and activation (27). Similar results were obtained in several cytokine receptors (28, 29), atrial natriuretic peptide receptor (30) and fibroblast growth factor receptor (31). Interestingly, Cys to Ser substitution in position 609, 611, 618, 620 of Ret ectodomain, which
839
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
markedly decrease Ret expression on cell surface, can cause MEN 2A or Hirschsprung’s disease (32, 33). Together with these findings, our results strongly support the conserved functional role of the iuxtamembrane cysteine cluster in transmembrane receptors ectodomain. Insulin and IGF-I receptors are unique models to further investigate these processes in naturally occurring disulfide-linked dimers. ACKNOWLEDGMENTS This work was partially supported by AIRC, MURST, and University of Genova. The authors thank Mrs. Maria Rosa Dagnino for the skillful administrative assistance.
REFERENCES 1. Cheatham, B., and Kahn, C. R. (1995) Insulin action and insulin signaling network. Endocr. Rev. 16, 117–142. 2. LeRoith, D., Werner, H., Beitner-Johnson, D., and Roberts, C. T., Jr. (1995) Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr. Rev. 16, 143–163. 3. Olson, T. S., Bamberger, M. J., and Lane, M. D. (1988) Posttranslational changes in tertiary and quaternary structure of the insulin proreceptor: Correlation with acquisition of function. J. Biol. Chem. 263, 7342–7351. 4. Schaefer, L., and Ljungqvist, L. (1992) Identification of a disulfide bridge connecting the alpha-subunits of the extracellular domain of the insulin receptor. Biochem. Biophys. Res. Commun. 189, 650 – 653. 5. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1998) The disulfide bonds in the C-terminal domains of the human insulin receptor ectodomain. J. Biol. Chem. 272, 29460 –29467. 6. Cheatham, B., and Kahn, C. R. (1992) Cysteine 647 in the insulin receptor is required for normal covalent interaction between ␣ and  subunits and signal transduction. J. Biol. Chem. 267, 7108 –7115. 7. Mulhern, T. D., Booker, G. W., and Cosgrove, L. (1998) A third fibronectin type-III domain in the insulin family of receptors. Trends Biochem. Sci. 23, 465– 466. 8. Ward, C. W. (1999) Members of the insulin receptor family contain three fibronectin type III domains. Growth Factors 16, 315–322. 9. Schaefer, E. M., Siddle, K., and Ellis, L. (1990) Deletion analysis of the human insulin receptor ectodomain reveals independently folded soluble subdomains and insulin binding by a monomeric ␣-subunit. J. Biol. Chem. 265, 13248 –13253. 10. Molina, L., Marino-Buslje, C., Quinn, D. R., and Siddle, K. (2000) Structural domains of the insulin receptor and IGF receptor required for dimerisation and ligand binding. FEBS Lett. 467, 226 –230. 11. Maggi, D., Andraghetti, G., Carpentier, J.-L., and Cordera, R. (1998) Cys 860 in the extracellular domain of Insulin Receptor -subunit is critical for internalization and signal transduction in transfected CHO cells. Endocrinology 139, 496 –502. 12. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, pp. 139 –243, Cold Spring Harbor Laboratory Publications, Cold Spring Harbor, NY. 13. Accili, D., Kadowaki, T., Kadowaki, H., Mosthaf, L., Ullrich, A., and Taylor, S. I. (1992) Immunoglobulin heavy chain-binding protein binds to misfolded mutant insulin receptors with mutations in the extracellular domain. J. Biol. Chem. 267, 586 –590.
