- Email: [email protected]
Cytokine changes in response to TPO receptor agonist treatment in primary immune thrombocytopenia
Cytokine 92 (2017) 110–117
Contents lists available at ScienceDirect
Cytokine journal homepage: www.journals.elsevier.com/cytokine
Cytokine changes in response to TPO receptor agonist treatment in primary immune thrombocytopenia Ming-ming Qu a,1, Xue-na Liu a,1, Xin-guang Liu a,⇑,1, Qi Feng a, Yang Liu a, Xu Zhang a, Shuang Liu a,b, Lei Zhang c, Guo-sheng Li d, Yuan-yuan Zhu a, Ming-yun Lv e, Jun Peng a,f, Ming Hou f,⇑ a
Department of Hematology, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China Department of Hematology, Taian Central Hospital, Taian, PR China Department of Orthopedics, Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan, China d Shandong Provincial Key Laboratory of Immunohematology, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China e Reproductive Center, Rizhao Maternal & Child Health Hospital, Rizhao, PR China f Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China b c
a r t i c l e
i n f o
Article history: Received 5 September 2016 Received in revised form 8 January 2017 Accepted 13 January 2017 Available online 29 January 2017 Keywords: Primary immune thrombocytopenia Cytokines T helper cells Thrombopoietin receptor agonists
a b s t r a c t Thrombopoietin receptor agonists (TPO-RAs) have been clinically used in primary immune thrombocytopenia (ITP) with favorable outcomes, while their effect on cytokine regulation in ITP remains unknown. In the present study, plasma and mRNA expression levels of interleukin (IL)-2, interferon gamma (IFN-c), IL-4, IL-17A, and transforming growth factor-b1 (TGF-b1) were determined by ELISA and real-time quantitative PCR in 26 corticosteroid-resistant/relapsed ITP patients receiving eltrombopag or rhTPO therapy and 15 healthy controls (HCs). Results showed that plasma and mRNA levels of IL-2, IFN-c, IL-4, and IL-17A in ITP patients did not change significantly after TPO-RA treatment, whereas TGF-b1 levels increased remarkably. The pre- and post-treatment plasma and mRNA levels of IFN-c and IL-2 were significantly higher, while the pre- and post-treatment IL-4 levels as well as the pre-treatment TGF-b1 levels were remarkably lower in ITP patients compared with HCs. There was no significant difference in TGF-b1 levels between TPO-RA-treated ITP patients and HCs. No statistical difference was found in plasma levels of IL-17A between ITP patients before or after treatment and HCs. However, the pre- and post-treatment mRNA expression of IL-17A and retinoic orphan receptor (ROR) ct in ITP patients were higher than that in HCs. Overall, these findings indicated that TPO-RA treatment could promote the secretion of TGF-b1, while it could not correct the Th1 and Th17 polarization in ITP patients. This study might improve our understanding of the mechanism of action of TPO-RAs and provide important information for optimizing therapeutic strategies for ITP. Ó 2017 Elsevier Ltd. All rights reserved.
1. Background Primary immune thrombocytopenia (ITP) is an acquired immune-mediated bleeding disorder characterized by autoantibody-mediated platelet destruction and impaired megakaryocyte maturation with reduced platelet production [1]. More recently, it has become obvious that ITP is a more complex disorder in which T cell abnormalities play important roles in platelet destruction [2–4]. Antiplatelet autoantibody production is under the control of T helper (Th) cells, and elevated antiplatelet ⇑ Corresponding authors. E-mail addresses: [email protected] (X.-g. Liu), [email protected] (M. Hou). 1 M.-M. Qu, X.-N. Liu, and X.-G. Liu contributed equally to this work. http://dx.doi.org/10.1016/j.cyto.2017.01.013 1043-4666/Ó 2017 Elsevier Ltd. All rights reserved.
T-cell reactivity in ITP has been observed [1,5–8]. Th cell polarization in ITP has been attributed to increased Th1 and Th17 cells, decreased Th2 cells, and reduced or impaired CD4+CD25+Foxp3+ regulatory T cells (Tregs) [9–11]. Moreover, enhanced cytotoxic T lymphocyte-mediated platelet destruction has been reported in ITP [5,12–14]. The precise reason for these abnormalities remains to be clarified. Thrombopoietin (TPO) is the principal hematopoietic cytokine that stimulates thrombopoiesis by activating the cell through TPO-receptor (TPO-R), c-MPL [15–17]. As insufficient TPO has been found to contribute to decreased platelet production in ITP [18,19], a series of thrombopoietic agents have been developed. Two types of TPO receptor agonists (TPO-RAs), eltrombopag and romiplostim, have been approved by the US Food and Drug Administration as
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
second-line options for the management of ITP [20–22]. In addition, recombinant human TPO (rhTPO) has been used for the treatment of corticosteroid-resistant and relapsed ITP patients in China [23,24]. A rapid response can often be achieved during TPO-RA treatment. Nevertheless, platelet counts usually return to pretreatment levels once the regimen is withdrawn, making it difficult to achieve a long-term drug-independent remission. TPO-R is mainly expressed by CD34+ cells, megakaryocytes, platelets, and several kinds of tumor cells. It has been demonstrated that peripheral blood lymphocytes do not express TPO-R [25]. Nevertheless, TPO-RAs have showed additional effect on regulation of different lymphocyte subsets in ITP. Bao et al. observed that improved activity of Tregs coincided with a remarkable decrease in effector T cell function in TPO-RA-treated ITP patients [26]. Number of regulatory B cells (Bregs) was also increased after TPO-RA treatment in ITP patients [27]. In addition, our recently published paper showed that the recovery of platelet counts after TPO-RA administration in ITP was associated with the restoration of FccR balance toward the inhibitory FccRIIb on monocytes [28]. These data indicate that TPO-RAs have profound effect on immune modulation besides their direct role in stimulating platelet production from megakaryocytes. Cytokine-mediated immunity plays an important role in the pathogenesis of various autoimmune disorders [29–32]. Aberrant cytokine profiles have been correlated with the loss of immune tolerance in ITP patients [8,33]. Moreover, response to different therapeutic strategies, such as high-dose dexamethasone, splenectomy, rituximab, and Helicobacter pylori eradication, is often associated with correction of the cytokine abnormalities in ITP [6,34–38]. Even though TPO-RAs have been used to treat ITP patients for several years, their roles in cytokine modulation remain largely unknown. To evaluate the effect of TPO-RAs on cytokine modulation in ITP, a total of 26 corticosteroid-resistant/relapsed chronic ITP patients receiving eltrombopag or rhTPO treatment were enrolled in the present study. Plasma concentrations and mRNA expression of interleukin (IL)-2, interferon gamma (IFN-c), IL-4, IL-17A, and transforming growth factor b1 (TGF-b1), as well as retinoic orphan receptor (ROR) ct mRNA levels in peripheral blood mononuclear cells (PBMCs) were determined, which might deepen our understanding about the mechanism of TPO-RAs in the treatment of ITP.
2. Materials and methods 2.1. Patients and controls A total of 26 corticosteroid-resistant/relapsed chronic ITP patients (15 females and 11 males; 22–84 years of age, median 51 years) were enrolled in this study between June 2013 and March 2015 at the Department of Hematology, Qilu Hospital, Shandong University, Jinan, China. The duration of ITP from the time of diagnosis ranged from 13 to 433 months. Patients were diagnosed according to the practice guidelines of the International Working Group on ITP [39]. All patients had a pre-treatment platelet count below 30 109/L (baseline platelet count ranged from 4 to 25 109/L, median 13 109/L; Table 1), and had relapsed or had been unresponsive to glucocorticosteroid therapy. Previous therapies, including rescue therapy, must have been completed at least 6 weeks prior to enrollment. Cases complicated with any of the following conditions were excluded: (1) thrombosis or use of thrombopoietic agents, (2) liver, kidney, cardiac, or pulmonary dysfunction, or (3) a clinical history of hepatitis B/C virus or human immunodeficiency virus infection. Pregnant or nursing female subjects were also excluded.
111
Fifteen healthy adult volunteers (9 females and 6 males; 20– 45 years of age, median 30 years) were recruited as controls. Platelet counts ranged from 165 to 325 109/L, with the median count of 209 109/L. This study was approved by the Medical Ethical Committee of Qilu Hospital, Shandong University. Informed consent was obtained from all patients and controls before enrollment in accordance with the Declaration of Helsinki. 2.2. Treatment regimen Eltrombopag (GlaxoSmithKline, Ware, UK) was administered orally with an initial dose of 25 mg once daily for 6 weeks. The dose could be increased to 50 or 75 mg once daily to maintain platelet counts P50 109/L. rhTPO (3SBIO, Shenyang, China) was administered subcutaneously at a daily dose of 300 U/kg initially. The dose frequencies could be adjusted to every other day once platelet counts ascended above 100 109/L. If response was not achieved after 2 weeks of rhTPO administration, patients were designated as non-responders and treatment was discontinued. To reduce the risk of thrombocytosis, eltrombopag or rhTPO therapy was stopped once platelet counts exceeded 250 109/L. The response was evaluated according to the following criteria: complete response (CR) was defined as a platelet count P100 109/L without bleeding; response (R) was defined as a platelet count between 30 and 100 109/L without bleeding, at least a doubling of the baseline counts; no response (NR) was defined as either a platelet count <30 109/L, less than doubling of the baseline platelet count, or bleeding. 2.3. Plasma and PBMC preparation Peripheral blood samples from all patients prior to TPO-RA therapy and healthy controls were obtained. For patients who achieved R, blood samples were collected 6 weeks after TPO-RA treatment. With regard to the non-responders, blood samples were obtained on the day of treatment discontinuation. Plasma was obtained by centrifugation and stored at 80 °C. PBMCs were isolated from the peripheral blood by gradient centrifugation (400g, 20 min) on Ficoll-Paque (HaoYang Biological Manufacture, Tianjin, China) and were stored in aliquots at 80 °C until RNA extraction. 2.4. IFN-c, IL-2, IL-4, IL-17A and TGF-b1 enzyme-linked immunosorbent assay Plasma levels of IL-2, IL-17A and TGF-b1 were measured by commercialized enzyme-linked immunosorbent assay (ELISA) kits following the manufacturer’s protocols (R&D systems, Minneapolis, MN, USA). The lower detection limits for IL-2, IL-17A and TGF-b1 were 7, 15 and 15.4 pg/mL, respectively. Plasma IFNc and IL-4 levels were also determined using a commercial ELISA (Sizhengbai, Beijing, China) according to manufacturer’s instructions. The lower detection limits for these 2 cytokines were both 2 pg/mL. 2.5. RNA isolation and quantitative real-time polymerase chain reaction analysis Total RNA was extracted from PBMCs by TRIzol (Takara Biotechnology, Inc, Japan). The amount of RNA was determined using the Nanophotometer P-class (Implen, Germany). cDNA was synthesized using the PrimeScript RT reagent kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, TGF-b1, RORct, and GAPDH (endogenous control) were quantified by real-time PCR using SYBR Green (Toy-
112
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
Table 1 ITP patient clinical characteristics.
+ # ##
Patient No.
