Cytochrome P450 2E1 mRNA in the rat prostate: detection and quantitation by competitive reverse transcription and polymerase chain reaction

Molecular and Cellular Probes (1998) 12, 263–271 Article No. ll980177

Cytochrome P450 2E1 mRNA in the rat prostate: detection and quantitation by competitive reverse transcription and polymerase chain reaction Y. Jiang,1 C.-L. Kuo2, S. J. Pernecky3, M. J. Coon2 and W. N. Piper1,4∗ 1

Toxicology Program, Department of Environmental and Industrial Health, School of Public Health, The University of Michigan, Ann Arbor, MI 48109-2029, USA, 2 Department of Biological Chemistry, Medical School, The University of Michigan, Ann Arbor, MI 48109-0606, USA, 3Department of Chemistry, Eastern Michigan University, Ypsilanti, MI 48197, USA and 4Department of Pharmacology, Medical School, The University of Michigan, Ann Arbor, MI 48109-0636, USA (Received 26 January 1998, Accepted 14 May 1998)

Cytochrome P450 2E1 plays a pivotal role in the metabolic activation of a wide variety of low molecular weight environmental toxicants and procarcinogens. In the present study, expression of the P450 2E1 gene in the rat prostate gland was quantitated by competitive reverse transcription and the polymerase chain reaction. To assess accurately the induction level of P450 2E1 mRNA in the prostate after pyridine treatment of rats, a recombinant standard RNA was generated that is homologous to the sequence of P450 2E1 mRNA except for an internal deletion of 100 bases. The data indicate that P450 2E1 mRNA is present in the prostate of untreated animals and is induced about four-fold by treatment with pyridine. The results suggest that exposure to certain environmental chemicals and procarcinogens may increase P450 2E1 levels in the prostate gland and thus could enhance formation of reactive, carcinogenic metabolites.  1998 Academic Press

KEYWORDS: cytochrome P450 2E1, gene expression, prostate, polymerase chain reaction (PCR), pyridine, procarcinogens.

INTRODUCTION High expression of certain cytochrome P450 genes in extrahepatic tissues can be a major determinant of susceptibility to cancer, since P450 enzymes can activate chemicals in close proximity to the target.1–3 Soderkvist et al.4 have demonstrated that a 9000×g supernatant fraction from rat prostate can activate numerous chemicals to mutagenic products, as judged by the Ames Salmonella mutagenicity test.

This finding prompted the authors to investigate the cytochrome P450 enzyme system in the rat prostate gland. It is well documented that many nitrogenous compounds and halogenated hydrocarbons require metabolic activation for carcinogenic activity.2,3,5–8 P450 2E1 catalyses the biotransformation of these substances, which may result in the formation of highly

∗ Author to whom all correspondence should be addressed at: Toxicology Program, Department of Environmental and Industrial Health, School of Public Health, The University of Michigan, Ann Arbor, MI 48109-2029, USA.

0890–8508/98/050263+09 $30.00/0

 1998 Academic Press

264

Y. Jiang et al.

reactive intermediates, often including free radicals, that could bind to DNA and cause malignant transformation.5,9 Pyridine, a nitrogenous heterocyclic compound, is contained within the structure of nicotine and of other cigarette-specific carcinogenic chemicals such as 4(methylnitrosamino)-1-(3-pyridyl)-1-butanone. Pyridine is also a component of cigarette smoke and smoke condensate.10 Pyridine is known to increase the level of P450 2E1 in liver and in extrahepatic tissues.11 P450 2E1 mRNA is found predominantly in the liver, but it is also present at lower levels in the kidney, mucosa and lung.12 However, P450 2E1 mRNA has not yet been detected in the prostate, probably because of the scarcity of the message in this tissue and of the insensitivity of traditional detection techniques. The polymerase chain reaction (PCR) has been widely used for amplification of specific gene products that are present in very small amounts. Accurate quantitation of the amount of target mRNA molecules requires the generation of internal standard RNA as a competitor. Several new competitive PCR techniques have recently been proposed,13–16 the general concept of which is the introduction into the reaction system of an internal standard RNA together with wild-type mRNA before reverse transcription (RT) is performed. In accordance with these techniques, a new type of recombinant standard RNA (rsRNA) has been generated without a plasmid vector in the competitive RT-PCR. The rsRNA is homologous in sequence to wild-type P450 2E1 mRNA except for a 100-base deletion. Theoretically, it has the same efficiency as wild-type P450 2E1 mRNA during reverse transcription and PCR amplification. After RT-PCR amplification, the two DNA products are separated on a 2% agarose gel electrophoresis, visualized by staining with ethidium bromide, photographed, and then analysed by flatbed scanning densitometry. The general strategy for production of rsRNA is illustrated in Fig. 1. This competitive RT-PCR technique has been used to determine the presence of P450 2E1 in the rat prostate gland.

