Cytokine mRNA expression pattern in horses with large intestinal disease

Research in Veterinary Science 2002, 72, 177±185 doi:10.1053/rvsc.2001.0529, available online at http://www.idealibrary.com on

Cytokine mRNA expression pattern in horses with large intestinal disease A. J. DAVIDSON, G. B. EDWARDS, C. J. PROUDMAN, P. J. CRIPPS, J. B. MATTHEWS* Department of Veterinary Clinical Science and Animal Husbandry, Faculty of Veterinary Science, University of Liverpool, South Wirral CH64 7TE, UK SUMMARY The aim of this study was to investigate cytokine expression patterns in the large intestinal mucosa of horses, particularly in diseases associated with inflammation. Many cases of equine colitis remain without a definitive diagnosis and survival rates are poor. In humans, colitis is associated with increased expression of pro-inflammatory cytokines. To examine if similar responses occur in horses, we investigated IL-2, IL-4, IL-5, IL-10, TNFa, IFNg and TGFb messenger RNA expression in large intestinal mucosa. Samples were obtained from animals with large intestinal disease (n ˆ 15) or from horses which had different levels of cyathostomin infection (n ˆ 9) and analysed by reverse transcription-polymerase chain reaction. IL-2 was detected at all sites, whilst IL-4 was detected at all but one site. The presence of IL-10, IL-5, IFNg and TGFb varied with no significant differences amongst groups (P > 0
4). Detection of TNFa was significantly different between the group of horses that had infiltrative inflammatory bowel disease and those with larval cyathostominosis (P ˆ 0
028) and those that were helminth negative (P ˆ 0
014). These results indicate a possible role for TNFa in the pathogenesis of equine infiltrative inflammatory bowel disease. # 2002 Published by Elsevier Science Ltd.

COLITIS is a significant cause of disease in horses, yet little is known of the mechanisms that initiate and exacerbate large intestinal inflammation. Often, the underlying aetiology is not ascertained and a definitive diagnosis is reached in only 20±30 per cent cases (Mair et al 1990, Love et al 1992, Murphy et al 1996). Furthermore, treatment success rates are disappointing with case fatalities approaching 33±35 per cent (Mair et al 1990). These studies highlight the lack of understanding of the mechanisms involved in equine colitis and emphasise the need for further research into its underlying aetiology. One common cause of colitis is larval cyathostominosis, associated with synchronous reactivation of inhibited cyathostomin larvae. The precise triggers involved in development of this disease are unknown and, similarly, success rates of treatment are poor (Love and McKeand 1997). In humans, inflammatory bowel disease (IBD) is associated with excess production of chronic tissuedamaging inflammatory mediators (McDermott 1997). Detailed analyses of responses revealed that, in Crohn's disease, there is predominantly a T-helper cell type 1 (Th1) mucosal response, associated with exaggerated production of interleukin (IL)-12 and interferon (IFN)gamma, with downstream over-production of tumour necrosis factor (TNF)-alpha, IL-6 and IL-8. Mucosal TNFa levels appear to play a critical role in this disease in humans and measurement of this cytokine in diagnostic biopsies is used as a prognostic indicator of relapse *Corresponding author: Department of Veterinary Clinical Science and Animal Husbandry, Faculty of Veterinary Science, University of Liverpool, Leahurst, South Wirral, CH64 7TE, UK. Fax: 44 (0) 151 794 6034. E-mail: [email protected]

0034±5288/02/$ ± see front matter

(Schreiber et al 1999). Furthermore, of relevance at the applied level, monoclonal antibodies to this cytokine reduce clinical disease in corticosteroid-refractory patients (Stack et al 1997). Conversely, other cytokines may play anti-inflammatory roles: transforming growth factor (TGF)-beta (Autenrieth et al 1997), IL-4 (Schreiber et al 1995) and IL-10 (Groux et al 1997) have been identified as having such roles. To examine if similar responses are involved in the aetiology of equine colitis, we performed an analysis of the pattern of cytokine mRNA expression in the large intestinal mucosa of horses with different forms of colitis and varying levels of cyathostomin infection. Horses presenting with parasitic, granulomatous, lymphocytic and eosinophilic colitis were included. The latter is a localised lesion of unknown origin, usually found in the left dorsal colon and associated with mucosal necrosis and eosinophilic infiltration (Edwards et al 2000). In this study, we assayed presence of IL-2, IL-4, IL-5, IL-10, TNFa, IFNg and TGFb messenger (m) RNA transcripts in horses with no mucosal cyathostomin larvae, horses harbouring encysted larvae and horses exhibiting different types of overt colitis. MATERIALS AND METHODS Abattoir samples Samples (approximately one cm2) were collected in duplicate from the caecum (C), right (RVC) and left (LVC) ventral colon, pelvic flexure (PF) and left (LDC) and right (RDC) dorsal colon from nine horses from an abattoir. After washing in diethyl pyrocarbonatetreated sterile water, the serosa was removed and # 2002 Published by Elsevier Science Ltd.