Sex/Age (yr)
Disease duration, yr
Previous treatment
1# 2# 3# 4# 5# 6# 7# 8# 9# 10## 11## 12# 13# 14# 15# 16# 17# 18# 19# 20# 21# 22## 23## 24## 25## 26##
M/25 M/24 M/51 M/48 M/59 M/55 M/29 M/54 M/84 M/53 M/38 F/63 F/35 F/52 F/24 F/60 F/62 F/58 F/54 F/42 F/44 F/51 F/28 F/67 F/35 F/22
2+ 4+ 2+ 23+ 30+ 2+ 3+ 2+ 2+ 5+ 2+ 7+ 4+ 1+ 10+ 2+ 4+ 7+ 1+ 2+ 10+ 3+ 20+ 2+ 1+
Steroids, Steroids Steroids, Steroids, Steroids, Steroids, Steroids, Steroids Steroids, Steroids, Steroids, Steroids Steroids Steroids, Steroids, Steroids, Steroids Steroids, Steroids, Steroids Steroids, Steroids, Steroids, Steroids, Steroids Steroids
Platelet count ( 109/L)
VCR IVIg VCR, splenectomy IVIg, rituximab, VCR, splenectomy splenectomy rituximab IVIg IVIg rituximab
VCR IVIg herbs herbs IVIg, rituximab, splenectomy IVIg, rituximab, VCR herbs IVIg, VCR herbs
Pre-treatment
Post-treatment
13 12 8 4 13 21 25 19 7 11 5 12 18 17 8 21 9 19 22 17 6 18 8 13 6 23
112 5 25 167 15 59 62 247 37 10 96 15 22 105 50 71 124 51 69 57 104 85 51 29 135 95
Efficacy
R NR NR R NR R R R R NR R NR NR R R R R R R R R R R NR R R
Indicates more than. Indicates less than. Patients treated with eltrombopag. Patients treated with rhTPO; steroids included high-dose dexathemethasone, prednisone, or methylprednisolone; IVIg, intravenous immunoglobulin; VCR, vincristine.
obo, Osaka, Japan) as a double-stranded DNA-specific binding dye on a LightCyclerÒ 480II (Roche, Germany). All primers were intron spanning. Primer sequences are listed in Table 2. PCR was performed with denaturation at 95 °C for 5 min, followed by 40 cycles of: denaturation at 95 °C for 15 s, annealing at 62 or 65 °C for 15 s, and extension at 72 °C for 40 s. LightCyclerÒ 480II software release 1.5.0 SP4 Version 1.5.0.39 (Roche, Germany) was used to determine the cycle numbers at which fluorescence emission crossed the automatically determined Ct value. Relative expression levels of the target genes in each sample were analyzed using the 2DDCT method. 2.6. Statistical analysis Data are presented as mean ± SD. The statistical significance among different groups was determined by an analysis of variance, and the differences between two independent groups were evaluated using a Student-Newman-Keuls test, unless the data were not normally distributed, in which case the Mann-Whitney U test was used. Differences between pre- and post-treatment groups were determined by a paired Student’s t test. All tests were performed by SPSS19.0. P values < 0.05 were considered statistically significant. 3. Results 3.1. Efficacy and safety of TPO-RAs Platelet counts at baseline and after eltrombopag or rhTPO treatment are shown in Table 1. Response was achieved in 19 (73.08%) patients, including 7 with CR (26.92%). NR was found in 7 (26.92%) of the 26 patients. Two patients received platelet transfusions during the study (both are because the platelets <10 109/ L at the first two weeks during the eltrombopag treatment).
Eltrombopag and rhTPO therapy were well tolerated in most patients. Liver transaminase increased transiently in 3 patients (2 treated with eltrombopag, 1 with rhTPO) and returned to normal levels after liver-protecting therapy. Four patients reported headaches (3 with eltrombopag, 1 with rhTPO), two patients fatigue (1 with eltrombopag, 1 with rhTPO), and two patients reported nausea and diarrhea (1 with eltrombopag, 1 with rhTPO). 3.2. Cytokine profile in plasma after TPO-RA treatment As is shown in Fig. 1, plasma concentrations of IL-2 and IFN-c were significantly higher in untreated ITP patients than in healthy controls (HCs) (IL-2: 34.27 ± 10.18 vs. 11.33 ± 4.95 pg/mL, P < 0.001; IFN-c: 63.33 ± 10.64 vs. 36.31 ± 9.25 pg/mL, P < 0.001). By contrast, plasma IL-4 and TGF-b1 levels were lower in untreated ITP patients than in HCs (IL-4: 8.82 ± 1.85 vs. 17.90 ± 2.48 pg/mL, P < 0.001; TGF-b1: 1691.27 ± 706.33 vs. 2666.00 ± 1014.88 pg/mL, P = 0.001), confirming a Th1 dominant state in ITP. Consistent with our previous reports [40,41], no statistically significant difference was found in plasma IL-17A levels between untreated ITP patients and HCs (16.48 ± 2.24 vs. 15.64 ± 1.88 pg/mL, P = 0.229). The post-treatment levels of IL-2, IFN-c, IL-4, IL-17A and TGF-b1 in ITP patients were determined to evaluate the potential role of TPO-RAs on Th cell regulation. We did not observe any significant change in plasma IL-2, IFN-c, IL-4, or IL-17A levels after TPO-RA treatment (IL-2: 31.84 ± 10.06 vs. 34.27 ± 10.18 pg/mL, P = 0.346; IFN-c: 64.30 ± 15.27 vs. 63.33 ± 10.64 pg/mL, P = 0.731; IL-4: 9.11 ± 2.07 vs. 8.82 ± 1.85 pg/mL, P = 0.617; IL-17A: 16.66 ± 2.17 vs. 16.48 ± 2.24 pg/mL, P = 0.756), whereas plasma levels of TGF-b1 increased significantly (2336.50 ± 893.17 vs. 1691.27 ± 706.33 pg/mL, P = 0.008). Compared with HCs, plasma IL-2 and IFN-c were higher, while IL-4 was lower in TPO-RAtreated ITP patients (IL-2: 31.84 ± 10.06 vs. 11.33 ± 4.95 pg/mL, P < 0.001; IFN-c: 64.30 ± 15.27 vs. 36.31 ± 9.25 pg/mL, P < 0.001;
113
M.-m. Qu et al. / Cytokine 92 (2017) 110–117 Table 2 Primers and conditions for real-time quantitative PCR. Gene
IL-2 IL-4 IFN-c IL-17A RORct TGF-b1 GAPDH
Primers sequence (50 ? 30 ) Forward
Reverse
GAATGGAATTAATAATTACAAGAATCCC AGCAGTTCCACAGGCACAAG TTGGCTTAATTCTCTCGGAAACG GGAATCTCCACCGCAATGAG CTCAAAGCAGGAGCAATGGAA GAAGTGGATCCACGAGCCCAAG GCACCGTCAAGGCTGAGAAC
TGTTTCAGATCCCTTTAGTTCCAG TACTCTGGTTGGCTTCCTTCAC CGCTACATCTGAATGACCTGC ACACCAGTATCTTCTCCAGGC AGGGAGTGGGAGAAGTCAAAGA GCTGCACTTGCAGGAGCGCAC TGGTGAAGACGCCAGTGGA
Annealing temperature (°C)
Product length (bp)
62 62 62 65 62 62 65/62
229 112 161 202 164 247 138
Fig. 1. Plasma cytokine profiles in untreated ITP patients, patients after TPO-RA treatment, and healthy controls. (A, B, C, E) Higher plasma IL-2, IFN-c levels, and lower IL-4 and TGF-b1 levels were detected in ITP patients both pre- and post-treatment compared to healthy controls. (D) No statistical difference was observed in plasma IL-17A levels among ITP patients and healthy controls. Plasma IL-2, IFN-c, IL-4, and IL-17A did not significantly change after TPO-RA administration. Whereas plasma levels of TGF-b1 increased significantly. All samples were tested in duplicate. Bars represent means ± SD.
IL-4: 9.11 ± 2.07 vs. 17.90 ± 2.48 pg/mL, P < 0.001). In addition, plasma concentrations of IL-17A and TGF-b1 were not statistically different between TPO-RA-treated ITP patients and healthy controls (IL-17A, 16.66 ± 2.17 vs. 15.64 ± 1.88 pg/mL, P = 0.143; TGFb1, 2336.50 ± 893.17 vs. 2666.00 ± 1014.88 pg/mL, P = 0.239; Fig. 1). 3.3. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, TGF-b1 and RORct To further evaluate the effect of TPO-RAs on cytokine modulation, mRNA expression levels of IL-2, IFN-c, IL-4, IL-17A, TGF-b1 and RORct in PBMCs from ITP patients and HCs were determined by real-time PCR. As is shown in Fig. 2, significantly higher IL-2, IFN-c, IL-17A, and RORct together with remarkably lower IL-4 and TGF-b1 mRNA levels were found in untreated ITP patients compared with HCs (IL-2, P = 0.012; IFN-c, P = 0.015; IL-17A, P = 0.001; RORct, P = 0.012; IL-4, P < 0.001; and TGF-b1, P = 0.042, respectively). Consistent with the plasma cytokine findings, there
was no significant change in mRNA expression levels of IL-2, IFN-
c, IL-4, IL-17A, and RORct in PBMCs (P > 0.05), whereas mRNA expression level of TGF-b1 increased significantly (P = 0.039) after TPO-RA treatment. Furthermore, mRNA expression levels of IL17A and RORct in TPO-RA-treated ITP patients were considerably higher than in HCs (P = 0.006 and P = 0.042, respectively). 3.4. Correlation between cytokine changes and platelet response to TPO-RAs To evaluate whether response to TPO-RAs was correlated with cytokine modulation, changes in plasma protein and mRNA expression levels of IL-2, IFN-c, IL-4, and IL-17A in TPO-RA responders and non-responders were analyzed independently. There was no significant change in plasma IL-2, IFN-c, IL-4, and IL-17A levels in TPO-RA responders compared with their pre-treatment levels (IL-2: 35.21 ± 11.08 pg/mL vs. 32.87 ± 10.92 pg/mL, P = 0.277; IFNc: 64.06 ± 11.59 pg/mL vs. 64.52 ± 11.07 pg/mL, P = 0.783; IL-4:
114
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
tration increased significantly in TPO-RA responders (1691.27 ± 706.33 vs. 2561.53 ± 882.24 pg/ml; P < 0.01), but we did not observe any significant change in non-responders after TPO-RA treatment (1633.86 ± 634.43 vs. 1725.71 ± 627.19 pg/ml; P = 0.647; Fig. 3). Further analysis revealed that mRNA levels of IL-2, IFN-c, IL-4, IL-17A, and RORct did not change significantly in either responders or non-responders after TPO-RA treatment (all P > 0.05). With regard to TGF-b1 mRNA, its expression level increased considerably in responders after TPO-RA treatment (P = 0.027), but no statistical change in TGF-b1 mRNA level was found in non-responders (P > 0.05; Fig. 4). 4. Discussion Fig. 2. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 in PBMCs. Significantly higher mRNA expression of IL-2, IFN-c, IL-17A, RORct, and lower IL-4 was found in ITP patients both pre- and post-treatment compared to healthy controls. There was no significant difference in mRNA levels of IL-2, IFN-c, IL-4, IL-17A, and RORC between untreated and TPO-RA-treated patients. mRNA level of TGF-b1 in ITP patients decreased significantly after TPO-RA treatment. Bars represent means ± SD.