14. Bass, J., Chiu, G., Argon, Y., and Steiner, D. F. (1998) Folding of insulin receptor monomers is facilitated by the molecular chaperones calnexin and calreticulin and impaired by rapid dimerization. J. Cell Biol. 141, 637– 646. 15. Maggi, D., Barbetti, F., and Cordera, R. (1999) Role of proline 193 in the insulin receptor post-translational processing. Diabetologia 42, 435– 442. 16. Sell, C., Rubini, M., Rubin, R., Liu, J.-P., Efstratiadis, A., and Baserga, R. (1993) Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulinlike growth factor receptor. Proc. Natl. Acad. Sci. 90, 11217– 11221. 17. Massague, J., Pilch, P. F., and Czech, M. P. (1980) Electrophoretic resolution of three major insulin receptor structures with unique subunit stoichiometries. J. Biol. Chem. 77, 7137– 7141. 18. Finn, F. M., Ridge, K. D., and Hofmann, K. (1990) Labile disulfide bonds in placental insulin receptor. Proc. Natl. Acad. Sci. 87, 419 – 423. 19. Whittaker, J., Garcia, P., Yu, G. Q., and Mynarcik, D. C. (1994) Transmembrane domain interactions are necessary for negative cooperativity of the insulin receptor. Mol. Endocrinol. 8, 1521– 1527. 20. Leconte, I., Carpentier, J.-L., and Clauser, E. (1994) The functions of the human insulin receptor are affected in different ways by mutation of each of the four N-glycosylation sites in the  subunit. J. Biol. Chem. 269, 18062–18071. 21. Haruta, T., Sawa, T., Takata, Y., Imamura, T., Takada, Y., Morioka, H., Yang, G. H., and Kobayashi, M. (1995) An extracellular domain of the  subunit is essential for processing, transport and kinase activity of insulin receptor. Biochem. J. 305, 599 – 604. 22. Bass, J., Kurose, T., Pashmforoush, M., and Steiner, D. F. (1996) Fusion of insulin receptor ectodomains to immunoglobulin constant domains reproduces high-affinity insulin binding in vitro. J. Biol. Chem. 19367–19375. 23. Sawa, T., Imamura, T., Haruta, T., Sasaoka, T., Ishiki, M., Takata, Y., Takada, Y., Morioka, H., Ishihara, H., Usui, I., and Kobayashi, M. (1996) Hsp70 family molecular chaperones and mutant insulin receptor: Differential binding specificities of BiP and Hsp70/Hsc70 determines accumulation or degradation of insulin receptor. Biochem. Biophys. Res. Commun. 218, 449 – 453. 24. Imamura, T., Haruta, T., Takata, Y., Usui, I., Iwata, M., Ishihara, H., Ishiki, M., Ishibashi, O., Ueno, E., Sasaoka, T., and Kobayashi, M. (1998) Involvement of heat shock protein 90 in the degradation of mutant insulin receptors by the proteasome. J. Biol. Chem. 273, 11183–1118. 25. Pashmforoush, M., Chan, S. J., and Steiner, D. F. (1996) Structure and expression of the Insulin-like peptide receptor from Amphioxus. Mol. Endocr. 10, 857– 866. 26. O’Bryan, J. P., Frye, R. A., Cogswell, P. C., Neubauer, A., Kitch, B., Prokop, C., Espinosa, R., III, Le Beau, M. M., Earp, H. S., and Liu, E. T. (1991) Ax1, a transforming gene isolated from primary human myeloid leukemia cells, encodes a novel receptor tyrosine kinase. Mol. Cell. Biol. 11, 5016 –5031. 27. Siegel, P. M., and Muller, W. J. (1996) Mutation affecting conserved cysteine residues within the extracellular domain of Neu promote receptor dimerization and activation. Proc. Natl. Acad. Sci. 93, 8878 – 8883. 28. de Vos, A. M., Ultsch, M., and Kossiakoff, A. A. (1994) Human growth hormone and extracellular domain of its receptor: Crystal structure of the complex. Science 255, 306 –312. 29. Watowich, S. S., Hilton, D. J., and Lodish, H. F. (1994) Activa-
840
Vol. 280, No. 3, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
tion and inhibition of erythropoietin receptor function: Role of receptor dimerization. Mol. Cell. Biol. 14, 3535–3549. 30. Labrecque, J., McNicoll, N., Marquis, M., and De Le´an, A. (1999) A disulfide-bridged mutant of natriuretic peptide receptor-A displays costitutive activity. J. Biol. Chem. 274, 9752–9759. 31. d’Avis, P. Y., Robertson, S. C., Meyer, A. N., Bardwell, W. M., Webster, M. K., and Donoghue, D. J. (1998) Constitutive activation of fibroblast growth factor receptor 3 by mutations responsible for the lethal skeletal dysplasia thanatophoric dysplasia type I. Cell Growth Differ. 9, 71–78.
32. Ito, S., Iwashita, T., Asai, N., Murakami, H., Iwata, Y., Sobue, G., and Takahashi, M. (1997) Biological properties of Ret with cysteine mutations correlate with multiple endocrine neoplasia type 2A, familial medullary thyroid carcinoma and Hirschsprung’s disease phenotype. Cancer Res. 57, 2870 –2872. 33. Chappuis-Flament, S., Pasini, A., De Vita, G., Se´gouffin-Cariou, C., Fusco, A., Attie´, T., Lenoir, G. M., Santoro, M., and Billaud, M. (1998) Dual effect on the Ret receptor of MEN 2 mutations affecting specific extracytoplasmic cysteines. Oncogene 17, 2851– 2861.
841