- Email: [email protected]
Cytochrome P450 1B1 gene mutations in Japanese patients with primary congenital glaucoma1
Cytochrome P450 1B1 Gene Mutations in Japanese Patients With Primary Congenital Glaucoma TOMOKO KAKIUCHI-MATSUMOTO, MD, YASUSHI ISASHIKI, MD, PHD, NORIO OHBA, MD, PHD, KATSUAKI KIMURA, MD, SHOZO SONODA, MD, AND KAZUHIKO UNOKI, MD, PHD
● PURPOSE:
To report a novel missense mutation and DNA polymorphism of the CYP1B1gene in Japanese patients with primary congenital glaucoma. ● METHODS: A series of 11 unrelated patients with primary congenital glaucoma was examined. Patients were followed in the Kagoshima University Hospital between 1979 and 1998. DNA was extracted from leukocytes of the patients, their families, and unrelated healthy individuals. Amplicons spanning the coding regions of the CYP1B1 gene were examined by direct sequencing and enzyme-restriction detection. ● RESULTS: In the 11 unrelated patients, besides the previously reported insertional mutation (1620 ins G), a novel missense mutation was identified at codons 444 to replace arginine with glutamine (R444Q) in one patient. The novel missense mutation cosegregated in the relevant family as an autosomal recessive pattern and was not found in other patients or control individuals. In addition, five polymorphic sites were found at codons 48, 119, 330, 432, and 449. These polymorphic alleles did not cosegregate with the disease, and they were found in healthy individuals as well. ● CONCLUSIONS: Approximately 20% of Japanese patients with primary congenital glaucoma may be affected by mutations in the CYP1B1 gene. Further studies are justified to explore whether a relationship exists between the phenotypic expressivity of the disease and the type of Accepted for publication Sep 14, 2000. From the Department of Ophthalmology (Drs Kakiuchi-Matsumoto, Ohba, Kimura, Sonoda, and Unoki) and Center for Chronic Viral Diseases (Dr Isashiki), Kagoshima University Faculty of Medicine, Kagoshima, Japan. This work was supported by Grants-in-Aid for Scientific Research (12877279, 12671715) from the Japanese Ministry of Education, Science and Culture, Tokyo, Japan. No proprietary interest. Reprint requests to Yasushi Isashiki, MD, Division of Molecular Pathology and Genetic Epidemiology, Center for Chronic Viral Diseases, Kagoshima University Faculty of Medicine, Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan. Fax: ⫹ 81 099 275 5942; e-mail: isayasu@ m.kufm.kagoshima-u.ac.jp 0002-9394/01/$20.00 PII S0002-9394(00)00808-4
©
2001 BY
mutation. (Am J Ophthalmol 2001;131:345–350. © 2001 by Elsevier Science Inc. All rights reserved.)
P
RIMARY CONGENITAL OR INFANTILE GLAUCOMA IS A
rare genetic disorder that usually manifests itself at birth or within the first year of life. It is characterized by tearing, photophobia, and enlargement of the eyeball (buphthalmos) resulting from elevated intraocular pressure. Unless managed properly, the disease may eventually result in permanent visual loss because of optic atrophy.1 The disorder is autosomal recessively inherited, and it has been assumed to comprise a group of genetically heterogenous diseases. Linkage studies have mapped two loci to chromosome 2p21 and 1p36.2,3 The 2p21 locus has emerged as a major location for patients with primary congenital glaucoma in Turkey and Saudi Arabia. Candidate gene studies of the 2p21 locus have identified diseasecausative mutations in the cytochrome P4501B1 (CYP1B1) gene, a member of P-450 superfamily, and its sequence analyses have revealed a variety of nucleotide alterations and micro- or gross-lesions within the translated regions of the gene. These mutations have been demonstrated as a predominant cause of primary congenital glaucoma in the Turkish and Saudi Arabian population.4 – 6 Recently, we reported an insertional frameshift mutation in our Japanese patient with primary congenital glaucoma.7 We further investigated a series of Japanese patients with primary congenital glaucoma and found a novel missense mutation that is believed to be disease causative. In addition, we confirmed that the CYP1B1 gene is highly polymorphic in its coding regions.
PATIENTS AND METHODS ● PATIENTS:
Eleven patients were diagnosed with primary congenital glaucoma and followed up between 1979 and 1998 in the Kagoshima University Medical Center, a
ELSEVIER SCIENCE INC. ALL
RIGHTS RESERVED.
345
346
AMERICAN JOURNAL
OF
Sex
F M M M M M M M M F M 1 2 3 4 5 6 7 8 9 10 11
Taq I recognizes the wild-type sequence at codon 444 in exon 3, and digests into three fragments. An amino acid-substituting mutation at codon 444 (R444Q) abolishes the Taq I–restriction sequence. Enzyme-treated amplicon was separated by 3.0% agarose gel electrophoresis.