8.82 ± 1.82 pg/mL vs. 9.31 ± 2.22 pg/mL, P = 0.316; IL-17A: 16.54 ± 2.11 pg/mL vs. 16.65 ± 2.10 pg/mL, P = 0.670), neither was there in TPO-RA non-responders (IL-2: 31.72 ± 7.26 pg/mL vs. 29.05 ± 7.19 pg/mL, P = 0.358; IFN-c: 61.35 ± 7.93 pg/mL vs. 63.69 ± 7.44 pg/mL, P = 0.219; IL-4: 8.80 ± 2.09 pg/mL vs. 8.54 ± 1.57 pg/mL, P = 0.758; IL-17A: 16.31 ± 2.74 pg/mL vs. 16.69 ± 2.54 pg/mL, P = 0.521). By contrast, plasma TGF-b1 concen-
Cytokines exert a crucial role in maintaining self-tolerance [42]. Aberrant cytokine profiles have been implicated in the pathogenesis of many autoimmune disorders [41,43,44]. It has been well established that active ITP patients exhibit significantly higher Th1/Th2 ratios [2,3,7,33]. Moreover, Th1/Th2 ratios negatively correlated with platelet counts in ITP patients [8]. Consistent with these reports, our data showed that plasma protein and PBMC mRNA of IFN-c and IL-2 levels were increased, whereas IL-4 levels were decreased in ITP patients compared to healthy controls. Our findings further confirm the Th1 dominance in ITP. Th17 cells are another subset of T cells that has been linked to the development of ITP [9,11,45]. Our previous studies have demonstrated that Th17 cells and their lineage-specific transcription factor RORct increased considerably in ITP patients [40]. In line with those observations, we found that mRNA expression of IL-17A and RORct was significantly higher in ITP patients than in
Fig. 3. Plasma IL-2, IFN-c, IL-4, IL-17A and TGF-b1 in responders and non-responders before and after TPO-RA treatment. (A, B, C, D) Plasma levels of IL-2, IFN-c, IL-4 and IL17A did not change significantly after TPO-RA treatment in either responders or non-responders. Plasma TGF-b1 concentrations significantly increased in TPO-RA responders, while no significant changes were observed in non-responders. All samples were tested in duplicate. Bars represent means ± SD.
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
Fig. 4. Relative mRNA expression of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 in patients before and after TPO-RA treatment. (A) Relative mRNA levels of IL-2, IFN-c, IL-4, IL-17A, RORct did not change significantly in responders after TPO-RA treatment, whereas relative mRNA levels of TGF-b1 increased significantly in responders. (B) Relative mRNA levels of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 did not change significantly in non-responders after TPO-RA treatment. Bars represent means ± SD.
healthy controls. Additionally, plasma IL-17A was slightly higher in ITP patients than in healthy controls, though not statistically significant. In ITP patients, response to a range of therapeutic strategies is often accompanied by correction of the aberrant cytokine profiles. High-dose dexamethasone rectified Th1 dominance and restored Th17/Treg balance in ITP [34,35]. Stasi and colleagues also observed that rituximab therapy restored the aberrant Th1/Th2 ratio in ITP responders [38]. In addition, correction of the abnormal cytokine profiles by other therapeutic regimens, such as splenectomy and Helicobacter pylori eradication, has also been reported in ITP [33,36,37]. Together, these observations suggest that restoring a balanced cytokine network strongly contributes to response to different therapeutic regimens. TPO-RAs have recently been used for the management of ITP with relatively high effectiveness [46]. Besides their direct role in stimulating platelet production from megakaryocytes, TPO-RAs have demonstrated additional effects on immunoregulation [47,48]. It has been reported that Treg and Breg activity was enhanced remarkably in TPO-RA-treated ITP patients [26,27]. We previously observed a shift in the balance of Fcc receptors (FccRs) toward the inhibitory FccRIIb on monocytes after TPO-RA treatment [28]. The improvement in Treg activity and restoration of FccR balance in TPO-RA-treated ITP patients could be largely attributed to the enhanced release of transforming growth factor b1 (TGF-b1) [26,28], as a result of greater platelet turnover. Our
115
present data also showed that plasma levels of TGF-b1 increased significantly after TPO-RA administration. TGF-b1 is a multifunctional cytokine which regulates a great diversity of different cell activity. Its receptors, known as TbR1 and TbR2, are also expressed on megakaryocytes. Several independent research groups demonstrated that TGF-b1 suppressed the development of megakaryocyte colony-forming units (CFU-Meg) in a dose-dependent manner [49– 51], and the suppression of TGF-b1 on CFU-Meg development was rather stage-specific, with no effect on primitive stem cells, resulting in a maturational arrest of megakaryopoiesis [52]. Interestingly, TPO was able to upregulate TbR1 and TbR2 expression on megakaryoblasts at the midmegakaryopoietic period, a stage when TGF-b1 was able to arrest the maturation of CFU-Meg [52]. Therefore, TGF-b1 is generally considered as a negative feed-back regulator of megakaryopoiesis, and there seems to be no sufficient evidence to support the role of TGF-b1 in promoting thrombopoiesis. By contrast, the immunoregulatory effect of TGF-b1 on T cells and monocytes might help to restore the immune tolerance and decrease platelet destruction in ITP. Taking into account the enormous heterogeneity and complexity of ITP pathogenesis, the precise role of TGF-b1 in ITP still awaits further investigation. It is noteworthy that other inflammatory cytokines, including IL-6, IL-18, tumor necrosis factors a (TNF-a), and IL-7, could also be secreted by platelets and megakaryocytes [53–57]. Based on these observations, we evaluated the effect of TPO-RAs on modulation of cytokine profiles in ITP. However, our present data did not show any statistical significance in plasma and mRNA expression levels of IFN-c, IL-2, IL-4, and IL-17A after TPO-RA administration, regardless of the response to treatment. Plasma protein and PBMC mRNA expression levels of IFN-c, IL-2, as well as IL-17A and RORct mRNA levels were still higher in post-treatment ITP patients than in healthy controls. In addition, plasma and mRNA levels of IL-4, the effector cytokine of Th2 cells, were considerably lower in post-treatment ITP patients compared with healthy controls. These data indicated that TPO-RA monotherapy did not correct the Th1 and Th17 polarization in ITP, which might account for the high rates of rapid relapse after discontinuation of TPO-RA therapy [23,58,59]. Taking together, TPO-RAs promoted the elevation of platelet counts effectively and were well tolerated in corticosteroidresistant and relapsed ITP patients. However, monotherapy of TPO-RAs did not correct the aberrant cytokine profiles. Despite a longitudinal study should be conducted to further examine these findings, our present data provide important clues to treatment strategy optimization for patients with ITP.
Competing interests The authors have no competing financial interests to declare.
Funding This work was supported by grants from National Natural Science Foundation of China (No. 81570103, No. 30600680). References [1] R. McMillan, Antiplatelet antibodies in chronic immune thrombocytopenia and their role in platelet destruction and defective platelet production, Hematol. Oncol. Clin. North Am. 23 (6) (2009) 1163–1175. [2] J.W. Semple, J. Freedman, Cellular immune mechanisms in chronic autoimmune thrombocytopenic purpura (ATP), Autoimmunity 13 (4) (1992) 311–319. [3] J.W. Semple, A.H. Lazarus, J. Freedman, The cellular immunology associated with autoimmune thrombocytopenic purpura: an update, Transfus. Sci. 19 (3) (1998) 245–251.
116
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
[4] M. Kuwana, J. Kaburaki, Y. Ikeda, Autoreactive T cells to platelet GPIIb-IIIa in immune thrombocytopenic purpura. Role in production of anti-platelet autoantibody, J. Clin. Invest. 102 (7) (1998) 1393–1402. [5] B. Olsson, P.O. Andersson, M. Jernas, S. Jacobsson, B. Carlsson, L.M. Carlsson, H. Wadenvik, T-cell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura, Nat. Med. 9 (9) (2003) 1123–1124. [6] J. Peng, C. Liu, D. Liu, C. Ren, W. Li, Z. Wang, N. Xing, C. Xu, X. Chen, C. Ji, M. Zhang, M. Hou, Effects of B7-blocking agent and/or CsA on induction of platelet-specific T-cell anergy in chronic autoimmune thrombocytopenic purpura, Blood 101 (7) (2003) 2721–2726. [7] J.W. Semple, J. Freedman, Increased antiplatelet T helper lymphocyte reactivity in patients with autoimmune thrombocytopenia, Blood 78 (10) (1991) 2619– 2625. [8] J.W. Semple, Y. Milev, D. Cosgrave, M. Mody, A. Hornstein, V. Blanchette, J. Freedman, Differences in serum cytokine levels in acute and chronic autoimmune thrombocytopenic purpura: relationship to platelet phenotype and antiplatelet T-cell reactivity, Blood 87 (10) (1996) 4245–4254. [9] L. Ji, Y. Zhan, F. Hua, F. Li, S. Zou, W. Wang, D. Song, Z. Min, H. Chen, Y. Cheng, The ratio of Treg/Th17 cells correlates with the disease activity of primary immune thrombocytopenia, PLoS ONE 7 (12) (2012) e50909. [10] H. Ogawara, H. Handa, K. Morita, M. Hayakawa, J. Kojima, H. Amagai, Y. Tsumita, Y. Kaneko, N. Tsukamoto, Y. Nojima, H. Murakami, High Th1/Th2 ratio in patients with chronic idiopathic thrombocytopenic purpura, Eur. J. Haematol. 71 (4) (2003) 283–288. [11] S. Liu, Y.Z. Xiong, T. Li, Y. Li, S.Q. Gu, Y.M. Wang, K.H. Zhang, M. Hou, X.G. Liu, Interleukin-17A and -17F gene polymorphisms in chinese population with chronic immune thrombocytopenia, Ann. Clin. Lab. Sci. 46 (3) (2016) 291–297. [12] L. Chow, R. Aslam, E.R. Speck, M. Kim, N. Cridland, M.L. Webster, P. Chen, K. Sahib, H. Ni, A.H. Lazarus, M.B. Garvey, J. Freedman, J.W. Semple, A murine model of severe immune thrombocytopenia is induced by antibody- and CD8+ T cell-mediated responses that are differentially sensitive to therapy, Blood 115 (6) (2010) 1247–1253. [13] S. Audia, M. Samson, M. Mahevas, C. Ferrand, M. Trad, M. Ciudad, A. Gautheron, F. Seaphanh, V. Leguy, S. Berthier, B. Salles, L. Martin, B. Lorcerie, P. OrtegaDeballon, O. Facy, D. Caillot, et al., Preferential splenic CD8(+) T-cell activation in rituximab-nonresponder patients with immune thrombocytopenia, Blood 122 (14) (2013) 2477–2486. [14] L. Guo, L. Yang, E.R. Speck, R. Aslam, M. Kim, C.G. McKenzie, A.H. Lazarus, H. Ni, M. Hou, J. Freedman, J.W. Semple, Allogeneic platelet transfusions prevent murine T-cell-mediated immune thrombocytopenia, Blood 123 (3) (2014) 422–427. [15] T.D. Bartley, J. Bogenberger, P. Hunt, Y.S. Li, H.S. Lu, F. Martin, M.S. Chang, B. Samal, J.L. Nichol, S. Swift, et al., Identification and cloning of a megakaryocyte growth and development factor that is a ligand for the cytokine receptor Mpl, Cell 77 (7) (1994) 1117–1124. [16] F.J. de Sauvage, P.E. Hass, S.D. Spencer, B.E. Malloy, A.L. Gurney, S.A. Spencer, W.C. Darbonne, W.J. Henzel, S.C. Wong, W.J. Kuang, et al., Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand, Nature 369 (6481) (1994) 533–538. [17] K. Kaushansky, S. Lok, R.D. Holly, V.C. Broudy, N. Lin, M.C. Bailey, J.W. Forstrom, M.M. Buddle, P.J. Oort, F.S. Hagen, et al., Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin, Nature 369 (6481) (1994) 568–571. [18] R.S. Makar, O.S. Zhukov, M.A. Sahud, D.J. Kuter, Thrombopoietin levels in patients with disorders of platelet production: diagnostic potential and utility in predicting response to TPO receptor agonists, Am. J. Hematol. 88 (12) (2013) 1041–1044. [19] R.V. Emmons, D.M. Reid, R.L. Cohen, G. Meng, N.S. Young, C.E. Dunbar, N.R. Shulman, Human thrombopoietin levels are high when thrombocytopenia is due to megakaryocyte deficiency and low when due to increased platelet destruction, Blood 87 (10) (1996) 4068–4071. [20] C. Neunert, W. Lim, M. Crowther, A. Cohen, L. Solberg, M.A. Crowther Jr. American Society of H, The American Society of Hematology 2011 evidencebased practice guideline for immune thrombocytopenia, Blood 117 (16) (2011) 4190–4207. [21] J.B. Bussel, D. Provan, T. Shamsi, G. Cheng, B. Psaila, L. Kovaleva, A. Salama, J.M. Jenkins, D. Roychowdhury, B. Mayer, N. Stone, M. Arning, Effect of eltrombopag on platelet counts and bleeding during treatment of chronic idiopathic thrombocytopenic purpura: a randomised, double-blind, placebo-controlled trial, Lancet 373 (9664) (2009) 641–648. [22] D.J. Kuter, J.B. Bussel, R.M. Lyons, V. Pullarkat, T.B. Gernsheimer, F.M. Senecal, L.M. Aledort, J.N. George, C.M. Kessler, M.A. Sanz, H.A. Liebman, F.T. Slovick, J.T. de Wolf, E. Bourgeois, T.H. Guthrie Jr., A. Newland, et al., Efficacy of romiplostim in patients with chronic immune thrombocytopenic purpura: a double-blind randomised controlled trial, Lancet 371 (9610) (2008) 395–403. [23] Z.G. Cui, X.G. Liu, P. Qin, M. Hou, S.L. Wu, J. Peng, H.G. Zhao, H.Y. Wang, C.T. Zhao, Recombinant human thrombopoietin in combination with cyclosporin A as a novel therapy in corticosteroid-resistant primary immune thrombocytopenia, Chin. Med. J. 126 (21) (2013) 4145–4148. [24] Y.Q. Zhao, Q.Y. Wang, M. Zhai, J. Xu, X.Q. Chen, W.L. Liu, M. Zhang, S.J. Song, J.M. Wang, F.Y. Meng, Y.D. Shan, A multi-center clinical trial of recombinant human thrombopoietin in chronic refractory idiopathic thrombocytopenic purpura, Zhonghua nei ke za zhi 43 (8) (2004) 608–610. [25] K. Kaushansky, Thrombopoietin and hematopoietic stem cell development, Ann. N. Y. Acad. Sci. 872 (1999) 314–319.