MATERIALS AND METHODS Animals and treatments Sprague-Dawley rats (300–400 g) were obtained from Charles River Breeding Labs (Wilmington, MA, USA), and maintained in a temperature controlled room with 12-h light–dark cycles (0600 lights on; 1800 lights off). Animals were allowed free access to food (Purina Rodent Chow, Ralston Purina Co., St Louis, MO, USA) and water. For studies of expression of the

P450 2E1 gene, animals were treated with pyridine (100 mg kg−1 day−1, i.p.) for 3 days, and controls received an equal volume of saline vehicle. The animals were killed by decapitation, and the ventral lobes of the prostate were rapidly removed and snapfrozen in liquid nitrogen. Tissue was maintained at −80°C until processed for RNA isolation.

Isolation of total RNA and poly(A)+ RNA Total RNA was isolated by the guanidinium thiocyanate method,17 and quantitated from the absorbance at 260 nm. Poly(A)+ RNA was isolated from total RNA with the Poly(A) Quik∈ mRNA Isolation Kit (Stratagene; La Jolla, CA, USA) according to the instructions of the manufacturer.

Reverse-transcription polymerase chain reaction (RT-PCR) assay for P450 2E1 Complementary DNA (cDNA) was synthesized from total prostate RNA (2 lg) with 2·5×10−6  oligo (dT),16 1·0×10−3  of each of the four deoxynucleotide triphosphates, 1·0×10−2  Tris-HCl buffer (pH 8·3), 5·0×10−3  MgCl2 and 2·5 U ll−1 murine leukemia virus reverse transcriptase (BRL; Gaithersburg, MD, USA) in a final volume of 20 ll. Samples were incubated at 42°C for 60 min. The P450 2E1 oligonucleotide primers were synthesized by the DNA Synthesis Facility at the University of Michigan. Sense (5′) and antisense (3′) primers for amplification of a specific 381-bp sequence of P450 2E1 cDNA were as designed by Hellmold et al.18 An internal probe of P450 2E1 was used for Southern blot hybridization to confirm the identity of the PCR product. All primers are shown in Table 1. The rat gene sequence was reported by Umeno et al.31 Polymerase chain reaction mixtures (100 ll) consisted of deoxynucleotide triphosphates (each at 2·5×10−4 ), 2·0×10−3  MgCl2, 0·5 U Taq DNA Polymerase (BRL) and 3′ and 5′ primers (each at 1·5×10−5 ) in 1·0×10−2  TrisHCl buffer, pH 8·3, containing 5·0×10−2  KCl. The reaction mixtures were overlaid with two drops of light mineral oil, placed in a programmable thermocycler (Perkin-Elmer Cetus; Norwalk, CT, USA) at 95°C for 2 min, and submitted to 35 cycles of denaturation (94°C; 2 min), annealing and extension (70°C; 2 min). A 7 min extension step at 72°C was included after the last cycle. The amplified products were resolved by electrophoresis on 2% agarose gels prepared with ethidium bromide (0·5 mg ml−1) in 4·0×10−2  Tris-acetate buffer (pH 8·5) containing

Expression of P450 2E1 gene in rat prostate

265

Primer A (T7 + 5' primer T7

5' primer 381 bases

Wild-type P450 2E1 mRNA

3' primer

Primer B (21mer nest oligonucleotides + 3' primer-AAACG Reverse transcription + PCR amplification T7 Synthesized rsRNA cDNA + T7 promoter sequence T7 RNA polymerase

281 bases

rsRNA with 100-base deletion

Fig. 1. General scheme for preparation of recombinant standard RNA (rsRNA) as a competitor for P450 2E1. PCR, polymerase chain reaction.