Weight loss, ataxia*, L4 in faeces Weight loss, diarrhoea, oedema, pyrexia, L4 in faeces Severe diarrhoea, L4 in faeces

C1

Mild colic, depression, anorexia

Severe colic, depression

Mild colic, depression, turbid peritoneal fluid

Severe colic

Chronic weight loss, intermittent diarrhoea

Chronic weight loss, dullness Chronic weight loss, chronic diarrhoea Chronic weight loss, chronic diarrhoea Severe colic, depression, severe, acute diarrhoea

Severe acute diarrhoea

C6

C7

C8

C9

C10

C11 C12

C15

Lymphocytic infiltration No evidence of neoplasia. Extensive mucosal necrosis Residual mucosa infiltrated with viable and degenerate lymphocytes and neutrophilic leukocytes Extensive diffuse haemorrhage, oedema, congested blood vessels in submucosa. No bacteria cultured Caecal and RVC mucosa totally ulcerated Mixed cellular infiltrate

Granulomatous infiltrate in colon and small intestine Granulomatous infiltrate in small and large intestine

Numerous helminth profiles Large infiltration of lymphoid and plasma cells in submucosa Widespread mucosal scarring Focal infiltrate of eosinophils, severe mucosal ulceration Focal infiltrate of eosinophils, broad mucosal ulcer at centre No evidence of helminth profiles. Lesion margin: Marked submucosal oedema. Mild eosinophilic infiltrate Lesion centre: full thickness necrosis. Marked submucosal oedema. Eosinophlic infiltrate Mucosal /submucosal oedema, many eosinophils present in lamina propria and submucosa Many helminth larvae mucosa /submucosa. Macrophage accumulations. Submucosal oedema with central abscess containing neutrophils PF : full thickness infarction Ghost like remnants of mucosa Diffuse inflammation LDC: mucosa intact Eosinophilic infiltration Granulomatous infiltrate and ulceration in colon

Numerous helminth profiles in mucosa and submucosa Granulomatous cellular infiltrate Numerous helminth profiles in mucosa and submucosa Granulomatous cellular infiltrate

Histopathological description

Haemorrhagic colitis Salmonellosis

Haemorrhagic colitis

Lymphocytic colitis

Granulomatous colitis Granulomatous colitis

Caecal infarction, possibly associated with large numbers of mucosal cyathostomins PF infarction. Noted large number of empty cysts on TMI and many lumenal parasites at exploratory laparotomy Granulomatous colitis

Eosinophilic colitis

Eosinophilic colitis

Eosinophilic colitis

Eosinophilic colitis

Larval cyathostminosis

Larval cyathostminosis

Larval cyathostminosis

Presumptive diagnosis

PF

Focal (PF )

Diffuse

Diffuse

Diffuse, including small intestine

RVC, LVC, LDC, RDC

Not small intestine Diffuse, including small intestine Diffuse, including small intestine

C, LVC, PF, LDC, RDC

PF

LVC, LDC, RDC

C, RVC, LDC, RDC

C, RVC, LVC, PF, LDC, RDC

PF, LDC

Focal (PF extending to LDC)

Diffuse

C

Focal (tip of caecum)

LDC

PF

Focal ( PF )

Focal ( LDC)

LDC

RDC

Focal (RDC) Focal (LDC)

C, RVC, PF, LDC, RDC

Diffuse

C, RVC, LVC, PF, LDC, RDC

C, RVC

Diffuse, particularly severe C and RVC Diffuse

Sites analysed

Extent of Lesion

* Incidental finding due to recent self inflicted trauma; NB: L4 refers to cyathostomin fourth stage larvae, presumably reactivated from large intestinal mucosa; C: caecum; RVC: right ventral colon; LVC: left ventral: PF : pelvic flexure; LDC: left dorsal colon; RDC: right dorsal colon.