Case
● PCR-RESTRICTION DETECTION FOR R444Q:
OPHTHALMOLOGY
A ⫽ alanine; CF ⫽ counting finger; D1 ⫽ aspartic acid (GAC); D2 ⫽ aspartic acid (GAT); G ⫽ glycine; GON ⫽ goniotomy; L ⫽ leucine; N ⫽ asparagine; Q ⫽ glutamine; R ⫽ arginine; S ⫽ serine; TRT ⫽ trabeculotomy; V ⫽ valine. *Codon numbers follow those of Tang and associates.9
N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N D2/D2 D1/D2 D1/D2 D2/D2 D1/D1 D1/D1 D1/D1 D1/D2 D2/D2 D1/D1 D1/D1 L/L V/L L/L L/L L/L L/L L/L L/L L/L L/L L/L A/A A/A A/V A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/S A/A A/S S/S A/S A/A A/S A/S A/A R444Q 1620 ins G ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ 6 years 3 months at birth at birth 3 years 6 months 3 months at birth at birth at birth 7 years
Bilateral Bilateral Bilateral Bilateral Unilateral Bilateral Bilateral Bilateral Bilateral Bilateral Bilateral
GON, TRT GON GON, TRT GON GON GON, TRT TRT TRT TRT TRT TRT
RE: RE: RE: RE: RE: RE: RE: RE: RE: RE: RE:
0.7; LE: 1.5 (20 years) 0.8; LE: 0.1 (21 years) 0.08; LE: 0.1 (9 years) null; LE: 0.03 (21 years) CF§; LE: 1.2 (11 years) 0.04; LE: 1.5 (11 years) 0.5; LE: 0.1 (2 years) 1.0; LE: 1.5 (20 years) 0.2; LE: 0.2 (3 years) 0.02; LE: CF (25 years) 1.0; LE: 0.8 (10 years)
⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫺ ⫺
R/R R/R R/G R/G R/R R/R R/G R/R R/R R/G R/G
449 gac/gat 432 ctg/gtg 330 gcc/gtc
Variants (Codon Number and Nucleotide Change)*
119 gcc/tcc 48 cgg/ggg Age at Onset
Affected Eyes
● DIRECT SEQUENCING: Nucleotide sequence of amplified DNA fragment was directly determined by autocycle sequencing, using an automated nucleotide sequencer (ALF Express, Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK) and 5⬘-dyeamidite 667 (CY5) labeled primers. Sense and antisense strands were evaluated in each case; numbering of CYP1B1 gene nucleotides and codons followed that of Tang and associates.9
Surgery
● PCR-AMPLIFICATION: DNA was prepared from peripheral white blood cells after cell lysis. The CYP1B1 gene has two long coding exons (exon 2, 1043 base pair [bp]; exon 3, 589 bp), which translate 543 amino acids.8,9 Three fragments dividing exon 2 and one fragment encompassing exon 3 were amplified using a set of primer pairs (Cbe237F/Cbe2-41R, Cbe2-40F/Cbe2-44R, Cbe2-44F/Cbe249R, and Cbe3-F/Cbe3-R), as shown in Table 2. After initial denaturation at 95°C for 5 minutes, polymerase chain reaction amplification was performed with 30 cycles (95°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes), except for Cbe2-37F/Cbe2-41R in which annealing temperature was set at 58°C. Final extension was at 72°C for 10 minutes.
Causative Mutation
Informed consent was obtained from all participants in this study. Peripheral blood was obtained from the 11 patients and their family members, 30 patients with juvenile- or adult-onset primary open-angle glaucoma, and 100 unrelated healthy adults.
Family History
● DNA SAMPLES:
Visual Acuity Outcome (Age at Final Examination)
TABLE 1. Clinical and CYP1B1 Genotype Information in Patients With Primary Congenital Glaucoma
453 aac/agc
tertiary referral institution in the Kagoshima prefecture of southwestern Japan with an average annual new birth rate of approximately 17,000 during the study period. The clinical information of the patients is summarized in Table 1. Each patient belonged to unrelated families who had resided in the Kagoshima prefecture; 10 patients were sporadic and one patient had an affected maternal grandmother. Eight patients presented with symptoms and signs at birth or within 6 months after birth, and the remaining three patients were first noted to have the disease at ages older than 3 years. Results of examination at the initial presentation were compatible with features of primary congenital glaucoma characterized by elevated intraocular pressure and subtle developmental defect in the anterior chamber angle; none of the patients had other inherited ocular disorders. These patients underwent goniotomy and/or trabeculotomy with a variable long-term visual outcome.
MARCH 2001
TABLE 2. Primers Used in the Amplification of Coding Exons of the CYP1B1 Gene
Exon
Primer
Sequence
Position*
2
Cbe2-37F Cbe2-41R Cbe2-40F Cbe2-44R Cbe2-44F Cbe2-49R Cbe3-F Cbe3-R
GTGTCACGCCTTCTCCTTTCT GAGCCCTGCTGCACCAGGGC ACGTTTTCCAGATCCGCCTG CGTTGTGGCTGAGCAGCTCA ACAGCCACGACGACCCCGAG TGTCTCTACTCCGCCTTTTTCA GCTCACTTGCTTTTCTCTCT AAATTTCAGCTTGCCTCTTG
3776-3797 4140-4121 4053-4072 4490-4471 4446-4465 4910-4889 7841-7860 8493-8474
2 2 3
Fragment size (base pair)
365 438 465 653
*Nucleotide number follows genomic DNA sequence of the CYP1B1 gene (Tang and associates9).
FIGURE 1. Direct sequencing results of exon 3 of the CYP1B1 gene. Wild-type: ⴝ a control subject; mutant: ⴝ a patient (Case 1) with primary congenital glaucoma. The patient shows a homozygous mutation at codon 444 (CGA to CAA, arrows) that substitutes arginine (Arg) to glutamine (Gln).
● POLYMORPHIC ALLELES:
Among known polymorphic alleles at codon 48, 119, 432, 449, and 453,5 enzymerestriction method was applicable for Arg48Gly, Ala119Ser, and Leu432Val. Ava I digests allele Gly (GGG) at codon 48 in exon 2. Nae I digests allele Ala (GCC) at codon 119 in exon 2. Bsr I digests allele Leu (CTG) at codon 432 in exon 3. Newly identified polymorphic alleles (Ala330Val) could be confirmed with Sfo I that recognizes allele Ala at codon 330. Enzyme-treated amplicon was separated by 3.0% agarose gel electrophoresis to determine polymorphic genotypes. Other polymorphisms at codons 449 and 453 were evaluated by direct sequencing.
RESULTS ● DISEASE-CAUSATIVE MUTATIONS:
One patient (Case 1) showed a novel mutation in the CYP1B1 gene that is responsible for primary congenital glaucoma. This mutation consisted of an alteration of nucleotide 1677 from guanine to adenine that resulted in amino acid substitution from arginine to glutamine at codon 444 (R444Q) in exon 3 (Figure 1). Taq I–restriction detection revealed that the patient had homozygous mutant alleles and that the family members were either heterozygous with mutant and wildtype allele or homozygous with wild-type alleles (Figure 2). All of the remaining ten patients with primary congenVOL. 131, NO. 3
CYP1B1 MUTATION
IN
FIGURE 2. Taq I–restriction detection for R444Q mutation of the CYP1B1 gene in a family with primary congenital glaucoma. Taq I recognizes the wild-type sequence at codons 355 and 444 of the exon 3 of the CYP1B1 gene and digests into three fragments with 327 base pair (bp), 267 bp, and 59 bp (wild-type). R444Q mutation abolishes a Taq I–restriction site at codon 444 (mutant, 594 bp). C ⴝ a control individual; M: ⴝ molecular markers (100 bp ladder); U: ⴝ untreated amplicon (653 bp); C: a control individual. The patient (closed circle) has homozygous mutant alleles (Gln/Gln) at codon 444. Parents and two brothers (open symbols) of the patient show heterozygous alleles (Arg/Gln).
ital glaucoma, 30 unrelated patients with juvenile-onset or adult-onset primary open-angle glaucoma, or 100 unrelated healthy individuals showed only the wild-type sequence at codon 444.