Table 1. Oligonucleotides used as primers and as an internal probe, with the respective lengths and positions in the rat P450 2E1 gene Oligonucleotide

Length

Sequence

Primer Aa Primer Bb Sense primerc (5′ primer) Antisense primerd (3′ primer) Internal probee

46 mer 47 mer 21 mer

AATTTAATACGACTCACTATAGGGACTGATTGGCTGCGCACCCTGC GCAAAGAACAGGTCGGCCAAAGTCACAGTGACTGAAGGTGTTCCTTG CTGATTGGCTGCGCACCCTGC

21 mer

GAACAGGTCGGCCAAAGTCAC

21 mer

CACCTTCAGTCACTGGACATC

a

T7 polymerase sequence (underlined) linked to the position of 5019-5039 bases in 2E1 gene sequence. The position of 6519-6494 bases (underlined) linked to the position of 5604-5584 bases. c The position of 5019-5039 bases identical to primer A except the T7 polymerase sequence is absent. d The position of 6514-6494 bases used as 3′ primers. e The position of 5591-5611 bases used as an internal probe. b

2·0×10−3  EDTA. Bands were visualized by exposure of the gels to u.v. light.

the PCR products was identical to that expected for the amplified region of the cDNAs (381-bp).

Southern blot analysis

Preparation of recombinant standard P450 2E1 RNA (rsRNA)

Southern transfer was performed with capillary blotting. The membranes were probed with digoxigeninlabelled internal oligomers specific to the targeted sequence within the RT-PCR products. The resulting blot was exposed to X-ray film for 5 min. The size of

The upstream primer (primer A) was identical in sequence to that of the P450 2E1 mRNA, except that the 5′ end of the primer contained the T7 RNA polymerase promoter sequence (25mer) for specific

266

Y. Jiang et al.

binding of this enzyme. Primer B was created by linking a 26-base sequence at the 3′ end of the antisense primer (5 bases longer than the sequence of antisense primer) to a nest sequence (21mer) beginning at the nucleotide 100 bases upstream in P450 2E1 RNA, thereby creating a 100 base deletion in the final RT-PCR product. A scheme of the procedure for generation of the P450 2E1 homologous competitor, or rsRNA, is given in Fig. 1. The RT reaction for generation of rsRNA was performed with a superscript preamplification kit (BRL). Total RNA from rat prostate (2 lg) was added to an RT reaction system containing the four deoxyribonucleoside triphosphates (1·0×10−3  each), 1·0×10−2  dithiothreitol, 5·0×10−2  KCl, 3·0×10−3  MgCl2, 1·5×10−5  primer B and 200 U superscript RNase H− reverse transcriptase in 5·0×10−2  Tris-HCl buffer, pH 8·3 (total volume, 20 ll). The reaction mixtures were incubated at 37°C for 60 min. An 80 ll aliquot of a PCR master mixture containing 1·5×10−3  MgCl2, 5·0×10−2  KCl, 0·5 U Taq DNA Polymerase and primer A in 1·0×10−2  Tris-HCl buffer, pH 8·3 was added to the RT reaction mixture (final volume, 100 ll). The PCR mixtures were heated at 95°C for 3 min and submitted to 35 cycles of denaturation (94°C, 1 min), annealing (55°C, 2 min) and extension (72°C, 2 min). A 7 min extension step at 72°C was included after the last cycle. The RT-PCR amplified product contained P450 2E1 cDNA with a 100-bp deletion and a segment of the T7 RNA polymerase promoter sequence attached at the 5′ end. The cDNA was purified by column chromatography (High Purification of PCR Product Kit; Boehringer Mannheim, Indianapolis, IN, USA), and the concentration of the purified standard cDNA was determined spectrophotometrically at 260 nm. The T7-MEGAshortscript∠ transcription kit (Ambion; Austin, TX, USA) was used for transcription of rsRNA as follows: standard template cDNA (50 n final concentration) was added to the reaction mixture containing transcription buffer, 2 ll T7 enzyme mix, and the four ribonucleotides (each at 7·5×10−2 ). After gentle mixing, and a brief centrifugation (5 s), samples were incubated at 37°C for 4 h. The template DNA was subsequently degraded by incubation with RNase-free DNase I at 37°C for 15 min, and the reaction was terminated by addition of 15 ll of ammonium acetate (5 ) in RNase-free water. The rsRNA was extracted with two volumes of ethanol, and the mixture was chilled at −80°C for 15 min and centrifuged for 15 min at 12 000×g. The pellet was resuspended in RNase-free water, and the concentration of rsRNA was determined spectrophotometrically at 260 nm.