[26] W. Bao, J.B. Bussel, S. Heck, W. He, M. Karpoff, N. Boulad, K. Yazdanbakhsh, Improved regulatory T-cell activity in patients with chronic immune thrombocytopenia treated with thrombopoietic agents, Blood 116 (22) (2010) 4639–4645. [27] X. Li, H. Zhong, W. Bao, N. Boulad, J. Evangelista, M.A. Haider, J. Bussel, K. Yazdanbakhsh, Defective regulatory B-cell compartment in patients with immune thrombocytopenia, Blood 120 (16) (2012) 3318–3325. [28] X.G. Liu, S. Liu, Q. Feng, X.N. Liu, G.S. Li, Z. Sheng, P. Chen, Y. Liu, Y. Wei, X.Y. Dong, P. Qin, C. Gao, C. Ma, L. Zhang, M. Hou, J. Peng, Thrombopoietin receptor agonists shift the balance of Fcgamma receptors towards inhibitory receptor IIb on monocytes in ITP, Blood (2016). [29] L.E. Ballantine, J. Ong, A. Midgley, L. Watson, B.F. Flanagan, M.W. Beresford, The pro-inflammatory potential of T cells in juvenile-onset systemic lupus erythematosus, Pediat. Rheumatol. Online J. 12 (2014) 4. [30] E. Lubberts, IL-17/Th17 targeting: on the road to prevent chronic destructive arthritis?, Cytokine 41 (2) (2008) 84–91 [31] C. Qian, T. Jiang, W. Zhang, C. Ren, Q. Wang, Q. Qin, J. Chen, A. Deng, R. Zhong, Increased IL-23 and IL-17 expression by peripheral blood cells of patients with primary biliary cirrhosis, Cytokine 64 (1) (2013) 172–180. [32] D.M. Roeleveld, A.E. van Nieuwenhuijze, W.B. van den Berg, M.I. Koenders, The Th17 pathway as a therapeutic target in rheumatoid arthritis and other autoimmune and inflammatory disorders, BioDrugs: Clin. Immunother., Biopharma. Gene Ther. 27 (5) (2013) 439–452. [33] F.P. Panitsas, M. Theodoropoulou, A. Kouraklis, M. Karakantza, G.L. Theodorou, N.C. Zoumbos, A. Maniatis, A. Mouzaki, Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response, Blood 103 (7) (2004) 2645–2647. [34] C. Guo, X. Chu, Y. Shi, W. He, L. Li, L. Wang, Y. Wang, J. Peng, M. Hou, Correction of Th1-dominant cytokine profiles by high-dose dexamethasone in patients with chronic idiopathic thrombocytopenic purpura, J. Clin. Immunol. 27 (6) (2007) 557–562. [35] Y. Ling, X. Cao, Z. Yu, C. Ruan, Circulating dendritic cells subsets and CD4 +Foxp3+ regulatory T cells in adult patients with chronic ITP before and after treatment with high-dose dexamethasome, Eur. J. Haematol. 79 (4) (2007) 310–316. [36] F.P. Panitsas, A. Mouzaki, Effect of splenectomy on type-1/type-2 cytokine gene expression in a patient with adult idiopathic thrombocytopenic purpura (ITP), BMC Blood Disorders 4 (1) (2004) 4. [37] A.M. Rocha, C. Souza, F.F. Melo, N.C. Clementino, M.C. Marino, G.A. Rocha, D.M. Queiroz, Cytokine profile of patients with chronic immune thrombocytopenia affects platelet count recovery after Helicobacter pylori eradication, Br. J. Haematol. 168 (3) (2015) 421–428. [38] R. Stasi, N. Cooper, G. Del Poeta, E. Stipa, M. Laura Evangelista, E. Abruzzese, S. Amadori, Analysis of regulatory T-cell changes in patients with idiopathic thrombocytopenic purpura receiving B cell-depleting therapy with rituximab, Blood 112 (4) (2008) 1147–1150. [39] F. Rodeghiero, R. Stasi, T. Gernsheimer, M. Michel, D. Provan, D.M. Arnold, J.B. Bussel, D.B. Cines, B.H. Chong, N. Cooper, B. Godeau, K. Lechner, M.G. Mazzucconi, R. McMillan, M.A. Sanz, P. Imbach, et al., Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group, Blood 113 (11) (2009) 2386–2393. [40] X.G. Liu, J. Ren, Y. Yu, L. Sun, Y. Shi, P. Qin, L. Yang, S.H. Ma, X.Y. Dong, D.X. Ma, X. Qu, C.S. Guo, C.Y. Chen, M. Hou, J. Peng, Decreased expression of interleukin27 in immune thrombocytopenia, Br. J. Haematol. 153 (2) (2011) 259–267. [41] D. Ma, X. Zhu, P. Zhao, C. Zhao, X. Li, Y. Zhu, L. Li, J. Sun, J. Peng, C. Ji, M. Hou, Profile of Th17 cytokines (IL-17, TGF-beta, IL-6) and Th1 cytokine (IFNgamma) in patients with immune thrombocytopenic purpura, Ann. Hematol. 87 (11) (2008) 899–904. [42] S.R. Holdsworth, P.Y. Gan, Cytokines: names and numbers you should care about, Clin. J. Am. Soc. Nephrol.: CJASN 10 (12) (2015) 2243–2254. [43] P.O. Andersson, A. Olsson, H. Wadenvik, Reduced transforming growth factorbeta1 production by mononuclear cells from patients with active chronic idiopathic thrombocytopenic purpura, Br. J. Haematol. 116 (4) (2002) 862– 867. [44] C.K. Wong, C.Y. Ho, E.K. Li, C.W. Lam, Elevation of proinflammatory cytokine (IL-18, IL-17, IL-12) and Th2 cytokine (IL-4) concentrations in patients with systemic lupus erythematosus, Lupus 9 (8) (2000) 589–593. [45] J. Zhang, D. Ma, X. Zhu, X. Qu, C. Ji, M. Hou, Elevated profile of Th17, Th1 and Tc1 cells in patients with immune thrombocytopenic purpura, Haematologica 94 (9) (2009) 1326–1329. [46] J.D. Chouhan, J.D. Herrington, Treatment options for chronic refractory idiopathic thrombocytopenic purpura in adults: focus on romiplostim and eltrombopag, Pharmacotherapy 30 (7) (2010) 666–683. [47] G. Cheng, Eltrombopag, a thrombopoietin- receptor agonist in the treatment of adult chronic immune thrombocytopenia: a review of the efficacy and safety profile, Therapeut. Adv. Hematol. 3 (3) (2012) 155–164. [48] K.P. Garnock-Jones, S.J. Keam, Eltrombopag. Drugs. 69 (5) (2009) 567–576. [49] L. Gorelik, R.A. Flavell, Transforming growth factor-beta in T-cell biology, Nat. Rev. Immunol. 2 (1) (2002) 46–53. [50] D.J. Kuter, D.M. Gminski, R.D. Rosenberg, Transforming growth factor beta inhibits megakaryocyte growth and endomitosis, Blood 79 (3) (1992) 619– 626. [51] M.B. Sporn, A.B. Roberts, L.M. Wakefield, R.K. Assoian, Transforming growth factor-beta: biological function and chemical structure, Science 233 (4763) (1986) 532–534.
M.-m. Qu et al. / Cytokine 92 (2017) 110–117 [52] S. Sakamaki, Y. Hirayama, T. Matsunaga, H. Kuroda, T. Kusakabe, T. Akiyama, Y. Konuma, K. Sasaki, N. Tsuji, T. Okamoto, M. Kobune, K. Kogawa, J. Kato, R. Takimoto, R. Koyama, Y. Niitsu, Transforming growth factor-beta1 (TGF-beta1) induces thrombopoietin from bone marrow stromal cells, which stimulates the expression of TGF-beta receptor on megakaryocytes and in turn, renders them susceptible to suppression by TGF-beta itself with high specificity, Blood 94 (6) (1999) 1961–1970. [53] O. Garraud, H. Hamzeh-Cognasse, F. Cognasse, Platelets and cytokines: how and why?, Transfusion clinique et biologique: journal de la Societe francaise de transfusion sanguine 19 (3) (2012) 104–108. [54] E.D. Hottz, A.P. Monteiro, F.A. Bozza, P.T. Bozza, Inflammasome in platelets: allying coagulation and inflammation in infectious and sterile diseases?, Mediators Inflamm 2015 (2015) 435783. [55] S. Lindemann, N.D. Tolley, D.A. Dixon, T.M. McIntyre, S.M. Prescott, G.A. Zimmerman, A.S. Weyrich, Activated platelets mediate inflammatory signaling by regulated interleukin 1beta synthesis, J. Cell Biol. 154 (3) (2001) 485–490.
117
[56] G. Soslau, D.A. Morgan, J.S. Jaffe, I. Brodsky, Y. Wang, Cytokine mRNA expression in human platelets and a megakaryocytic cell line and cytokine modulation of platelet function, Cytokine 9 (6) (1997) 405–411. [57] O. Allam, S. Samarani, R. Marzouk, A. Ahmad, Human platelets produce and constitute the main source of IL-18 in the circulation, J. Immunol. 188 (44) (2012) 25. [58] J.B. Bussel, D.J. Kuter, V. Pullarkat, R.M. Lyons, M. Guo, J.L. Nichol, Safety and efficacy of long-term treatment with romiplostim in thrombocytopenic patients with chronic ITP, Blood 113 (10) (2009) 2161–2171. [59] M.N. Saleh, J.B. Bussel, G. Cheng, O. Meyer, C.K. Bailey, M. Arning, A. BrainskyGroup ES, Safety and efficacy of eltrombopag for treatment of chronic immune thrombocytopenia: results of the long-term, open-label EXTEND study, Blood 121 (3) (2013) 537–545.