PRIMARY CONGENITAL GLAUCOMA
347
28 mm Hg in the right eye and 21 mm Hg in the left eye. There were no remarkable anomalies in the external or anterior segments of the eyes. Corneas were clear, and their horizontal diameter measured 12.0 mm in the right eye and 11.0 mm in the left eye. Anterior chambers were normal in depth and clear with normal round pupils. Gonioscopies revealed that anterior chamber angles were open with the iris inserted anteriorly and subtle altered transparency of the trabecular meshwork, more marked in the right eye. Lenses and vitreous cavities were normal. Ophthalmoscopic examination showed that the right optic disk was mildly pale and had an enlarged cupping with the cup-to-disk ratio of 0.7 and the left optic disk appeared normal. The patient was diagnosed as having late-onset primary congenital glaucoma, and she underwent repeated goniotomy and a trabeculotomy in the right eye, which finally led to the control of the right intraocular pressure at or below 21 mm Hg. Subsequently, she was followed at regular intervals to evaluate the intraocular pressure and visual function. Examination results at the age of 22 years were as follows. Best visual acuity was 0.5 in RE by correction with ⫺2.5 diopters sphere and 1.2 in LE by correction with ⫺4.0 diopters sphere. Visual field tests revealed mild loss of the central field in the right eye and superonasal step defect in the left eye. Corneas, lenses, and vitreous cavities were clear. Anterior chamber angles remained unchanged except partial peripheral anterior synechiae formation in the right eye resulting from previous surgeries. Ophthalmoscopic examination disclosed mild pallor of the right optic disk with cup-to-disk ratio of approximately 0.9 and normal-appearing left optic disk.
FIGURE 3. DNA polymorphism at codon 330 of the CYP1B1 gene in a family with primary congenital glaucoma. U: ⴝ untreated amplicon. A genomic fragment of exon 3 of the CYP1B1 gene was amplified including a Ala/Val polymorphism at codon 330 (Ala330Val). Sfo I recognizes allele Ala (gcc) and digested into smaller fragments. In this family, the nonaffected father of the affected patient (Case 3, Table 1) has the homozygous genotype (Val/Val). The patient and his nonaffected mother and sister have the heterozygous genotype (Ala/ Val). Thus, Ala330Val does not cosegregate with the disease.
● GENETIC POLYMORPHISM:
Enzyme restriction and direct sequencing of the CYP1B1 gene revealed five polymorphic sites in exon 2 and exon 3 at codons 48, 119, 330, 432, and 449, demonstrating in each site variable genotypes resulting from a nucleotide alteration with or without amino acid substitution (Table 1). Codon 453, for which polymorphism was described in the British and Turkish population,5 showed only wild-type sequence in the present samples. These polymorphic alleles did not cosegregate with the disease, and they were found in healthy individuals as well. Haplotypes of assessed polymorphisms were different among examined patients. Ala330Val was newly identified in this study, and it does not cosegregate with the disease phenotype. Figure 3 shows a representative result of polymerase chain reaction restriction detection for Ala330Val in a family (Case 3). The frequencies of the alleles in 11 patients with primary congenital glaucoma were determined as: allele Ala, 0.95; allele Val, 0.05, and the heterozygosity (Ala/Val) was 9.0%, and those in 116 unrelated healthy individuals were determined as: allele Ala, 0.97; allele Val, 0.03, and the heterozygosity (Ala/Val) was 6.0%.
DISCUSSION PREVIOUS STUDIES REPORTED A WIDE RANGE OF MUTA-
tions in the coding regions of the CYP1B1 gene in patients with primary congenital glaucoma. The current Human Gene Mutation Database Cardiff compiles a total of 22 mutations of the gene among patients in the Mid East and Western countries, consisting of 13 missense or nonsense amino acid substitutions, four small deletions, three small insertions, and two gross abnormalities. 10 These mutations were homozygous or compound heterozygous in affected individuals and transmitted as an autosomal recessive pattern with phenotypically normal heterozygotes; inheritance of the disease over two successive generations was proved to represent pseudodominance.5 Some types of mutation were described in only one family and others in more than two families, noticeably a single ancestral missense mutation at codon 387 in many families of Slovak Gypsies. 11 In our series of Japanese patients, two of the 11 patients with primary congenital glaucoma had different mutations in the CYP1B1 gene (Table 1). It is also noticeable that CYP1B1 gene mutation was not observed in our patients
CASE REPORT ● CASE 1:
A 6-year-old Japanese female (Table 1), who was found to have the R444Q mutation, was referred by a local doctor for ophthalmologic studies because, although she had been visually asymptomatic with normal physical and mental developments, she was found at the preschool vision check-up to have unsatisfactory vision in the right eye. Her parents were first cousins but were healthy, and there was no contributory family history. On examination, best visual acuity was 0.6 in RE and 1.2 in LE. Refractions were emmetropic. Intraocular pressure was elevated up to 348
AMERICAN JOURNAL
OF
OPHTHALMOLOGY
MARCH 2001