To confirm the integrity of the rsRNA, serial dilutions were prepared with RNase-free water and added to the RT mixture containing the 3′ primer for P450 2E1 (at 1·5×10−5 ). After reverse transcription, the 5′ primer (1·5×10−5 ) and the additional PCR components were added for amplification. Control reaction mixtures were prepared without reverse transcriptase and rsRNA, respectively. The PCR-amplified products were then separated on a 2% agarose gel and stained with ethidium bromide (0·5 mg ml−1).

Competitive RT-PCR The mRNA (200 ng) from rat prostate and varying amounts of rsRNA were added to the same tube for initial primer extension and subsequent PCR amplification. The basic concept of competitive PCR is illustrated in Fig. 2. The RT reaction was performed at 42°C for 45 min in the presence of 3′ primer (1·5×10−5 ), 2·5 U ll−1 murine leukemia virus reverse transcriptase, and the four deoxynucleotide triphosphates (each at 1·0×10−3 ). After reverse transcription, PCR master mixture was added to a mixture containing 5′ primer (1·5×10−5 ) and the additional PCR components. Amplification was performed as described above for RT-PCR, except that 30 cycles were performed. The two products were resolved on a 2% agarose gel, visualized by staining with ethidium bromide, photographed and quantified by flatbed scanning densitometry. Each experiment was performed in duplicate. Due to the 100 base deletion from the rsRNA sequence, the decreased incorporation of ethidium bromide into rsRNA was corrected by the following equation:12 CBDrsRNA=BDrsRNA×P450 2E1 cDNA (381-bp)/rsRNA (281-bp) where CBDrsRNA is the corrected band area density, and BDrsRNA is the band area density of rsRNA.

RESULTS The results in Fig. 3 illustrate RT-PCR products and Southern blot analysis of RNA samples from liver and prostate tissue obtained from three pyridine-treated rats. The amplified P450 2E1 mRNA products are shown in Fig. 3a. Lane 1 contained the products from prostate total RNA, and the products in lanes 2 and 3 were from prostate mRNA and liver total RNA, respectively. Each of the bands corresponds to a 381bp fragment. Controls (lane 4) contained all RT-PCR components except for reverse transcriptase. The absence of detectable signal in the controls confirmed

Expression of P450 2E1 gene in rat prostate

267

Constant P450 2E1 mRNA + varying rsRNA

Reverse transcription PCR master mix + primers

PCR amplification Gel electrophoresis Marker 381-bp 281-bp

Fig. 2. Schematic diagram for quantitation of P450 2E1 mRNA with competitive reverse transcriptase-polymerase chain reaction (RT-PCR). rsRNA was synthesized as described in Methods. Varying known amounts of rsRNA were added to a constant amount of P450 2E1 mRNA prior to reverse transcription. Theoretically, rsRNA has the same efficiency as wild-type P450 2E1 mRNA during reverse transcription and PCR amplification. The amplified product of rsRNA can be differentiated from that of wild-type P450 2E1 mRNA by virtue of the 100-bp deletion. Electrophoresis was performed on a 2% agarose gel stained with ethidium bromide. (a)

M

1

2

3

(b)

4

381-bp

M

1

2

3

4

381-bp

Fig. 3. Rat P450 2E1 polymerase chain reaction (PCR) products. (a) Ethidium bromide-stained agarose gel containing reverse transcriptase (RT)-PCR products with template P450 2E1 cDNA from amplification of rat liver and prostate glands, respectively. Lane M, 100-bp DNA size marker; lane 1, total RNA from prostate; lane 2, mRNA from prostate; lane 3, total RNA from liver; lane 4, control with all components for RT-PCR except for reverse transcriptase. (b) Same gel as in Fig. 3a following Southern blotting and hybridization to an internal P450 2E1 oligomer probe labelled with digoxigenin. The visible bands were 381 base pairs long, as predicted from the positions of the PCR primers.