C14

C13

C5

Intermittent colic, turbid peritoneal fluid Severe colic, depression, turbid peritoneal fluid

C4

C3

C2

Presenting signs

Horse

TABLE 1: Description of mucosal samples obtained from 15 clinical cases of weight loss and/or diarrhoea or colic. The horses are designated C1^ C15. Due to restrictions on access to sites during exploratory laparotomy, samples were obtained from fewer sites, in some cases, than from the cohort obtained from the abattoir. The abbreviations relating to anatomical location are as described in the text. Mucosal larval burdens were not assessed in these cases as the samples obtained were small and were used in their entirety for RNA analysis and histopathology

179

Cytokine mRNA expression in equine colitis

mucosa frozen in liquid nitrogen. A further 10 cm2 of mucosa were taken in close proximity to these samples and mucosal larvae, classified as late third stage (LL3) and developing fourth stage (DL4), enumerated by transillumination (Murphy and Love 1997). In horses negative for these stages at all sites, mucosa was digested in pepsin/HCl for 1±2 hours and the sample examined for mucosal early L3 (EL3). Due to restriction on access to live animals at the abattoir, no clinical assessment could be made prior to necropsy. At the time of sampling, mucosa from all sites was examined grossly for evidence of inflammation and cyathostomin larval reactivation and obvious inflammation or reactivation noted. Clinical samples Intestinal mucosal samples were collected during exploratory laparotomy or at post mortem examination from 15 clinical cases. All samples collected post mortem were obtained within 30 minutes of death so as to ensure minimal effects on RNA degradation. The clinical histories and histopathological descriptions of the mucosal samples from each case are summarised in Table 1. In summary, the clinical group included three cases of larval cyathostominosis (C1±C3); four cases of histologically confirmed eosinophilic colitis (C4±C7); two cases of non-strangulating infarction (C8 and C9); four cases with histologically confirmed infiltrative colitis (granulomatous or lymphocytic colitis, C10±C13) and two cases of haemorrhagic colitis (C14 and C15). Following faecal culture, Salmonella were isolated from one of these cases (C15). Unless indicated in Table 1, faecal samples were negative for cyathostomin larvae. No parasites were observed grossly or histologically in any of the cases with infiltrative colitis (C10±C13) and so current parasitic infection was not assumed to be involved in the underlying pathogenesis of disease in these cases. Because of surgical restrictions, samples were not obtained from all six sites from some cases as these were derived from small biopsies resected for histological diagnosis at exploratory laparotomy. In most cases, parasites could not be enumerated as the entire sample was used for histology and RNA extraction, however large numbers of nematodes were noted grossly in the lumen and, microscopically, in the gut wall of all larval cyathostominosis cases (C1±C3) and one non-strangulating infarction case (C8). RNA

extraction

Mucosa was excised into small pieces in Trizol (BRL Life Technologies) and RNA extracted twice in the reagent as per manufacturer's instructions. RNA concentration was assessed by spectrophotometry at OD260 nm and quality assessed by OD260 nm : OD280 nm ratio and gel electrophoresis on 1
2 per cent agarose gels stained with ethidium bromide. RNA was stored in 100 per cent ethanol at ÿ 70 C. In some cases, RNA Later (Ambion) was used as the storage medium prior to extraction.

First strand complementary (c) DNA synthesis and polymerase chain amplification This was performed with the Superscript First Strand cDNA Synthesis Kit (BRL Life Technologies) using 25 mg of RNA from each site. Samples were pre-treated with 5 units of DNase (BRL Life Technologies) for 15 minutes at room temperature and reactions stopped by addition of 25 mM EDTA and incubation at 65 C for 15 minutes. The cDNA was synthesised following manufacturer's instructions and samples examined for integrity by amplification using primers for the equine b actin gene (Accession Number: AF035774, Table 2). A sample that did not include reverse transcriptase was assayed in all cases to ensure there was no contamination with genomic DNA. The cDNA was stored at ÿ 20 C. Oligonucleotide primers (Table 2), designed from sequences held in Genbank databases were used to amplify transcripts encoding equine IL-2, IL-4, IL-5, IL-10, IFNg, TNFa, TGFb and b actin. Primer quality was assessed using NetPrimer software (Premier Biosoft International). Amplification reactions were performed in 50 ml volumes containing 50 mM KCl, 10 mM Tris HCl (pH 8.3), 1.5 mM MgCl2, 200 mM each dNTP and 1U Taq polymerase (AmplitaqGold, Perkin Elmer). PCR amplification was optimised for template and primer concentration and for PCR cycle number to ensure reactions were terminated during linear amplification. Thermal cycling was performed over one cycle of 94 C for 10 minutes. This was followed by 30±40 cycles (depending on the gene being analysed) of 94 C for 1 minute (30 seconds for IL-5), 55 C (70 C for TGFb) for 1 minute (30 seconds for IL-5) and 72 C for 1 minute (30 seconds for IL-5), and 10 minute extension at 72 C. Optimisation studies indicated the following numbers of cycles: TGFb, 30 cycles; IL-5, 32 cycles; bactin and IL-10, 35 cycles; IL-2, IFNg, TNFa and IL-4, 40 cycles. One ml of cDNA was used for each cytokine PCR, whilst b actin PCR was performed using 0.1 ml of cDNA. Primers were