with juvenile-onset or adult-onset primary open- angle glaucoma. A homozygous insertional mutation (1620 ins G) has been reported in this AMERICAN JOURNAL OF OPHTHALMOLOGY,7 and an additional mutation is described above. This novel mutation replaces CGA with CAA at codon 444 (R444Q) in the C-terminus polypeptide, which causes a change of the amino acid (arginine to glutamine). The R444Q mutation is located in the meander region of the protein, in which another missense mutation has been identified at codon 437 (Pro to Leu) in a Turkish family of primary congenital glaucoma.5 The R444Q mutation cosegregated with the disease phenotype in an autosomal recessive pattern and was not found in unrelated healthy individuals. We are unaware of previous reports of this mutation and could find no reference to it in a computerized search utilizing Online Mendelian Inheritance in Man (OMIM) or The Cardiff Human Gene Mutation Database (HGMD). A computerized protein database search (National Center for Biotechnology Information, Basic Local Alignment Search Tool) found a significant conservation of the relevant arginine residue and the following two amino acid residues [Arg-Phe-Leu] in the P-450 superfamily, including CYP1B1, CYP1A1, CYP1A2, and other cytochrome P450 subfamilies from bacteria to human, thus suggesting that it is causative for primary congenital glaucoma. Because functional information of CYP1B1 gene abnormalities is not available, the mutational effect of R444Q mutation is unknown. Primary congenital glaucoma shows a certain extent of variable clinical expressivity.1 Little is known about the genotype-phenotype correlation with reference to CYP1B1 gene mutation. Most of the previous molecular genetic studies documented a brief clinical note that patients with primary congenital glaucoma presented with aggressive features of the disease. In our two patients with distinct mutations, there was a noticeably variable phenotype. The patient with an insertional mutation showed severe disease at birth characterized by tearing, enlarged eyeballs with hazy corneas, and elevated intraocular pressures as high as 50 mm Hg.7 The other patient with the R444Q mutation was noted as having asymptomatic disease at preschool check-up at six years of age. These two patients may represent the opposing sides of the phenotypic spectrum of primary congenital glaucoma. It is noticeable that only two (18.2%) of our 11 patients with primary congenital glaucoma were identified as having mutations in the CYP1B1 gene. This suggests that the CYP1B1 gene involves only a small portion of primary congenital glaucoma in our population. By contrast, CYP1B1 gene mutation is responsible for 85% to 90% of cases of primary congenital glaucoma in Turkey and Saudi Arabia,12,13 and a single ancestral mutation has been suggested to involve the majority of patients in Slovak Gypsies.11 Thus, available data suggest that there are ethnic and VOL. 131, NO. 3
CYP1B1 MUTATION
IN
racial differences in the frequency of CYP1B1 gene mutation in patients with primary congenital glaucoma. Other genes must contribute to a certain portion of the disease.3 Results in this study also revealed that the CYP1B1 gene is highly polymorphic. Genetic polymorphisms at codon 48, 119, 432, and 449 reported in British and Turkish population5 were confirmed in the present Japanese population. Furthermore, a novel substitution at codon 330 (Ala330Val) was identified in this study. The allele frequencies of Ala330Val showed no significant differences between a group of primary congenital glaucoma and that of normal controls in a Japanese population. They were in agreement with the expectations from the Hardy-Weinberg equilibrium. Therefore, Ala330Val is suggested to represent an innocent polymorphism in the CYP1B1 gene. We should be cautious regarding the genetic polymorphism of CYP1B1 in the molecular analyses of primary congenital glaucoma. Mutations of the CYP1B1 gene are pathognomonic in some extent of Japanese patients with congenital glaucoma. Further studies are justified to explore whether a relationship exists between the phenotypic expressivity of the disease and the type of mutation.
REFERENCES 1. Walton DS. Glaucoma in childhood. In: Albert DM, Jakobiec FA (editors). Principles and practice of ophthalmology: clinical practice, volume 4. Philadelphia: WB Saunders, 1994, pp. 2769 –2777. 2. Sarfarazi M, Akarsu AN, Hossain A, et al. Assignment of a locus (GLC3A) for primary congenital glaucoma (Buphthalmos) to 2p21 and evidence for genetic heterogeneity. Genomics 1995;30:171–177. 3. Akarsu AN, Turacli ME, Aktan SG, et al. A second locus (GLC3B) for primary congenital glaucoma (Buphthalmos) maps to the 1p36 region. Hum Mol Genet 1996;5:1199 – 1203. 4. Stoilov I, Akarsu AN, Sarfarazi M. Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 1997;6:641– 647. 5. Stoilov I, Akarsu AN, Alozie I, et al. Sequence analysis and homology modeling suggest that primary congenital glaucoma on 2p21 results from mutations disrupting either the hinge region or the conserved core structures of cytochrome P4501B1. Am J Hum Genet 1998;62:573–584. 6. Bejjani BA, Lewis RA, Tomey KF, et al. Mutations in CYP1B1, the gene for cytochrome P4501B1, are the predominant cause of primary congenital glaucoma in Saudi Arabia. Am J Hum Genet 1998;62:325–333. 7. Kakiuchi T, Isashiki Y, Nakao K, et al. A novel truncating mutation of cytochrome P4501B1 (CYP1B1) gene in primary infantile glaucoma. Am J Ophthalmol 1999;128:370 –372. 8. Sutter TR, Tang YM, Hayes CL, et al. Complete cDNA sequence of a human dioxin-inducible mRNA identifies a
PRIMARY CONGENITAL GLAUCOMA
349
affected with primary congenital glaucoma. J Med Genet 1999;36:290 –294. 12. Sarfarazi M. Recent advances in molecular genetics of glaucomas. Hum Mol Genet 1997;6:1667–1677. 13. Bejjani BA, Stockton DW, Lewis RA, et al. Multiple CYP1B1 mutations and incomplete penetrance in an inbred population segregating primary congenital glaucoma suggest frequent de novo events and a dominant modifier locus. Hum Mol Genet 2000;9:367–374.
new gene subfamily of cytochrome P450 that maps to chromosome 2. J Biol Chem 1994;269:13092–13099. 9. Tang YM, Wo YYP, Stewart J, et al. Isolation and characterization of the human cytochrome P450 CYP1B1 gene. J Biol Chem 1996;271:28324 –28330. 10. The Human Gene Mutation Database Cardiff. http.//www. uwcm.ac.uk/uwcm/mg/hgmd0.html. April 25, 2000. 11. Plasilova M, Stoilov I, Sarfarazi M, et al. Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms)
The full-text of AJO is now available online at www.ajo.com. Authors Interactive威, currently available in limited form, is undergoing an upgrade.