that there was no contamination with cDNA template. Fig. 3b illustrates the same gel after Southern transfer and hybridization to a digoxigenin-labelled internal probe of P450 2E1 designed to recognize the internal sequence of P450 2E1. Only lanes 1–3 exhibited

signal, and the bands were of the same size as those in Fig. 3a. These results indicate that P450 2E1 mRNA in rat prostate can be selectively detected by RT-PCR. The results in Fig. 4 show the integrity of rsRNA. The rsRNA was quantified spectrophotometrically, serially

Y. Jiang et al.

268

(a)

M

1

2

3

4

5

6

M

Marker 0.36 pmol 72

fmol

14

fmol

381-bp 281-bp

2.9 fmol

(b)

0.11 fmol

4

23

amol

4.6 amol 0.92 amol

Fig. 4. Ethidium bromide-stained agarose gel containing rsRNA reverse transcriptase-polymerase chain reaction (RT-PCR) product. The amount of rsRNA used in each reaction is indicated above the lane.

diluted and submitted to RT-PCR. The progressive decrease in signal density correlated with the serial dilution of the rsRNA template. The size of the PCR product was as expected (281-bp). Experimental variability in RT-PCR is dramatically decreased when rsRNA is included as an internal standard, and variability in rsRNA is also decreased in the reverse transcription because it has the same efficiency in the reaction as wild-type P450 2E1. A typical competitive PCR experiment with P450 2E1 mRNA is shown in Figs 5a and 6a. The segment amplified with rsRNA (281-bp) could be readily separated on the agarose gels from that amplified with wild-type P450 2E1 (381-bp). The decreased incorporation of ethidium bromide into the 100-bp short internal standard was corrected as described in Methods. The ratio of the amount of rsRNA to P450 2E1 mRNA vs the amount of rsRNA is a linear relationship. The correlation coefficient is 0·995 and 0·997 for the control and pyridine-treated animals, respectively. The results in Figs 5a and 6a illustrate that increasing amounts of rsRNA (lower bands) progressively compete with a constant amount of wildtype P450 2E1 mRNA (upper bands). Figs 5b and 6b show the standard curves obtained for the ratio of rsRNA/P450 2E1 mRNA, determined by densitometric quantitation of ethidium bromide-stained bands. When the ratio is equal to 1, there is equivalence of the two RNA templates. The equivalence point is at 3·996 amol/200 ng mRNA in Fig. 5b, and at 15·7 amol/200 ng mRNA in Fig. 6b. Based on Avogadro’s number (6·02×1023 molecules mol−1), P450 2E1 mRNA in the prostate from untreated (control) and pyridine-treated animals corresponds to 2·4×106 and 9·45×106 molecules, respectively. This indicates

Ratio (rsRNA/P450 2E1 mRNA)

0.58 fmol

y = 1.9808 + 0.74591x R2 = 0.995

3

2

1 4.0 amol 0

2

6

10 rsRNA (amol)

14

Fig. 5. Quantitation of P450 2E1 mRNA in prostate from three untreated rats by competitive reverse transcriptase-polymerase chain reaction (RT-PCR). (a) Ethidium bromide-stained agarose gel showing quantitation of P450 2E1 mRNA expression in rat prostate. Varying amounts (from a 1:2 serial dilution) of rsRNA were added to a constant amount of mRNA (200 ng tube−1) isolated from the prostate of untreated rats. The density of the RT-PCR products of rsRNA and of P450 2E1 mRNA was determined by flatbed scanning densitometry. The lanes were as follows: M, 100-bp DNA marker; 1, 1·56 amol of rsRNA; 2, 3·13 amol of rsRNA; 3, 6·25 amol of rsRNA; 4, 12·5 amol of rsRNA; 5, 25 amol of rsRNA; and 6, 50 amol of rsRNA. (b) The ratio of the density of the RT-PCR product of rsRNA relative to that of P450 2E1 is plotted as a function of the known amount of rsRNA added to each tube prior to RT-PCR. The line was constructed by linear regression analysis. The arrow depicts the theoretical equivalence point for rsRNA and 2E1 mRNA (ratio of 1·0, after correction for size difference), which corresponds to 4·0 amol mRNA.

a 3·9-fold induction of P450 2E1 mRNA in the prostate gland from pyridine-treated rats.