Contents lists available at ScienceDirect
Cytokine journal homepage: www.journals.elsevier.com/cytokine
Cytokine changes in response to TPO receptor agonist treatment in primary immune thrombocytopenia Ming-ming Qu a,1, Xue-na Liu a,1, Xin-guang Liu a,⇑,1, Qi Feng a, Yang Liu a, Xu Zhang a, Shuang Liu a,b, Lei Zhang c, Guo-sheng Li d, Yuan-yuan Zhu a, Ming-yun Lv e, Jun Peng a,f, Ming Hou f,⇑ a
Department of Hematology, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China Department of Hematology, Taian Central Hospital, Taian, PR China Department of Orthopedics, Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan, China d Shandong Provincial Key Laboratory of Immunohematology, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China e Reproductive Center, Rizhao Maternal & Child Health Hospital, Rizhao, PR China f Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital, Shandong University, 107 West Wenhua Road, Jinan, Shandong 250012, PR China b c
a r t i c l e
i n f o
Article history: Received 5 September 2016 Received in revised form 8 January 2017 Accepted 13 January 2017 Available online 29 January 2017 Keywords: Primary immune thrombocytopenia Cytokines T helper cells Thrombopoietin receptor agonists
a b s t r a c t Thrombopoietin receptor agonists (TPO-RAs) have been clinically used in primary immune thrombocytopenia (ITP) with favorable outcomes, while their effect on cytokine regulation in ITP remains unknown. In the present study, plasma and mRNA expression levels of interleukin (IL)-2, interferon gamma (IFN-c), IL-4, IL-17A, and transforming growth factor-b1 (TGF-b1) were determined by ELISA and real-time quantitative PCR in 26 corticosteroid-resistant/relapsed ITP patients receiving eltrombopag or rhTPO therapy and 15 healthy controls (HCs). Results showed that plasma and mRNA levels of IL-2, IFN-c, IL-4, and IL-17A in ITP patients did not change significantly after TPO-RA treatment, whereas TGF-b1 levels increased remarkably. The pre- and post-treatment plasma and mRNA levels of IFN-c and IL-2 were significantly higher, while the pre- and post-treatment IL-4 levels as well as the pre-treatment TGF-b1 levels were remarkably lower in ITP patients compared with HCs. There was no significant difference in TGF-b1 levels between TPO-RA-treated ITP patients and HCs. No statistical difference was found in plasma levels of IL-17A between ITP patients before or after treatment and HCs. However, the pre- and post-treatment mRNA expression of IL-17A and retinoic orphan receptor (ROR) ct in ITP patients were higher than that in HCs. Overall, these findings indicated that TPO-RA treatment could promote the secretion of TGF-b1, while it could not correct the Th1 and Th17 polarization in ITP patients. This study might improve our understanding of the mechanism of action of TPO-RAs and provide important information for optimizing therapeutic strategies for ITP. Ó 2017 Elsevier Ltd. All rights reserved.
1. Background Primary immune thrombocytopenia (ITP) is an acquired immune-mediated bleeding disorder characterized by autoantibody-mediated platelet destruction and impaired megakaryocyte maturation with reduced platelet production [1]. More recently, it has become obvious that ITP is a more complex disorder in which T cell abnormalities play important roles in platelet destruction [2–4]. Antiplatelet autoantibody production is under the control of T helper (Th) cells, and elevated antiplatelet ⇑ Corresponding authors. E-mail addresses: [email protected] (X.-g. Liu), [email protected] (M. Hou). 1 M.-M. Qu, X.-N. Liu, and X.-G. Liu contributed equally to this work. http://dx.doi.org/10.1016/j.cyto.2017.01.013 1043-4666/Ó 2017 Elsevier Ltd. All rights reserved.
T-cell reactivity in ITP has been observed [1,5–8]. Th cell polarization in ITP has been attributed to increased Th1 and Th17 cells, decreased Th2 cells, and reduced or impaired CD4+CD25+Foxp3+ regulatory T cells (Tregs) [9–11]. Moreover, enhanced cytotoxic T lymphocyte-mediated platelet destruction has been reported in ITP [5,12–14]. The precise reason for these abnormalities remains to be clarified. Thrombopoietin (TPO) is the principal hematopoietic cytokine that stimulates thrombopoiesis by activating the cell through TPO-receptor (TPO-R), c-MPL [15–17]. As insufficient TPO has been found to contribute to decreased platelet production in ITP [18,19], a series of thrombopoietic agents have been developed. Two types of TPO receptor agonists (TPO-RAs), eltrombopag and romiplostim, have been approved by the US Food and Drug Administration as
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
second-line options for the management of ITP [20–22]. In addition, recombinant human TPO (rhTPO) has been used for the treatment of corticosteroid-resistant and relapsed ITP patients in China [23,24]. A rapid response can often be achieved during TPO-RA treatment. Nevertheless, platelet counts usually return to pretreatment levels once the regimen is withdrawn, making it difficult to achieve a long-term drug-independent remission. TPO-R is mainly expressed by CD34+ cells, megakaryocytes, platelets, and several kinds of tumor cells. It has been demonstrated that peripheral blood lymphocytes do not express TPO-R [25]. Nevertheless, TPO-RAs have showed additional effect on regulation of different lymphocyte subsets in ITP. Bao et al. observed that improved activity of Tregs coincided with a remarkable decrease in effector T cell function in TPO-RA-treated ITP patients [26]. Number of regulatory B cells (Bregs) was also increased after TPO-RA treatment in ITP patients [27]. In addition, our recently published paper showed that the recovery of platelet counts after TPO-RA administration in ITP was associated with the restoration of FccR balance toward the inhibitory FccRIIb on monocytes [28]. These data indicate that TPO-RAs have profound effect on immune modulation besides their direct role in stimulating platelet production from megakaryocytes. Cytokine-mediated immunity plays an important role in the pathogenesis of various autoimmune disorders [29–32]. Aberrant cytokine profiles have been correlated with the loss of immune tolerance in ITP patients [8,33]. Moreover, response to different therapeutic strategies, such as high-dose dexamethasone, splenectomy, rituximab, and Helicobacter pylori eradication, is often associated with correction of the cytokine abnormalities in ITP [6,34–38]. Even though TPO-RAs have been used to treat ITP patients for several years, their roles in cytokine modulation remain largely unknown. To evaluate the effect of TPO-RAs on cytokine modulation in ITP, a total of 26 corticosteroid-resistant/relapsed chronic ITP patients receiving eltrombopag or rhTPO treatment were enrolled in the present study. Plasma concentrations and mRNA expression of interleukin (IL)-2, interferon gamma (IFN-c), IL-4, IL-17A, and transforming growth factor b1 (TGF-b1), as well as retinoic orphan receptor (ROR) ct mRNA levels in peripheral blood mononuclear cells (PBMCs) were determined, which might deepen our understanding about the mechanism of TPO-RAs in the treatment of ITP.
2. Materials and methods 2.1. Patients and controls A total of 26 corticosteroid-resistant/relapsed chronic ITP patients (15 females and 11 males; 22–84 years of age, median 51 years) were enrolled in this study between June 2013 and March 2015 at the Department of Hematology, Qilu Hospital, Shandong University, Jinan, China. The duration of ITP from the time of diagnosis ranged from 13 to 433 months. Patients were diagnosed according to the practice guidelines of the International Working Group on ITP [39]. All patients had a pre-treatment platelet count below 30 109/L (baseline platelet count ranged from 4 to 25 109/L, median 13 109/L; Table 1), and had relapsed or had been unresponsive to glucocorticosteroid therapy. Previous therapies, including rescue therapy, must have been completed at least 6 weeks prior to enrollment. Cases complicated with any of the following conditions were excluded: (1) thrombosis or use of thrombopoietic agents, (2) liver, kidney, cardiac, or pulmonary dysfunction, or (3) a clinical history of hepatitis B/C virus or human immunodeficiency virus infection. Pregnant or nursing female subjects were also excluded.
111
Fifteen healthy adult volunteers (9 females and 6 males; 20– 45 years of age, median 30 years) were recruited as controls. Platelet counts ranged from 165 to 325 109/L, with the median count of 209 109/L. This study was approved by the Medical Ethical Committee of Qilu Hospital, Shandong University. Informed consent was obtained from all patients and controls before enrollment in accordance with the Declaration of Helsinki. 2.2. Treatment regimen Eltrombopag (GlaxoSmithKline, Ware, UK) was administered orally with an initial dose of 25 mg once daily for 6 weeks. The dose could be increased to 50 or 75 mg once daily to maintain platelet counts P50 109/L. rhTPO (3SBIO, Shenyang, China) was administered subcutaneously at a daily dose of 300 U/kg initially. The dose frequencies could be adjusted to every other day once platelet counts ascended above 100 109/L. If response was not achieved after 2 weeks of rhTPO administration, patients were designated as non-responders and treatment was discontinued. To reduce the risk of thrombocytosis, eltrombopag or rhTPO therapy was stopped once platelet counts exceeded 250 109/L. The response was evaluated according to the following criteria: complete response (CR) was defined as a platelet count P100 109/L without bleeding; response (R) was defined as a platelet count between 30 and 100 109/L without bleeding, at least a doubling of the baseline counts; no response (NR) was defined as either a platelet count <30 109/L, less than doubling of the baseline platelet count, or bleeding. 2.3. Plasma and PBMC preparation Peripheral blood samples from all patients prior to TPO-RA therapy and healthy controls were obtained. For patients who achieved R, blood samples were collected 6 weeks after TPO-RA treatment. With regard to the non-responders, blood samples were obtained on the day of treatment discontinuation. Plasma was obtained by centrifugation and stored at 80 °C. PBMCs were isolated from the peripheral blood by gradient centrifugation (400g, 20 min) on Ficoll-Paque (HaoYang Biological Manufacture, Tianjin, China) and were stored in aliquots at 80 °C until RNA extraction. 2.4. IFN-c, IL-2, IL-4, IL-17A and TGF-b1 enzyme-linked immunosorbent assay Plasma levels of IL-2, IL-17A and TGF-b1 were measured by commercialized enzyme-linked immunosorbent assay (ELISA) kits following the manufacturer’s protocols (R&D systems, Minneapolis, MN, USA). The lower detection limits for IL-2, IL-17A and TGF-b1 were 7, 15 and 15.4 pg/mL, respectively. Plasma IFNc and IL-4 levels were also determined using a commercial ELISA (Sizhengbai, Beijing, China) according to manufacturer’s instructions. The lower detection limits for these 2 cytokines were both 2 pg/mL. 2.5. RNA isolation and quantitative real-time polymerase chain reaction analysis Total RNA was extracted from PBMCs by TRIzol (Takara Biotechnology, Inc, Japan). The amount of RNA was determined using the Nanophotometer P-class (Implen, Germany). cDNA was synthesized using the PrimeScript RT reagent kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, TGF-b1, RORct, and GAPDH (endogenous control) were quantified by real-time PCR using SYBR Green (Toy-
112
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
Table 1 ITP patient clinical characteristics.
+ # ##
Patient No.