TABLE 2: Primers used for PCR amplification. The accession numbers of the sequences from which the primers were designed are shown for each primer set Primer name

Sequence

Accession number

bactin-F bactinr-R IFN g-F IFN g-R IL2-F IL2-R IL4-F IL4-R IL -5F IL -5R IL -10F IL -10R TGFb-F TGFbr-R TNFa-F TNFar-R

5 0 ACCCCGTGCTGCTGACCGA 3 0 5 0 AGGGCTGTGATCTCCTTCTGC 3 0 5 0 GGGTTCTTCTACCTATTACTGCC 3 0 5 0 AAACGGATTCTGACTCCTCTTC 3 0 5 0 CAGCAACAACTGAAGCAA 3 0 5 0 TTCCTGTCTCATCATCATA 3 0 5 0 ATACGACATCACCTTACAA 3 0 5 0 CTTGGCTTCATTCACAG 3 0 5 0 GATGGGAACCTGATGATTCCTACT 3 0 5 0 TCCCCTTGGACAGTTTGATTCT 3 0 5 0 ATGTTGTTGAACGGGTCCC 3 0 5 0 AGAGGTACCACAGGGTTTT 3 0 5 0 CCAGATCCTGTCCAAGTTGCGG 3 0 5 0 TTGATGCCCACGCGGAGT 3 0 5 0 GACACACCTCTGGATAAACA 3 0 5 0 ATCAGCACACCTCTTTCCCC 3 0

AF035774

F: forward primer; R: reverse primer.

D28520 X69393 AF035404 U91947 U38200 X99438 M64087

180

A. J. Davidson, G. B. Edwards, C. J. Proudman, P. J. Cripps, J. B. Matthews

A

A4

B

A8

FIG 1: Ethidium bromide-stained agarose gels of RT-PCR products from b actin competitive RT-PCR and cytokine RT-PCR analyses from horse A4 (abattoir, parasite-negative group) and A8 (abattoir, parasite-positive group). (i) An example of competitive amplification of b actin transcript from one site fromeachhorse.Shownhere, for A4, istheresult obtained for the PF and, for A8, theresult obtained for the RDC.The competitive PCR experiments were performed in triplicate. `M' represents the 100 bp marker, `a' to `e' represent 10-fold dilutions of the b actin competitor (10 ÿ 4 to10 ÿ 8),` ‡ 'representsthe positive control,` ÿ 'representsthe control to which no template DNAwas added.The lower band represents competitor product, the upper bandis the bactin host transcript. (ii)^(vi) Cytokine amplifications from all sites of horses A4 and A8. As described in Materials and Methods, c DNA from each site was amplified in duplicate. In each panel,`1' ˆcaecum,`2' ˆright ventral colon,`3' ˆleft ventral colon,`4' ˆpelvic flexure,`5' ˆleft dorsal colon and`6' ˆright dorsal colon,` ‡ ' ˆamplification products frompositive controlhorse using the same primer set, ` ÿ ' ˆthe control to which no template DNA was added.

optimised to a final concentration of between 0
4 and 2
0 picomoles/ml. Reaction products (10 ml) were separated on 1
2 per cent agarose gels stained with ethidium bromide and the gel images over-exposed to ensure that low levels of PCR product (i.e. transcript) were detected.