350
AMERICAN JOURNAL
OF
OPHTHALMOLOGY
MARCH 2001
● PURPOSE:
To report a novel missense mutation and DNA polymorphism of the CYP1B1gene in Japanese patients with primary congenital glaucoma. ● METHODS: A series of 11 unrelated patients with primary congenital glaucoma was examined. Patients were followed in the Kagoshima University Hospital between 1979 and 1998. DNA was extracted from leukocytes of the patients, their families, and unrelated healthy individuals. Amplicons spanning the coding regions of the CYP1B1 gene were examined by direct sequencing and enzyme-restriction detection. ● RESULTS: In the 11 unrelated patients, besides the previously reported insertional mutation (1620 ins G), a novel missense mutation was identified at codons 444 to replace arginine with glutamine (R444Q) in one patient. The novel missense mutation cosegregated in the relevant family as an autosomal recessive pattern and was not found in other patients or control individuals. In addition, five polymorphic sites were found at codons 48, 119, 330, 432, and 449. These polymorphic alleles did not cosegregate with the disease, and they were found in healthy individuals as well. ● CONCLUSIONS: Approximately 20% of Japanese patients with primary congenital glaucoma may be affected by mutations in the CYP1B1 gene. Further studies are justified to explore whether a relationship exists between the phenotypic expressivity of the disease and the type of Accepted for publication Sep 14, 2000. From the Department of Ophthalmology (Drs Kakiuchi-Matsumoto, Ohba, Kimura, Sonoda, and Unoki) and Center for Chronic Viral Diseases (Dr Isashiki), Kagoshima University Faculty of Medicine, Kagoshima, Japan. This work was supported by Grants-in-Aid for Scientific Research (12877279, 12671715) from the Japanese Ministry of Education, Science and Culture, Tokyo, Japan. No proprietary interest. Reprint requests to Yasushi Isashiki, MD, Division of Molecular Pathology and Genetic Epidemiology, Center for Chronic Viral Diseases, Kagoshima University Faculty of Medicine, Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan. Fax: ⫹ 81 099 275 5942; e-mail: isayasu@ m.kufm.kagoshima-u.ac.jp 0002-9394/01/$20.00 PII S0002-9394(00)00808-4
©
2001 BY
mutation. (Am J Ophthalmol 2001;131:345–350. © 2001 by Elsevier Science Inc. All rights reserved.)
P
RIMARY CONGENITAL OR INFANTILE GLAUCOMA IS A
rare genetic disorder that usually manifests itself at birth or within the first year of life. It is characterized by tearing, photophobia, and enlargement of the eyeball (buphthalmos) resulting from elevated intraocular pressure. Unless managed properly, the disease may eventually result in permanent visual loss because of optic atrophy.1 The disorder is autosomal recessively inherited, and it has been assumed to comprise a group of genetically heterogenous diseases. Linkage studies have mapped two loci to chromosome 2p21 and 1p36.2,3 The 2p21 locus has emerged as a major location for patients with primary congenital glaucoma in Turkey and Saudi Arabia. Candidate gene studies of the 2p21 locus have identified diseasecausative mutations in the cytochrome P4501B1 (CYP1B1) gene, a member of P-450 superfamily, and its sequence analyses have revealed a variety of nucleotide alterations and micro- or gross-lesions within the translated regions of the gene. These mutations have been demonstrated as a predominant cause of primary congenital glaucoma in the Turkish and Saudi Arabian population.4 – 6 Recently, we reported an insertional frameshift mutation in our Japanese patient with primary congenital glaucoma.7 We further investigated a series of Japanese patients with primary congenital glaucoma and found a novel missense mutation that is believed to be disease causative. In addition, we confirmed that the CYP1B1 gene is highly polymorphic in its coding regions.
PATIENTS AND METHODS ● PATIENTS:
Eleven patients were diagnosed with primary congenital glaucoma and followed up between 1979 and 1998 in the Kagoshima University Medical Center, a
ELSEVIER SCIENCE INC. ALL
RIGHTS RESERVED.
345
346
AMERICAN JOURNAL
OF
Sex
F M M M M M M M M F M 1 2 3 4 5 6 7 8 9 10 11
Taq I recognizes the wild-type sequence at codon 444 in exon 3, and digests into three fragments. An amino acid-substituting mutation at codon 444 (R444Q) abolishes the Taq I–restriction sequence. Enzyme-treated amplicon was separated by 3.0% agarose gel electrophoresis.