Sex/Age (yr)
Disease duration, yr
Previous treatment
1# 2# 3# 4# 5# 6# 7# 8# 9# 10## 11## 12# 13# 14# 15# 16# 17# 18# 19# 20# 21# 22## 23## 24## 25## 26##
M/25 M/24 M/51 M/48 M/59 M/55 M/29 M/54 M/84 M/53 M/38 F/63 F/35 F/52 F/24 F/60 F/62 F/58 F/54 F/42 F/44 F/51 F/28 F/67 F/35 F/22
2+ 4+ 2+ 23+ 30+ 2+ 3+ 2+ 2+ 5+ 2+ 7+ 4+ 1+ 10+ 2+ 4+ 7+ 1+ 2+ 10+ 3+ 20+ 2+ 1+
Steroids, Steroids Steroids, Steroids, Steroids, Steroids, Steroids, Steroids Steroids, Steroids, Steroids, Steroids Steroids Steroids, Steroids, Steroids, Steroids Steroids, Steroids, Steroids Steroids, Steroids, Steroids, Steroids, Steroids Steroids
Platelet count ( 109/L)
VCR IVIg VCR, splenectomy IVIg, rituximab, VCR, splenectomy splenectomy rituximab IVIg IVIg rituximab
VCR IVIg herbs herbs IVIg, rituximab, splenectomy IVIg, rituximab, VCR herbs IVIg, VCR herbs
Pre-treatment
Post-treatment
13 12 8 4 13 21 25 19 7 11 5 12 18 17 8 21 9 19 22 17 6 18 8 13 6 23
112 5 25 167 15 59 62 247 37 10 96 15 22 105 50 71 124 51 69 57 104 85 51 29 135 95
Efficacy
R NR NR R NR R R R R NR R NR NR R R R R R R R R R R NR R R
Indicates more than. Indicates less than. Patients treated with eltrombopag. Patients treated with rhTPO; steroids included high-dose dexathemethasone, prednisone, or methylprednisolone; IVIg, intravenous immunoglobulin; VCR, vincristine.
obo, Osaka, Japan) as a double-stranded DNA-specific binding dye on a LightCyclerÒ 480II (Roche, Germany). All primers were intron spanning. Primer sequences are listed in Table 2. PCR was performed with denaturation at 95 °C for 5 min, followed by 40 cycles of: denaturation at 95 °C for 15 s, annealing at 62 or 65 °C for 15 s, and extension at 72 °C for 40 s. LightCyclerÒ 480II software release 1.5.0 SP4 Version 1.5.0.39 (Roche, Germany) was used to determine the cycle numbers at which fluorescence emission crossed the automatically determined Ct value. Relative expression levels of the target genes in each sample were analyzed using the 2DDCT method. 2.6. Statistical analysis Data are presented as mean ± SD. The statistical significance among different groups was determined by an analysis of variance, and the differences between two independent groups were evaluated using a Student-Newman-Keuls test, unless the data were not normally distributed, in which case the Mann-Whitney U test was used. Differences between pre- and post-treatment groups were determined by a paired Student’s t test. All tests were performed by SPSS19.0. P values < 0.05 were considered statistically significant. 3. Results 3.1. Efficacy and safety of TPO-RAs Platelet counts at baseline and after eltrombopag or rhTPO treatment are shown in Table 1. Response was achieved in 19 (73.08%) patients, including 7 with CR (26.92%). NR was found in 7 (26.92%) of the 26 patients. Two patients received platelet transfusions during the study (both are because the platelets <10 109/ L at the first two weeks during the eltrombopag treatment).
Eltrombopag and rhTPO therapy were well tolerated in most patients. Liver transaminase increased transiently in 3 patients (2 treated with eltrombopag, 1 with rhTPO) and returned to normal levels after liver-protecting therapy. Four patients reported headaches (3 with eltrombopag, 1 with rhTPO), two patients fatigue (1 with eltrombopag, 1 with rhTPO), and two patients reported nausea and diarrhea (1 with eltrombopag, 1 with rhTPO). 3.2. Cytokine profile in plasma after TPO-RA treatment As is shown in Fig. 1, plasma concentrations of IL-2 and IFN-c were significantly higher in untreated ITP patients than in healthy controls (HCs) (IL-2: 34.27 ± 10.18 vs. 11.33 ± 4.95 pg/mL, P < 0.001; IFN-c: 63.33 ± 10.64 vs. 36.31 ± 9.25 pg/mL, P < 0.001). By contrast, plasma IL-4 and TGF-b1 levels were lower in untreated ITP patients than in HCs (IL-4: 8.82 ± 1.85 vs. 17.90 ± 2.48 pg/mL, P < 0.001; TGF-b1: 1691.27 ± 706.33 vs. 2666.00 ± 1014.88 pg/mL, P = 0.001), confirming a Th1 dominant state in ITP. Consistent with our previous reports [40,41], no statistically significant difference was found in plasma IL-17A levels between untreated ITP patients and HCs (16.48 ± 2.24 vs. 15.64 ± 1.88 pg/mL, P = 0.229). The post-treatment levels of IL-2, IFN-c, IL-4, IL-17A and TGF-b1 in ITP patients were determined to evaluate the potential role of TPO-RAs on Th cell regulation. We did not observe any significant change in plasma IL-2, IFN-c, IL-4, or IL-17A levels after TPO-RA treatment (IL-2: 31.84 ± 10.06 vs. 34.27 ± 10.18 pg/mL, P = 0.346; IFN-c: 64.30 ± 15.27 vs. 63.33 ± 10.64 pg/mL, P = 0.731; IL-4: 9.11 ± 2.07 vs. 8.82 ± 1.85 pg/mL, P = 0.617; IL-17A: 16.66 ± 2.17 vs. 16.48 ± 2.24 pg/mL, P = 0.756), whereas plasma levels of TGF-b1 increased significantly (2336.50 ± 893.17 vs. 1691.27 ± 706.33 pg/mL, P = 0.008). Compared with HCs, plasma IL-2 and IFN-c were higher, while IL-4 was lower in TPO-RAtreated ITP patients (IL-2: 31.84 ± 10.06 vs. 11.33 ± 4.95 pg/mL, P < 0.001; IFN-c: 64.30 ± 15.27 vs. 36.31 ± 9.25 pg/mL, P < 0.001;
113
M.-m. Qu et al. / Cytokine 92 (2017) 110–117 Table 2 Primers and conditions for real-time quantitative PCR. Gene
IL-2 IL-4 IFN-c IL-17A RORct TGF-b1 GAPDH
Primers sequence (50 ? 30 ) Forward
Reverse
GAATGGAATTAATAATTACAAGAATCCC AGCAGTTCCACAGGCACAAG TTGGCTTAATTCTCTCGGAAACG GGAATCTCCACCGCAATGAG CTCAAAGCAGGAGCAATGGAA GAAGTGGATCCACGAGCCCAAG GCACCGTCAAGGCTGAGAAC
TGTTTCAGATCCCTTTAGTTCCAG TACTCTGGTTGGCTTCCTTCAC CGCTACATCTGAATGACCTGC ACACCAGTATCTTCTCCAGGC AGGGAGTGGGAGAAGTCAAAGA GCTGCACTTGCAGGAGCGCAC TGGTGAAGACGCCAGTGGA
Annealing temperature (°C)
Product length (bp)
62 62 62 65 62 62 65/62
229 112 161 202 164 247 138
Fig. 1. Plasma cytokine profiles in untreated ITP patients, patients after TPO-RA treatment, and healthy controls. (A, B, C, E) Higher plasma IL-2, IFN-c levels, and lower IL-4 and TGF-b1 levels were detected in ITP patients both pre- and post-treatment compared to healthy controls. (D) No statistical difference was observed in plasma IL-17A levels among ITP patients and healthy controls. Plasma IL-2, IFN-c, IL-4, and IL-17A did not significantly change after TPO-RA administration. Whereas plasma levels of TGF-b1 increased significantly. All samples were tested in duplicate. Bars represent means ± SD.
IL-4: 9.11 ± 2.07 vs. 17.90 ± 2.48 pg/mL, P < 0.001). In addition, plasma concentrations of IL-17A and TGF-b1 were not statistically different between TPO-RA-treated ITP patients and healthy controls (IL-17A, 16.66 ± 2.17 vs. 15.64 ± 1.88 pg/mL, P = 0.143; TGFb1, 2336.50 ± 893.17 vs. 2666.00 ± 1014.88 pg/mL, P = 0.239; Fig. 1). 3.3. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, TGF-b1 and RORct To further evaluate the effect of TPO-RAs on cytokine modulation, mRNA expression levels of IL-2, IFN-c, IL-4, IL-17A, TGF-b1 and RORct in PBMCs from ITP patients and HCs were determined by real-time PCR. As is shown in Fig. 2, significantly higher IL-2, IFN-c, IL-17A, and RORct together with remarkably lower IL-4 and TGF-b1 mRNA levels were found in untreated ITP patients compared with HCs (IL-2, P = 0.012; IFN-c, P = 0.015; IL-17A, P = 0.001; RORct, P = 0.012; IL-4, P < 0.001; and TGF-b1, P = 0.042, respectively). Consistent with the plasma cytokine findings, there
was no significant change in mRNA expression levels of IL-2, IFN-
c, IL-4, IL-17A, and RORct in PBMCs (P > 0.05), whereas mRNA expression level of TGF-b1 increased significantly (P = 0.039) after TPO-RA treatment. Furthermore, mRNA expression levels of IL17A and RORct in TPO-RA-treated ITP patients were considerably higher than in HCs (P = 0.006 and P = 0.042, respectively). 3.4. Correlation between cytokine changes and platelet response to TPO-RAs To evaluate whether response to TPO-RAs was correlated with cytokine modulation, changes in plasma protein and mRNA expression levels of IL-2, IFN-c, IL-4, and IL-17A in TPO-RA responders and non-responders were analyzed independently. There was no significant change in plasma IL-2, IFN-c, IL-4, and IL-17A levels in TPO-RA responders compared with their pre-treatment levels (IL-2: 35.21 ± 11.08 pg/mL vs. 32.87 ± 10.92 pg/mL, P = 0.277; IFNc: 64.06 ± 11.59 pg/mL vs. 64.52 ± 11.07 pg/mL, P = 0.783; IL-4:
114
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
tration increased significantly in TPO-RA responders (1691.27 ± 706.33 vs. 2561.53 ± 882.24 pg/ml; P < 0.01), but we did not observe any significant change in non-responders after TPO-RA treatment (1633.86 ± 634.43 vs. 1725.71 ± 627.19 pg/ml; P = 0.647; Fig. 3). Further analysis revealed that mRNA levels of IL-2, IFN-c, IL-4, IL-17A, and RORct did not change significantly in either responders or non-responders after TPO-RA treatment (all P > 0.05). With regard to TGF-b1 mRNA, its expression level increased considerably in responders after TPO-RA treatment (P = 0.027), but no statistical change in TGF-b1 mRNA level was found in non-responders (P > 0.05; Fig. 4). 4. Discussion Fig. 2. mRNA expression of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 in PBMCs. Significantly higher mRNA expression of IL-2, IFN-c, IL-17A, RORct, and lower IL-4 was found in ITP patients both pre- and post-treatment compared to healthy controls. There was no significant difference in mRNA levels of IL-2, IFN-c, IL-4, IL-17A, and RORC between untreated and TPO-RA-treated patients. mRNA level of TGF-b1 in ITP patients decreased significantly after TPO-RA treatment. Bars represent means ± SD.
8.82 ± 1.82 pg/mL vs. 9.31 ± 2.22 pg/mL, P = 0.316; IL-17A: 16.54 ± 2.11 pg/mL vs. 16.65 ± 2.10 pg/mL, P = 0.670), neither was there in TPO-RA non-responders (IL-2: 31.72 ± 7.26 pg/mL vs. 29.05 ± 7.19 pg/mL, P = 0.358; IFN-c: 61.35 ± 7.93 pg/mL vs. 63.69 ± 7.44 pg/mL, P = 0.219; IL-4: 8.80 ± 2.09 pg/mL vs. 8.54 ± 1.57 pg/mL, P = 0.758; IL-17A: 16.31 ± 2.74 pg/mL vs. 16.69 ± 2.54 pg/mL, P = 0.521). By contrast, plasma TGF-b1 concen-
Cytokines exert a crucial role in maintaining self-tolerance [42]. Aberrant cytokine profiles have been implicated in the pathogenesis of many autoimmune disorders [41,43,44]. It has been well established that active ITP patients exhibit significantly higher Th1/Th2 ratios [2,3,7,33]. Moreover, Th1/Th2 ratios negatively correlated with platelet counts in ITP patients [8]. Consistent with these reports, our data showed that plasma protein and PBMC mRNA of IFN-c and IL-2 levels were increased, whereas IL-4 levels were decreased in ITP patients compared to healthy controls. Our findings further confirm the Th1 dominance in ITP. Th17 cells are another subset of T cells that has been linked to the development of ITP [9,11,45]. Our previous studies have demonstrated that Th17 cells and their lineage-specific transcription factor RORct increased considerably in ITP patients [40]. In line with those observations, we found that mRNA expression of IL-17A and RORct was significantly higher in ITP patients than in
Fig. 3. Plasma IL-2, IFN-c, IL-4, IL-17A and TGF-b1 in responders and non-responders before and after TPO-RA treatment. (A, B, C, D) Plasma levels of IL-2, IFN-c, IL-4 and IL17A did not change significantly after TPO-RA treatment in either responders or non-responders. Plasma TGF-b1 concentrations significantly increased in TPO-RA responders, while no significant changes were observed in non-responders. All samples were tested in duplicate. Bars represent means ± SD.