DISCUSSION Prostate cancer has recently been reported to be the second leading cause of cancer deaths among men in the United States.21 It has been proposed that factors such as chemical carcinogens, steroid hormones, race and age may play a role,19–21 but the etiology of prostate cancer is poorly understood. Conflicting findings have been obtained concerning the association of smoking

Expression of P450 2E1 gene in rat prostate (a)

M

1

2

3

4

5

6

M

381-bp 281-bp

Ratio (rsRNA/P450 2E1 mRNA)

(b)

y = 0.13937 + 0.072774x R2 = 0.997

4

3

2

1 15.7 amol 0 00

10

20

30 40 rsRNA (amol)

50

60

Fig. 6. Quantitation of P450 2E1 mRNA levels in prostate from three pyridine-treated rats by competitive reverse transcriptase-polymerase chain reaction (RTPCR). (a) Conditions were as described in the legend to Fig. 5a, except that prostate mRNA was isolated from pyridine-treated rats. The lanes were as follows: M, 100bp DNA marker; 1, 1·56 amol of rsRNA; 2, 3·13 amol of rsRNA; 3, 6·25 amol of rsRNA; 4, 12·5 amol of rsRNA; 5, 25 amol of rsRNA; and 6, 50 amol of rsRNA. (b) The plot was similar to that of Fig. 5b. The arrow shows a theoretical equivalence point corresponding to 15·7 amol mRNA.

and alcohol abuse with prostate cancer.22–27 Pyridine, a major structural component of nicotine and other cigarette-specific carcinogens, and alcohol are inducers of P450 2E1, and repeated exposure can lead to elevated levels of P450 2E1 in target cells. In this study a PCR-based technique was used to detect and measure P450 2E1 gene expression which has the advantages of simplicity, selectivity and accuracy. The use of rsRNA as internal standard in each sample reduces not only the experimental variability in PCR amplification, but also variability in the RT reaction, since the rsRNA can be reverse-transcribed simultaneously with wild-type P450 2E1 mRNA. Furthermore, this approach eliminates many more elaborate procedures such as synthesis of an internal RNA standard by ligation of cDNA template into a plasmid vector, subcloning, enzymatic restriction and isotope detection. The present paper describes, for the first time, the occurrence and quantification of P450 2E1 mRNA in the rat prostate gland. Cellular P450 2E1 content has been suggested to

269

be an important factor in toxicity or carcinogenicity. Previous studies have demonstrated that the increase in liver P450 2E1 content after pyridine administration to rats and rabbits results from an increase in translational efficiency.28 The induction of the P450 2E1 gene is believed to be somewhat different from that of other P450 genes.29 In this regard, the induction of many such genes involves increased transcriptional activation.30 However, at birth an increase in P450 2E1 mRNA accompanies transcriptional activation of the P450 2E1 gene.31 In adult animals, hepatic P450 2E1 concentration is regulated by several distinct mechanisms which, depending on the inducer and treatment, include increased translation of existing mRNA,28 stabilization of protein via inhibition of protein degradation,32 mRNA stabilization33 and increased gene transcription and protein synthesis.34 The mechanism of regulation of hepatic P450 2E1 gene expression by pyridine may differ from that in extrahepatic tissues. Kim et al.28 reported that the increase in P450 2E1 content of rat hepatocytes was accompanied by a decrease in P450 2E1 mRNA; whereas, in renal tissue both 2E1 protein and mRNA levels were elevated by pyridine treatment of the animals.35 The results of the present study showed a 3·9-fold enhancement in P450 2E1 mRNA in the rat prostate gland after treatment with pyridine. It would be of interest to elucidate whether the increase in P450 2E1 mRNA levels in prostate involves stabilization of the mRNA or enhanced transcriptional activation of the gene. Although the prostatic cytochrome P450 2E1 protein and its enzymatic activity was undetected in our previous studies, and the physiological significance of P450 2E1 in this tissue remains to be elucidated, this isozyme may play a key role in the metabolic activation of many environmental toxicants and procarcinogens in situ. This, in turn, may provide clues as to the etiology of prostate cancer. ACKNOWLEDGEMENTS The authors express their thanks to Dr William Wu for his helpful advice during the early stages of this study and to Drs Lourdes Rodgers and Ying Liu for their assistance with scanning densitometry analysis. This research was supported by a Student Award Program Grant from the Blue Cross Blue Shield of Michigan Foundation, SPORE Grant P50 CA 69568, USA, and Grants AA09200 and AA-06211 from the National Institutes of Health.