Case
● PCR-RESTRICTION DETECTION FOR R444Q:
OPHTHALMOLOGY
A ⫽ alanine; CF ⫽ counting finger; D1 ⫽ aspartic acid (GAC); D2 ⫽ aspartic acid (GAT); G ⫽ glycine; GON ⫽ goniotomy; L ⫽ leucine; N ⫽ asparagine; Q ⫽ glutamine; R ⫽ arginine; S ⫽ serine; TRT ⫽ trabeculotomy; V ⫽ valine. *Codon numbers follow those of Tang and associates.9
N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N D2/D2 D1/D2 D1/D2 D2/D2 D1/D1 D1/D1 D1/D1 D1/D2 D2/D2 D1/D1 D1/D1 L/L V/L L/L L/L L/L L/L L/L L/L L/L L/L L/L A/A A/A A/V A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/S A/A A/S S/S A/S A/A A/S A/S A/A R444Q 1620 ins G ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ 6 years 3 months at birth at birth 3 years 6 months 3 months at birth at birth at birth 7 years
Bilateral Bilateral Bilateral Bilateral Unilateral Bilateral Bilateral Bilateral Bilateral Bilateral Bilateral
GON, TRT GON GON, TRT GON GON GON, TRT TRT TRT TRT TRT TRT
RE: RE: RE: RE: RE: RE: RE: RE: RE: RE: RE:
0.7; LE: 1.5 (20 years) 0.8; LE: 0.1 (21 years) 0.08; LE: 0.1 (9 years) null; LE: 0.03 (21 years) CF§; LE: 1.2 (11 years) 0.04; LE: 1.5 (11 years) 0.5; LE: 0.1 (2 years) 1.0; LE: 1.5 (20 years) 0.2; LE: 0.2 (3 years) 0.02; LE: CF (25 years) 1.0; LE: 0.8 (10 years)
⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫺ ⫺
R/R R/R R/G R/G R/R R/R R/G R/R R/R R/G R/G
449 gac/gat 432 ctg/gtg 330 gcc/gtc
Variants (Codon Number and Nucleotide Change)*
119 gcc/tcc 48 cgg/ggg Age at Onset
Affected Eyes
● DIRECT SEQUENCING: Nucleotide sequence of amplified DNA fragment was directly determined by autocycle sequencing, using an automated nucleotide sequencer (ALF Express, Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK) and 5⬘-dyeamidite 667 (CY5) labeled primers. Sense and antisense strands were evaluated in each case; numbering of CYP1B1 gene nucleotides and codons followed that of Tang and associates.9
Surgery
● PCR-AMPLIFICATION: DNA was prepared from peripheral white blood cells after cell lysis. The CYP1B1 gene has two long coding exons (exon 2, 1043 base pair [bp]; exon 3, 589 bp), which translate 543 amino acids.8,9 Three fragments dividing exon 2 and one fragment encompassing exon 3 were amplified using a set of primer pairs (Cbe237F/Cbe2-41R, Cbe2-40F/Cbe2-44R, Cbe2-44F/Cbe249R, and Cbe3-F/Cbe3-R), as shown in Table 2. After initial denaturation at 95°C for 5 minutes, polymerase chain reaction amplification was performed with 30 cycles (95°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes), except for Cbe2-37F/Cbe2-41R in which annealing temperature was set at 58°C. Final extension was at 72°C for 10 minutes.
Causative Mutation
Informed consent was obtained from all participants in this study. Peripheral blood was obtained from the 11 patients and their family members, 30 patients with juvenile- or adult-onset primary open-angle glaucoma, and 100 unrelated healthy adults.
Family History
● DNA SAMPLES:
Visual Acuity Outcome (Age at Final Examination)
TABLE 1. Clinical and CYP1B1 Genotype Information in Patients With Primary Congenital Glaucoma
453 aac/agc
tertiary referral institution in the Kagoshima prefecture of southwestern Japan with an average annual new birth rate of approximately 17,000 during the study period. The clinical information of the patients is summarized in Table 1. Each patient belonged to unrelated families who had resided in the Kagoshima prefecture; 10 patients were sporadic and one patient had an affected maternal grandmother. Eight patients presented with symptoms and signs at birth or within 6 months after birth, and the remaining three patients were first noted to have the disease at ages older than 3 years. Results of examination at the initial presentation were compatible with features of primary congenital glaucoma characterized by elevated intraocular pressure and subtle developmental defect in the anterior chamber angle; none of the patients had other inherited ocular disorders. These patients underwent goniotomy and/or trabeculotomy with a variable long-term visual outcome.
MARCH 2001
TABLE 2. Primers Used in the Amplification of Coding Exons of the CYP1B1 Gene
Exon
Primer
Sequence
Position*
2
Cbe2-37F Cbe2-41R Cbe2-40F Cbe2-44R Cbe2-44F Cbe2-49R Cbe3-F Cbe3-R
GTGTCACGCCTTCTCCTTTCT GAGCCCTGCTGCACCAGGGC ACGTTTTCCAGATCCGCCTG CGTTGTGGCTGAGCAGCTCA ACAGCCACGACGACCCCGAG TGTCTCTACTCCGCCTTTTTCA GCTCACTTGCTTTTCTCTCT AAATTTCAGCTTGCCTCTTG
3776-3797 4140-4121 4053-4072 4490-4471 4446-4465 4910-4889 7841-7860 8493-8474
2 2 3
Fragment size (base pair)
365 438 465 653
*Nucleotide number follows genomic DNA sequence of the CYP1B1 gene (Tang and associates9).
FIGURE 1. Direct sequencing results of exon 3 of the CYP1B1 gene. Wild-type: ⴝ a control subject; mutant: ⴝ a patient (Case 1) with primary congenital glaucoma. The patient shows a homozygous mutation at codon 444 (CGA to CAA, arrows) that substitutes arginine (Arg) to glutamine (Gln).
● POLYMORPHIC ALLELES:
Among known polymorphic alleles at codon 48, 119, 432, 449, and 453,5 enzymerestriction method was applicable for Arg48Gly, Ala119Ser, and Leu432Val. Ava I digests allele Gly (GGG) at codon 48 in exon 2. Nae I digests allele Ala (GCC) at codon 119 in exon 2. Bsr I digests allele Leu (CTG) at codon 432 in exon 3. Newly identified polymorphic alleles (Ala330Val) could be confirmed with Sfo I that recognizes allele Ala at codon 330. Enzyme-treated amplicon was separated by 3.0% agarose gel electrophoresis to determine polymorphic genotypes. Other polymorphisms at codons 449 and 453 were evaluated by direct sequencing.
RESULTS ● DISEASE-CAUSATIVE MUTATIONS:
One patient (Case 1) showed a novel mutation in the CYP1B1 gene that is responsible for primary congenital glaucoma. This mutation consisted of an alteration of nucleotide 1677 from guanine to adenine that resulted in amino acid substitution from arginine to glutamine at codon 444 (R444Q) in exon 3 (Figure 1). Taq I–restriction detection revealed that the patient had homozygous mutant alleles and that the family members were either heterozygous with mutant and wildtype allele or homozygous with wild-type alleles (Figure 2). All of the remaining ten patients with primary congenVOL. 131, NO. 3
CYP1B1 MUTATION
IN
FIGURE 2. Taq I–restriction detection for R444Q mutation of the CYP1B1 gene in a family with primary congenital glaucoma. Taq I recognizes the wild-type sequence at codons 355 and 444 of the exon 3 of the CYP1B1 gene and digests into three fragments with 327 base pair (bp), 267 bp, and 59 bp (wild-type). R444Q mutation abolishes a Taq I–restriction site at codon 444 (mutant, 594 bp). C ⴝ a control individual; M: ⴝ molecular markers (100 bp ladder); U: ⴝ untreated amplicon (653 bp); C: a control individual. The patient (closed circle) has homozygous mutant alleles (Gln/Gln) at codon 444. Parents and two brothers (open symbols) of the patient show heterozygous alleles (Arg/Gln).
ital glaucoma, 30 unrelated patients with juvenile-onset or adult-onset primary open-angle glaucoma, or 100 unrelated healthy individuals showed only the wild-type sequence at codon 444.