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
Fig. 4. Relative mRNA expression of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 in patients before and after TPO-RA treatment. (A) Relative mRNA levels of IL-2, IFN-c, IL-4, IL-17A, RORct did not change significantly in responders after TPO-RA treatment, whereas relative mRNA levels of TGF-b1 increased significantly in responders. (B) Relative mRNA levels of IL-2, IFN-c, IL-4, IL-17A, RORct and TGF-b1 did not change significantly in non-responders after TPO-RA treatment. Bars represent means ± SD.
healthy controls. Additionally, plasma IL-17A was slightly higher in ITP patients than in healthy controls, though not statistically significant. In ITP patients, response to a range of therapeutic strategies is often accompanied by correction of the aberrant cytokine profiles. High-dose dexamethasone rectified Th1 dominance and restored Th17/Treg balance in ITP [34,35]. Stasi and colleagues also observed that rituximab therapy restored the aberrant Th1/Th2 ratio in ITP responders [38]. In addition, correction of the abnormal cytokine profiles by other therapeutic regimens, such as splenectomy and Helicobacter pylori eradication, has also been reported in ITP [33,36,37]. Together, these observations suggest that restoring a balanced cytokine network strongly contributes to response to different therapeutic regimens. TPO-RAs have recently been used for the management of ITP with relatively high effectiveness [46]. Besides their direct role in stimulating platelet production from megakaryocytes, TPO-RAs have demonstrated additional effects on immunoregulation [47,48]. It has been reported that Treg and Breg activity was enhanced remarkably in TPO-RA-treated ITP patients [26,27]. We previously observed a shift in the balance of Fcc receptors (FccRs) toward the inhibitory FccRIIb on monocytes after TPO-RA treatment [28]. The improvement in Treg activity and restoration of FccR balance in TPO-RA-treated ITP patients could be largely attributed to the enhanced release of transforming growth factor b1 (TGF-b1) [26,28], as a result of greater platelet turnover. Our
115
present data also showed that plasma levels of TGF-b1 increased significantly after TPO-RA administration. TGF-b1 is a multifunctional cytokine which regulates a great diversity of different cell activity. Its receptors, known as TbR1 and TbR2, are also expressed on megakaryocytes. Several independent research groups demonstrated that TGF-b1 suppressed the development of megakaryocyte colony-forming units (CFU-Meg) in a dose-dependent manner [49– 51], and the suppression of TGF-b1 on CFU-Meg development was rather stage-specific, with no effect on primitive stem cells, resulting in a maturational arrest of megakaryopoiesis [52]. Interestingly, TPO was able to upregulate TbR1 and TbR2 expression on megakaryoblasts at the midmegakaryopoietic period, a stage when TGF-b1 was able to arrest the maturation of CFU-Meg [52]. Therefore, TGF-b1 is generally considered as a negative feed-back regulator of megakaryopoiesis, and there seems to be no sufficient evidence to support the role of TGF-b1 in promoting thrombopoiesis. By contrast, the immunoregulatory effect of TGF-b1 on T cells and monocytes might help to restore the immune tolerance and decrease platelet destruction in ITP. Taking into account the enormous heterogeneity and complexity of ITP pathogenesis, the precise role of TGF-b1 in ITP still awaits further investigation. It is noteworthy that other inflammatory cytokines, including IL-6, IL-18, tumor necrosis factors a (TNF-a), and IL-7, could also be secreted by platelets and megakaryocytes [53–57]. Based on these observations, we evaluated the effect of TPO-RAs on modulation of cytokine profiles in ITP. However, our present data did not show any statistical significance in plasma and mRNA expression levels of IFN-c, IL-2, IL-4, and IL-17A after TPO-RA administration, regardless of the response to treatment. Plasma protein and PBMC mRNA expression levels of IFN-c, IL-2, as well as IL-17A and RORct mRNA levels were still higher in post-treatment ITP patients than in healthy controls. In addition, plasma and mRNA levels of IL-4, the effector cytokine of Th2 cells, were considerably lower in post-treatment ITP patients compared with healthy controls. These data indicated that TPO-RA monotherapy did not correct the Th1 and Th17 polarization in ITP, which might account for the high rates of rapid relapse after discontinuation of TPO-RA therapy [23,58,59]. Taking together, TPO-RAs promoted the elevation of platelet counts effectively and were well tolerated in corticosteroidresistant and relapsed ITP patients. However, monotherapy of TPO-RAs did not correct the aberrant cytokine profiles. Despite a longitudinal study should be conducted to further examine these findings, our present data provide important clues to treatment strategy optimization for patients with ITP.
Competing interests The authors have no competing financial interests to declare.
Funding This work was supported by grants from National Natural Science Foundation of China (No. 81570103, No. 30600680). References [1] R. McMillan, Antiplatelet antibodies in chronic immune thrombocytopenia and their role in platelet destruction and defective platelet production, Hematol. Oncol. Clin. North Am. 23 (6) (2009) 1163–1175. [2] J.W. Semple, J. Freedman, Cellular immune mechanisms in chronic autoimmune thrombocytopenic purpura (ATP), Autoimmunity 13 (4) (1992) 311–319. [3] J.W. Semple, A.H. Lazarus, J. Freedman, The cellular immunology associated with autoimmune thrombocytopenic purpura: an update, Transfus. Sci. 19 (3) (1998) 245–251.
116
M.-m. Qu et al. / Cytokine 92 (2017) 110–117
[4] M. Kuwana, J. Kaburaki, Y. Ikeda, Autoreactive T cells to platelet GPIIb-IIIa in immune thrombocytopenic purpura. Role in production of anti-platelet autoantibody, J. Clin. Invest. 102 (7) (1998) 1393–1402. [5] B. Olsson, P.O. Andersson, M. Jernas, S. Jacobsson, B. Carlsson, L.M. Carlsson, H. Wadenvik, T-cell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura, Nat. Med. 9 (9) (2003) 1123–1124. [6] J. Peng, C. Liu, D. Liu, C. Ren, W. Li, Z. Wang, N. Xing, C. Xu, X. Chen, C. Ji, M. Zhang, M. Hou, Effects of B7-blocking agent and/or CsA on induction of platelet-specific T-cell anergy in chronic autoimmune thrombocytopenic purpura, Blood 101 (7) (2003) 2721–2726. [7] J.W. Semple, J. Freedman, Increased antiplatelet T helper lymphocyte reactivity in patients with autoimmune thrombocytopenia, Blood 78 (10) (1991) 2619– 2625. [8] J.W. Semple, Y. Milev, D. Cosgrave, M. Mody, A. Hornstein, V. Blanchette, J. Freedman, Differences in serum cytokine levels in acute and chronic autoimmune thrombocytopenic purpura: relationship to platelet phenotype and antiplatelet T-cell reactivity, Blood 87 (10) (1996) 4245–4254. [9] L. Ji, Y. Zhan, F. Hua, F. Li, S. Zou, W. Wang, D. Song, Z. Min, H. Chen, Y. Cheng, The ratio of Treg/Th17 cells correlates with the disease activity of primary immune thrombocytopenia, PLoS ONE 7 (12) (2012) e50909. [10] H. Ogawara, H. Handa, K. Morita, M. Hayakawa, J. Kojima, H. Amagai, Y. Tsumita, Y. Kaneko, N. Tsukamoto, Y. Nojima, H. Murakami, High Th1/Th2 ratio in patients with chronic idiopathic thrombocytopenic purpura, Eur. J. Haematol. 71 (4) (2003) 283–288. [11] S. Liu, Y.Z. Xiong, T. Li, Y. Li, S.Q. Gu, Y.M. Wang, K.H. Zhang, M. Hou, X.G. Liu, Interleukin-17A and -17F gene polymorphisms in chinese population with chronic immune thrombocytopenia, Ann. Clin. Lab. Sci. 46 (3) (2016) 291–297. [12] L. Chow, R. Aslam, E.R. Speck, M. Kim, N. Cridland, M.L. Webster, P. Chen, K. Sahib, H. Ni, A.H. Lazarus, M.B. Garvey, J. Freedman, J.W. Semple, A murine model of severe immune thrombocytopenia is induced by antibody- and CD8+ T cell-mediated responses that are differentially sensitive to therapy, Blood 115 (6) (2010) 1247–1253. [13] S. Audia, M. Samson, M. Mahevas, C. Ferrand, M. Trad, M. Ciudad, A. Gautheron, F. Seaphanh, V. Leguy, S. Berthier, B. Salles, L. Martin, B. Lorcerie, P. OrtegaDeballon, O. Facy, D. Caillot, et al., Preferential splenic CD8(+) T-cell activation in rituximab-nonresponder patients with immune thrombocytopenia, Blood 122 (14) (2013) 2477–2486. [14] L. Guo, L. Yang, E.R. Speck, R. Aslam, M. Kim, C.G. McKenzie, A.H. Lazarus, H. Ni, M. Hou, J. Freedman, J.W. Semple, Allogeneic platelet transfusions prevent murine T-cell-mediated immune thrombocytopenia, Blood 123 (3) (2014) 422–427. [15] T.D. Bartley, J. Bogenberger, P. Hunt, Y.S. Li, H.S. Lu, F. Martin, M.S. Chang, B. Samal, J.L. Nichol, S. Swift, et al., Identification and cloning of a megakaryocyte growth and development factor that is a ligand for the cytokine receptor Mpl, Cell 77 (7) (1994) 1117–1124. [16] F.J. de Sauvage, P.E. Hass, S.D. Spencer, B.E. Malloy, A.L. Gurney, S.A. Spencer, W.C. Darbonne, W.J. Henzel, S.C. Wong, W.J. Kuang, et al., Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand, Nature 369 (6481) (1994) 533–538. [17] K. Kaushansky, S. Lok, R.D. Holly, V.C. Broudy, N. Lin, M.C. Bailey, J.W. Forstrom, M.M. Buddle, P.J. Oort, F.S. Hagen, et al., Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin, Nature 369 (6481) (1994) 568–571. [18] R.S. Makar, O.S. Zhukov, M.A. Sahud, D.J. Kuter, Thrombopoietin levels in patients with disorders of platelet production: diagnostic potential and utility in predicting response to TPO receptor agonists, Am. J. Hematol. 88 (12) (2013) 1041–1044. [19] R.V. Emmons, D.M. Reid, R.L. Cohen, G. Meng, N.S. Young, C.E. Dunbar, N.R. Shulman, Human thrombopoietin levels are high when thrombocytopenia is due to megakaryocyte deficiency and low when due to increased platelet destruction, Blood 87 (10) (1996) 4068–4071. [20] C. Neunert, W. Lim, M. Crowther, A. Cohen, L. Solberg, M.A. Crowther Jr. American Society of H, The American Society of Hematology 2011 evidencebased practice guideline for immune thrombocytopenia, Blood 117 (16) (2011) 4190–4207. [21] J.B. Bussel, D. Provan, T. Shamsi, G. Cheng, B. Psaila, L. Kovaleva, A. Salama, J.M. Jenkins, D. Roychowdhury, B. Mayer, N. Stone, M. Arning, Effect of eltrombopag on platelet counts and bleeding during treatment of chronic idiopathic thrombocytopenic purpura: a randomised, double-blind, placebo-controlled trial, Lancet 373 (9664) (2009) 641–648. [22] D.J. Kuter, J.B. Bussel, R.M. Lyons, V. Pullarkat, T.B. Gernsheimer, F.M. Senecal, L.M. Aledort, J.N. George, C.M. Kessler, M.A. Sanz, H.A. Liebman, F.T. Slovick, J.T. de Wolf, E. Bourgeois, T.H. Guthrie Jr., A. Newland, et al., Efficacy of romiplostim in patients with chronic immune thrombocytopenic purpura: a double-blind randomised controlled trial, Lancet 371 (9610) (2008) 395–403. [23] Z.G. Cui, X.G. Liu, P. Qin, M. Hou, S.L. Wu, J. Peng, H.G. Zhao, H.Y. Wang, C.T. Zhao, Recombinant human thrombopoietin in combination with cyclosporin A as a novel therapy in corticosteroid-resistant primary immune thrombocytopenia, Chin. Med. J. 126 (21) (2013) 4145–4148. [24] Y.Q. Zhao, Q.Y. Wang, M. Zhai, J. Xu, X.Q. Chen, W.L. Liu, M. Zhang, S.J. Song, J.M. Wang, F.Y. Meng, Y.D. Shan, A multi-center clinical trial of recombinant human thrombopoietin in chronic refractory idiopathic thrombocytopenic purpura, Zhonghua nei ke za zhi 43 (8) (2004) 608–610. [25] K. Kaushansky, Thrombopoietin and hematopoietic stem cell development, Ann. N. Y. Acad. Sci. 872 (1999) 314–319.