REFERENCES 1. Gonzalez, F. J. (1989). The molecular biology of the cytochrome P450s. Pharmacological Reviews 40, 243–88.

270

Y. Jiang et al.

2. Guengerich, F. P. (1991). Oxidation of toxic and carcinogenic chemicals by human cytochrome P-450 enzymes. Chemical Research in Toxicology 4, 391– 407. 3. Guengerich, F. P. (1988). Roles of cytochrome P450 enzymes in chemical carcinogenesis and cancer chemotherapy. Cancer Research 48, 2946–54. 4. Soderkvist, P., Busk, L., Toftgard, R. & Gustafsson, J. A. (1982). Metabolic activation of promutagenic substances to active mutagens in the rat ventral prostate. The Prostate 4, 319–20. 5. Yang, C. S., Smith, T. J., Hong, J. & Zhou, S. (1994). Kinetics and enzymes involved in the metabolism of nitrosamines. In Nitrosamines and Related N-nitroso Compounds, Chemistry and Biochemistry, (Loeppky, R. N. & Michejda, C. J., eds) pp. 169–178. ACS Symposium Series 553. 6. Verna, L., Whysner, J. & Williams, G. M. (1996). Nnitrosodiethylamine mechanistic data and risk assessment: bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharmacology Therapeutics 71, 57–81. 7. Raucy, J. L. (1993). Bioactivation of halogenated hydrocarbons by cytochrome P4502E1. Critical Reviews in Toxicology 23, 1–20. 8. Guengerich, F. P., Kim, D. H. & Iwasaki, M. (1991). Role of human cytochrome P-450IIE1 in the oxidation of many low molecular weight cancer suspects. Chemical Research in Toxicology 4, 168–79. 9. Miller, E. C. (1978). Some current perspectives on chemical carcinogenesis in humans and experimental animals; Presidential address. Cancer Research 38, 1479–96. 10. Kim, S. G. & Novak, R. F. (1990). Role of P450IIE1 in the metabolism of 3-hydroxypyridine, a constituent of tobacco smoke: redox cycling and DNA strand scission by the metabolite 2,5-dihydroxypyridine. Cancer Research 50, 5333–9. 11. Kim, S. G., Williams, D. E., Schuets, E. G., Guzelian, P. S., & Novak, R. F. (1988). Pyridine induction of cytochrome P450 in the rat: role of P450j (alcoholinducible form) in pyridine N-oxidation. Journal of Pharmacological Experimental Therapeutics 246, 1175–82. 12. Porter, T. D., Khani, S. C. & Coon, M. J. (1989). Induction and tissue-specific expression of rabbit cytochrome P450 2E1 and 2E2 genes. Molecular Pharmacology 36, 61–5. 13. Menzo, S., Bannarelli, P., Giacca, M., Manzin, A., Varaldo, P. E. & Clementi, M. (1992). Absolute quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction. Journal of Clinical Microbiology 30, 1752–7. 14. Scadden, D. T., Wang, Z. & Groopman, J. E. (1992). Quantitation of plasma human immunodeficiency virus type I RNA by competitive polymerase chain reaction. Journal of Infections Disease 165, 1119–23. 15. Riedy, M. C., Timm, E. A. & Stewart, C. C. (1995). Quantitative RT-PCR for measuring gene expression. Biotechniques 18, 70–6. 16. Vanden Heuvel, J. P., Tyson, F. L. & Bell, D. A. (1993). Construction of recombinant RNA templates for use as internal standards in quantitative RT-PCR. Biotechniques 14, 395–8. 17. Chomczynski, P. & Sacchi, N. (1987). Single-step