PRIMARY CONGENITAL GLAUCOMA
347
28 mm Hg in the right eye and 21 mm Hg in the left eye. There were no remarkable anomalies in the external or anterior segments of the eyes. Corneas were clear, and their horizontal diameter measured 12.0 mm in the right eye and 11.0 mm in the left eye. Anterior chambers were normal in depth and clear with normal round pupils. Gonioscopies revealed that anterior chamber angles were open with the iris inserted anteriorly and subtle altered transparency of the trabecular meshwork, more marked in the right eye. Lenses and vitreous cavities were normal. Ophthalmoscopic examination showed that the right optic disk was mildly pale and had an enlarged cupping with the cup-to-disk ratio of 0.7 and the left optic disk appeared normal. The patient was diagnosed as having late-onset primary congenital glaucoma, and she underwent repeated goniotomy and a trabeculotomy in the right eye, which finally led to the control of the right intraocular pressure at or below 21 mm Hg. Subsequently, she was followed at regular intervals to evaluate the intraocular pressure and visual function. Examination results at the age of 22 years were as follows. Best visual acuity was 0.5 in RE by correction with ⫺2.5 diopters sphere and 1.2 in LE by correction with ⫺4.0 diopters sphere. Visual field tests revealed mild loss of the central field in the right eye and superonasal step defect in the left eye. Corneas, lenses, and vitreous cavities were clear. Anterior chamber angles remained unchanged except partial peripheral anterior synechiae formation in the right eye resulting from previous surgeries. Ophthalmoscopic examination disclosed mild pallor of the right optic disk with cup-to-disk ratio of approximately 0.9 and normal-appearing left optic disk.
FIGURE 3. DNA polymorphism at codon 330 of the CYP1B1 gene in a family with primary congenital glaucoma. U: ⴝ untreated amplicon. A genomic fragment of exon 3 of the CYP1B1 gene was amplified including a Ala/Val polymorphism at codon 330 (Ala330Val). Sfo I recognizes allele Ala (gcc) and digested into smaller fragments. In this family, the nonaffected father of the affected patient (Case 3, Table 1) has the homozygous genotype (Val/Val). The patient and his nonaffected mother and sister have the heterozygous genotype (Ala/ Val). Thus, Ala330Val does not cosegregate with the disease.
● GENETIC POLYMORPHISM:
Enzyme restriction and direct sequencing of the CYP1B1 gene revealed five polymorphic sites in exon 2 and exon 3 at codons 48, 119, 330, 432, and 449, demonstrating in each site variable genotypes resulting from a nucleotide alteration with or without amino acid substitution (Table 1). Codon 453, for which polymorphism was described in the British and Turkish population,5 showed only wild-type sequence in the present samples. These polymorphic alleles did not cosegregate with the disease, and they were found in healthy individuals as well. Haplotypes of assessed polymorphisms were different among examined patients. Ala330Val was newly identified in this study, and it does not cosegregate with the disease phenotype. Figure 3 shows a representative result of polymerase chain reaction restriction detection for Ala330Val in a family (Case 3). The frequencies of the alleles in 11 patients with primary congenital glaucoma were determined as: allele Ala, 0.95; allele Val, 0.05, and the heterozygosity (Ala/Val) was 9.0%, and those in 116 unrelated healthy individuals were determined as: allele Ala, 0.97; allele Val, 0.03, and the heterozygosity (Ala/Val) was 6.0%.
DISCUSSION PREVIOUS STUDIES REPORTED A WIDE RANGE OF MUTA-
tions in the coding regions of the CYP1B1 gene in patients with primary congenital glaucoma. The current Human Gene Mutation Database Cardiff compiles a total of 22 mutations of the gene among patients in the Mid East and Western countries, consisting of 13 missense or nonsense amino acid substitutions, four small deletions, three small insertions, and two gross abnormalities. 10 These mutations were homozygous or compound heterozygous in affected individuals and transmitted as an autosomal recessive pattern with phenotypically normal heterozygotes; inheritance of the disease over two successive generations was proved to represent pseudodominance.5 Some types of mutation were described in only one family and others in more than two families, noticeably a single ancestral missense mutation at codon 387 in many families of Slovak Gypsies. 11 In our series of Japanese patients, two of the 11 patients with primary congenital glaucoma had different mutations in the CYP1B1 gene (Table 1). It is also noticeable that CYP1B1 gene mutation was not observed in our patients
CASE REPORT ● CASE 1:
A 6-year-old Japanese female (Table 1), who was found to have the R444Q mutation, was referred by a local doctor for ophthalmologic studies because, although she had been visually asymptomatic with normal physical and mental developments, she was found at the preschool vision check-up to have unsatisfactory vision in the right eye. Her parents were first cousins but were healthy, and there was no contributory family history. On examination, best visual acuity was 0.6 in RE and 1.2 in LE. Refractions were emmetropic. Intraocular pressure was elevated up to 348
AMERICAN JOURNAL
OF
OPHTHALMOLOGY
MARCH 2001