[26] W. Bao, J.B. Bussel, S. Heck, W. He, M. Karpoff, N. Boulad, K. Yazdanbakhsh, Improved regulatory T-cell activity in patients with chronic immune thrombocytopenia treated with thrombopoietic agents, Blood 116 (22) (2010) 4639–4645. [27] X. Li, H. Zhong, W. Bao, N. Boulad, J. Evangelista, M.A. Haider, J. Bussel, K. Yazdanbakhsh, Defective regulatory B-cell compartment in patients with immune thrombocytopenia, Blood 120 (16) (2012) 3318–3325. [28] X.G. Liu, S. Liu, Q. Feng, X.N. Liu, G.S. Li, Z. Sheng, P. Chen, Y. Liu, Y. Wei, X.Y. Dong, P. Qin, C. Gao, C. Ma, L. Zhang, M. Hou, J. Peng, Thrombopoietin receptor agonists shift the balance of Fcgamma receptors towards inhibitory receptor IIb on monocytes in ITP, Blood (2016). [29] L.E. Ballantine, J. Ong, A. Midgley, L. Watson, B.F. Flanagan, M.W. Beresford, The pro-inflammatory potential of T cells in juvenile-onset systemic lupus erythematosus, Pediat. Rheumatol. Online J. 12 (2014) 4. [30] E. Lubberts, IL-17/Th17 targeting: on the road to prevent chronic destructive arthritis?, Cytokine 41 (2) (2008) 84–91 [31] C. Qian, T. Jiang, W. Zhang, C. Ren, Q. Wang, Q. Qin, J. Chen, A. Deng, R. Zhong, Increased IL-23 and IL-17 expression by peripheral blood cells of patients with primary biliary cirrhosis, Cytokine 64 (1) (2013) 172–180. [32] D.M. Roeleveld, A.E. van Nieuwenhuijze, W.B. van den Berg, M.I. Koenders, The Th17 pathway as a therapeutic target in rheumatoid arthritis and other autoimmune and inflammatory disorders, BioDrugs: Clin. Immunother., Biopharma. Gene Ther. 27 (5) (2013) 439–452. [33] F.P. Panitsas, M. Theodoropoulou, A. Kouraklis, M. Karakantza, G.L. Theodorou, N.C. Zoumbos, A. Maniatis, A. Mouzaki, Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response, Blood 103 (7) (2004) 2645–2647. [34] C. Guo, X. Chu, Y. Shi, W. He, L. Li, L. Wang, Y. Wang, J. Peng, M. Hou, Correction of Th1-dominant cytokine profiles by high-dose dexamethasone in patients with chronic idiopathic thrombocytopenic purpura, J. Clin. Immunol. 27 (6) (2007) 557–562. [35] Y. Ling, X. Cao, Z. Yu, C. Ruan, Circulating dendritic cells subsets and CD4 +Foxp3+ regulatory T cells in adult patients with chronic ITP before and after treatment with high-dose dexamethasome, Eur. J. Haematol. 79 (4) (2007) 310–316. [36] F.P. Panitsas, A. Mouzaki, Effect of splenectomy on type-1/type-2 cytokine gene expression in a patient with adult idiopathic thrombocytopenic purpura (ITP), BMC Blood Disorders 4 (1) (2004) 4. [37] A.M. Rocha, C. Souza, F.F. Melo, N.C. Clementino, M.C. Marino, G.A. Rocha, D.M. Queiroz, Cytokine profile of patients with chronic immune thrombocytopenia affects platelet count recovery after Helicobacter pylori eradication, Br. J. Haematol. 168 (3) (2015) 421–428. [38] R. Stasi, N. Cooper, G. Del Poeta, E. Stipa, M. Laura Evangelista, E. Abruzzese, S. Amadori, Analysis of regulatory T-cell changes in patients with idiopathic thrombocytopenic purpura receiving B cell-depleting therapy with rituximab, Blood 112 (4) (2008) 1147–1150. [39] F. Rodeghiero, R. Stasi, T. Gernsheimer, M. Michel, D. Provan, D.M. Arnold, J.B. Bussel, D.B. Cines, B.H. Chong, N. Cooper, B. Godeau, K. Lechner, M.G. Mazzucconi, R. McMillan, M.A. Sanz, P. Imbach, et al., Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group, Blood 113 (11) (2009) 2386–2393. [40] X.G. Liu, J. Ren, Y. Yu, L. Sun, Y. Shi, P. Qin, L. Yang, S.H. Ma, X.Y. Dong, D.X. Ma, X. Qu, C.S. Guo, C.Y. Chen, M. Hou, J. Peng, Decreased expression of interleukin27 in immune thrombocytopenia, Br. J. Haematol. 153 (2) (2011) 259–267. [41] D. Ma, X. Zhu, P. Zhao, C. Zhao, X. Li, Y. Zhu, L. Li, J. Sun, J. Peng, C. Ji, M. Hou, Profile of Th17 cytokines (IL-17, TGF-beta, IL-6) and Th1 cytokine (IFNgamma) in patients with immune thrombocytopenic purpura, Ann. Hematol. 87 (11) (2008) 899–904. [42] S.R. Holdsworth, P.Y. Gan, Cytokines: names and numbers you should care about, Clin. J. Am. Soc. Nephrol.: CJASN 10 (12) (2015) 2243–2254. [43] P.O. Andersson, A. Olsson, H. Wadenvik, Reduced transforming growth factorbeta1 production by mononuclear cells from patients with active chronic idiopathic thrombocytopenic purpura, Br. J. Haematol. 116 (4) (2002) 862– 867. [44] C.K. Wong, C.Y. Ho, E.K. Li, C.W. Lam, Elevation of proinflammatory cytokine (IL-18, IL-17, IL-12) and Th2 cytokine (IL-4) concentrations in patients with systemic lupus erythematosus, Lupus 9 (8) (2000) 589–593. [45] J. Zhang, D. Ma, X. Zhu, X. Qu, C. Ji, M. Hou, Elevated profile of Th17, Th1 and Tc1 cells in patients with immune thrombocytopenic purpura, Haematologica 94 (9) (2009) 1326–1329. [46] J.D. Chouhan, J.D. Herrington, Treatment options for chronic refractory idiopathic thrombocytopenic purpura in adults: focus on romiplostim and eltrombopag, Pharmacotherapy 30 (7) (2010) 666–683. [47] G. Cheng, Eltrombopag, a thrombopoietin- receptor agonist in the treatment of adult chronic immune thrombocytopenia: a review of the efficacy and safety profile, Therapeut. Adv. Hematol. 3 (3) (2012) 155–164. [48] K.P. Garnock-Jones, S.J. Keam, Eltrombopag. Drugs. 69 (5) (2009) 567–576. [49] L. Gorelik, R.A. Flavell, Transforming growth factor-beta in T-cell biology, Nat. Rev. Immunol. 2 (1) (2002) 46–53. [50] D.J. Kuter, D.M. Gminski, R.D. Rosenberg, Transforming growth factor beta inhibits megakaryocyte growth and endomitosis, Blood 79 (3) (1992) 619– 626. [51] M.B. Sporn, A.B. Roberts, L.M. Wakefield, R.K. Assoian, Transforming growth factor-beta: biological function and chemical structure, Science 233 (4763) (1986) 532–534.
M.-m. Qu et al. / Cytokine 92 (2017) 110–117 [52] S. Sakamaki, Y. Hirayama, T. Matsunaga, H. Kuroda, T. Kusakabe, T. Akiyama, Y. Konuma, K. Sasaki, N. Tsuji, T. Okamoto, M. Kobune, K. Kogawa, J. Kato, R. Takimoto, R. Koyama, Y. Niitsu, Transforming growth factor-beta1 (TGF-beta1) induces thrombopoietin from bone marrow stromal cells, which stimulates the expression of TGF-beta receptor on megakaryocytes and in turn, renders them susceptible to suppression by TGF-beta itself with high specificity, Blood 94 (6) (1999) 1961–1970. [53] O. Garraud, H. Hamzeh-Cognasse, F. Cognasse, Platelets and cytokines: how and why?, Transfusion clinique et biologique: journal de la Societe francaise de transfusion sanguine 19 (3) (2012) 104–108. [54] E.D. Hottz, A.P. Monteiro, F.A. Bozza, P.T. Bozza, Inflammasome in platelets: allying coagulation and inflammation in infectious and sterile diseases?, Mediators Inflamm 2015 (2015) 435783. [55] S. Lindemann, N.D. Tolley, D.A. Dixon, T.M. McIntyre, S.M. Prescott, G.A. Zimmerman, A.S. Weyrich, Activated platelets mediate inflammatory signaling by regulated interleukin 1beta synthesis, J. Cell Biol. 154 (3) (2001) 485–490.
117
[56] G. Soslau, D.A. Morgan, J.S. Jaffe, I. Brodsky, Y. Wang, Cytokine mRNA expression in human platelets and a megakaryocytic cell line and cytokine modulation of platelet function, Cytokine 9 (6) (1997) 405–411. [57] O. Allam, S. Samarani, R. Marzouk, A. Ahmad, Human platelets produce and constitute the main source of IL-18 in the circulation, J. Immunol. 188 (44) (2012) 25. [58] J.B. Bussel, D.J. Kuter, V. Pullarkat, R.M. Lyons, M. Guo, J.L. Nichol, Safety and efficacy of long-term treatment with romiplostim in thrombocytopenic patients with chronic ITP, Blood 113 (10) (2009) 2161–2171. [59] M.N. Saleh, J.B. Bussel, G. Cheng, O. Meyer, C.K. Bailey, M. Arning, A. BrainskyGroup ES, Safety and efficacy of eltrombopag for treatment of chronic immune thrombocytopenia: results of the long-term, open-label EXTEND study, Blood 121 (3) (2013) 537–545.