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, 156–9. Hellmold, H., Lamb, J. G., Wyss, A., Gustafsson, J. A. & Warner, M. (1995). Developmental and endocrine regulation of P450 isoforms in rat breast. Molecular Pharmacology 48, 630–8. Wynder, E. L., Mabuchi, K. & Whitmore, W. F., Jr (1971). Epidemiology of cancer of the prostate. Cancer 28, 344–60. Meikle, A. W. & Smith, J., Jr (1990). Epidemiology of prostate cancer. Urologic Clinics of North America 17, 709–18. Pienta, K. J. & Esper, P. S. (1993). Risk factors for prostate cancer. Annals of Internal Medicine 118, 793–803. Van Der Gulden, J. W. J., Verbeek, A. L. M. & Kolk, J. J. (1994). Smoking and drinking habits in relation to prostate cancer. British Journal of Cancer 73, 382–9. Hsing, A. W., McLaughlin, J. K., Hrubec, Z., Blot, W. J. & Fraumeni, J. F., Jr (1991). Tobacco use and prostate cancer: 26-year follow-up of US veterans. American Journal of Epidemiology 133, 437–41. Daniel, H. W. (1993). More stage a prostatic cancers, less surgery for benign hypertrophy in smokers. Journal of Urology 149, 68–72. Hatzkin, H. & Soloway, M. S. (1993). Cigarette smoking: a review of possible associations with benign prostatic hyperplasia and prostate cancer. The Prostate 22, 277–90. Daniell, H. W. (1995). A worse prognosis for smokers with prostate cancer. The Journal of Urology 154, 153–7. Hayes, R. B., Brown, L. M., Schoenberg, J. B., Greenberg, R. S., Silverman, D. T., Schwartz, A. G., Swanson, G. M., Benichou, J., Liff, J. M., Hoover, R. N. & Pottern, L. M. (1996). Alcohol use and prostate cancer risk in US blacks and whites. American Journal of Epidemiology 143, 692–7. Kim, S. G., Shehin, S. E., States, C. & Novak, R. F. (1990). Evidence for increased translational efficiency in the induction of P450IIE1 by solvents: analysis of P450IIE1 mRNA polyribosomal distribution. Biochemical and Biophysical Research Communications 172, 767–74. Koop, D. R. & Tierney, D. J. (1990). Multiple mechanisms in the regulation of ethanol-inducible cytochrome P450IIE1. BioEssays 12, 429–35. Okey, A. B. (1990). Enzyme induction in the cytochrome P-450 system. Pharmacology Therapeutics 45, 241–98. Umeno, M., Song, B. J., Kozak, C., Gelboin, H. V. & Gonzalez, F. J. (1988). The rat P450IIE1 gene: complete intron and exon sequence, chromosome mapping, and correlation of developmental expression with specific 5′ cytosine demethylation. Journal of Biological Chemistry 263, 4956–62. Eliasson, E., Johansson, I. & Ingelman-Sundberg, M. (1988). Ligand-dependent maintenance of ethanolinducible cytochrome P450 in primary hepatocyte cell cultures. Biochemical and Biophysical Research Communications 150, 436–43. Song, B. J., Matsunaga, T., Hardwick, J. P., Park, S. S., Veech, R. L., Yang, C. S., Gelboin, H. V. & Gonzalez, F. J. (1987). Stabilization of cytochrome P450j message

Expression of P450 2E1 gene in rat prostate ribonucleic acid in the diabetic rat. Molecular Endocrinology 1, 542–7. 34. Hong, J., Pan, J., Gonzalez, F. J., Gelboin, H. V. & Yang, C. S. (1987). The induction of specific form of cytochrome P-450 (P-450j) by fasting. Biochemical and Biophysical Research Communications 142, 1077–83.

271

35. Kim, H., Kim, S. G., Lee, M. Y. & Novak, R. F. (1992). Evidence for elevation of cytochrome P450 2E1 (alcohol-inducible form) mRNA levels in rat kidney following pyridine administration. Biochemical and Biophysical Research Communications 186, 846–53.