with juvenile-onset or adult-onset primary open- angle glaucoma. A homozygous insertional mutation (1620 ins G) has been reported in this AMERICAN JOURNAL OF OPHTHALMOLOGY,7 and an additional mutation is described above. This novel mutation replaces CGA with CAA at codon 444 (R444Q) in the C-terminus polypeptide, which causes a change of the amino acid (arginine to glutamine). The R444Q mutation is located in the meander region of the protein, in which another missense mutation has been identified at codon 437 (Pro to Leu) in a Turkish family of primary congenital glaucoma.5 The R444Q mutation cosegregated with the disease phenotype in an autosomal recessive pattern and was not found in unrelated healthy individuals. We are unaware of previous reports of this mutation and could find no reference to it in a computerized search utilizing Online Mendelian Inheritance in Man (OMIM) or The Cardiff Human Gene Mutation Database (HGMD). A computerized protein database search (National Center for Biotechnology Information, Basic Local Alignment Search Tool) found a significant conservation of the relevant arginine residue and the following two amino acid residues [Arg-Phe-Leu] in the P-450 superfamily, including CYP1B1, CYP1A1, CYP1A2, and other cytochrome P450 subfamilies from bacteria to human, thus suggesting that it is causative for primary congenital glaucoma. Because functional information of CYP1B1 gene abnormalities is not available, the mutational effect of R444Q mutation is unknown. Primary congenital glaucoma shows a certain extent of variable clinical expressivity.1 Little is known about the genotype-phenotype correlation with reference to CYP1B1 gene mutation. Most of the previous molecular genetic studies documented a brief clinical note that patients with primary congenital glaucoma presented with aggressive features of the disease. In our two patients with distinct mutations, there was a noticeably variable phenotype. The patient with an insertional mutation showed severe disease at birth characterized by tearing, enlarged eyeballs with hazy corneas, and elevated intraocular pressures as high as 50 mm Hg.7 The other patient with the R444Q mutation was noted as having asymptomatic disease at preschool check-up at six years of age. These two patients may represent the opposing sides of the phenotypic spectrum of primary congenital glaucoma. It is noticeable that only two (18.2%) of our 11 patients with primary congenital glaucoma were identified as having mutations in the CYP1B1 gene. This suggests that the CYP1B1 gene involves only a small portion of primary congenital glaucoma in our population. By contrast, CYP1B1 gene mutation is responsible for 85% to 90% of cases of primary congenital glaucoma in Turkey and Saudi Arabia,12,13 and a single ancestral mutation has been suggested to involve the majority of patients in Slovak Gypsies.11 Thus, available data suggest that there are ethnic and VOL. 131, NO. 3
CYP1B1 MUTATION
IN
racial differences in the frequency of CYP1B1 gene mutation in patients with primary congenital glaucoma. Other genes must contribute to a certain portion of the disease.3 Results in this study also revealed that the CYP1B1 gene is highly polymorphic. Genetic polymorphisms at codon 48, 119, 432, and 449 reported in British and Turkish population5 were confirmed in the present Japanese population. Furthermore, a novel substitution at codon 330 (Ala330Val) was identified in this study. The allele frequencies of Ala330Val showed no significant differences between a group of primary congenital glaucoma and that of normal controls in a Japanese population. They were in agreement with the expectations from the Hardy-Weinberg equilibrium. Therefore, Ala330Val is suggested to represent an innocent polymorphism in the CYP1B1 gene. We should be cautious regarding the genetic polymorphism of CYP1B1 in the molecular analyses of primary congenital glaucoma. Mutations of the CYP1B1 gene are pathognomonic in some extent of Japanese patients with congenital glaucoma. Further studies are justified to explore whether a relationship exists between the phenotypic expressivity of the disease and the type of mutation.
REFERENCES 1. Walton DS. Glaucoma in childhood. In: Albert DM, Jakobiec FA (editors). Principles and practice of ophthalmology: clinical practice, volume 4. Philadelphia: WB Saunders, 1994, pp. 2769 –2777. 2. Sarfarazi M, Akarsu AN, Hossain A, et al. Assignment of a locus (GLC3A) for primary congenital glaucoma (Buphthalmos) to 2p21 and evidence for genetic heterogeneity. Genomics 1995;30:171–177. 3. Akarsu AN, Turacli ME, Aktan SG, et al. A second locus (GLC3B) for primary congenital glaucoma (Buphthalmos) maps to the 1p36 region. Hum Mol Genet 1996;5:1199 – 1203. 4. Stoilov I, Akarsu AN, Sarfarazi M. Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 1997;6:641– 647. 5. Stoilov I, Akarsu AN, Alozie I, et al. Sequence analysis and homology modeling suggest that primary congenital glaucoma on 2p21 results from mutations disrupting either the hinge region or the conserved core structures of cytochrome P4501B1. Am J Hum Genet 1998;62:573–584. 6. Bejjani BA, Lewis RA, Tomey KF, et al. Mutations in CYP1B1, the gene for cytochrome P4501B1, are the predominant cause of primary congenital glaucoma in Saudi Arabia. Am J Hum Genet 1998;62:325–333. 7. Kakiuchi T, Isashiki Y, Nakao K, et al. A novel truncating mutation of cytochrome P4501B1 (CYP1B1) gene in primary infantile glaucoma. Am J Ophthalmol 1999;128:370 –372. 8. Sutter TR, Tang YM, Hayes CL, et al. Complete cDNA sequence of a human dioxin-inducible mRNA identifies a
PRIMARY CONGENITAL GLAUCOMA
349
affected with primary congenital glaucoma. J Med Genet 1999;36:290 –294. 12. Sarfarazi M. Recent advances in molecular genetics of glaucomas. Hum Mol Genet 1997;6:1667–1677. 13. Bejjani BA, Stockton DW, Lewis RA, et al. Multiple CYP1B1 mutations and incomplete penetrance in an inbred population segregating primary congenital glaucoma suggest frequent de novo events and a dominant modifier locus. Hum Mol Genet 2000;9:367–374.
new gene subfamily of cytochrome P450 that maps to chromosome 2. J Biol Chem 1994;269:13092–13099. 9. Tang YM, Wo YYP, Stewart J, et al. Isolation and characterization of the human cytochrome P450 CYP1B1 gene. J Biol Chem 1996;271:28324 –28330. 10. The Human Gene Mutation Database Cardiff. http.//www. uwcm.ac.uk/uwcm/mg/hgmd0.html. April 25, 2000. 11. Plasilova M, Stoilov I, Sarfarazi M, et al. Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms)
The full-text of AJO is now available online at www.ajo.com. Authors Interactive威, currently available in limited form, is undergoing an upgrade.
350
AMERICAN JOURNAL
OF
OPHTHALMOLOGY
MARCH 2001