Initially, cDNA from each anatomical site was tested for concentration by quantifying levels of b actin using a specific competitor. This was performed over a range of 10-fold dilutions of competitor (10 ÿ 4±10 ÿ 8), in triplicate for each dilution. Only when samples contained

181

Cytokine mRNA expression in equine colitis

A

C2

B

C13

FIG 2: Ethidium bromide-stained agarose gels of RT-PCR products from b actin competitive RT-PCR and cytokine RT-PCR analyses from horse C2 (larval cyathostominosis case) and C13 (lymphocytic colitis case). (i) An example of competitive amplification of b actin transcript from one site from each horse. Shown here, for C2, is the result obtained for the caecum and, for C13, the result obtained for the RDC.The competitive PCR experiments were performedintriplicateandtheabbreviationsareasdescribedfor Fig1. (ii)^(vi) Cytokineamplificationsfromallsitesofhorses C2 and C13.As described in Materials and Methods, c DNA from each site was amplified in duplicate. For horse C2, the abbreviations are as described for Fig 1. For horses C13, `1' ˆjejunum,`2' ˆ LVC,`3' ˆ LDC and`4' ˆ RDC.

b actin transcript equivalent to competitor at, or more concentrated than, a dilution of 10 ÿ 7, was the sample analysed for cytokines. Examples of the results of bactin competitive PCR experiments from one site selected from four horses are shown (Figs 1 and 2). Each cytokine, PCR was performed in duplicate and amplified concurrently with a mucosal sample that had been

shown previously to express detectable levels of all aforementioned cytokines (`positive control'). Each PCR was performed with a sample containing reaction mix to which no DNA template was added (`negative control'). Examples of the results of cytokine RT-PCR analysis from all sites from four horses are shown (Figs 1 and 2).

182

A. J. Davidson, G. B. Edwards, C. J. Proudman, P. J. Cripps, J. B. Matthews

To confirm that products amplified encoded the correct sequence, one example of each cytokine and of b actin PCR were cloned using the pCR2
1 vector (TA kit, Invitrogen) and the recombinants sequenced (MWG Biotech). Sequences were analysed by FASTA (GenBank). Data handling and statistical analysis The data were stored in Excel 8 spreadsheets (Microsoft Corporation, USA). To compare differences in cytokine expression, the samples were split as follows: (a) IBD group (three granulomatous and one lymphocytic colitis case); (b) larval cyathostominosis group; (c) eosinophilic colitis group; (d) nonstrangulating infraction group; (e) haemorrhagic colitis group; (f) cyathostomin-negative group (from the abattoir); and (g) cyathostomin-positive group (from the abattoir). The number of horses positive at any site for a given cytokine was ascertained. Differences between the groups in the proportion positive were investigated using binary logistic regression using the Minitab 13 statistical package (Minitab Inc., State College, PA). Epi Info 6 (CDC, Atlanta, Georgia) was used to examine differences between individual groups using Fishers Exact Test and to compute exact binomial confidence intervals (CI). Statistical significance was taken as P < 0
05. RESULTS Parasite status of abattoir horses The parasite status of each abattoir animal is shown (Table 3). Three horses had zero larvae, whilst one had one larva (A1, RVC). The other four horses had parasite burdens ranging from low levels at each site (A5) to large numbers of larvae (A8 and A9), particularly in the C and RVC. Larval reactivation was occurring in A8 and A9 in which the epithelium was grossly inflammed and many larvae were uncoiled.

Sequence analysis of

PCR

products

Prior to determination of cytokine profiles, the specificity of each primer set was confirmed by sequence analysis of cloned PCR products representative of each cytokine. Analysis showed 98 per cent or higher identity to the sequences from which the primers were originally designed, confirming that the appropriate gene was being analysed. Qualitative cytokine responses of horses Examples of gel analysis of the RT-PCR results for four of the horses analysed in this study are shown in Figs 1 and 2. Figure 1 shows the cytokine responses of two horses sampled at the abattoir: horse A4 (Fig 1A), which had one larvae detected in the mucosa, and horse A8 (Fig 1B), which had high numbers of larvae (including reactivating larvae) enumerated at all mucosal sites. Figure 2 shows agarose gels of the cytokines detected in two of the clinical cases: C2 (Fig 2A), a larval cyathostominosis case, and C13 (Fig 2B), the lymphocytic colitis case. Also shown in each figure is an example of the bactin competitive PCR analysis of one of the sites from each horse. The most obvious difference in cytokine detection amongst the different groups was in the expression of TNFa. A summary of the TNFa results in all horses is presented in Table 4. The results of the analysis of the other cytokines are described below, group by group. Horses with no larvae or a single larva (A1±A4) expressed detectable levels of IL-2, IL-4, IL-5 and IL-10 at all sites. Detection of TGFb varied, with 19 out of 24 sites positive for TGFb. Presence of IFNg also varied, with 18 out of 24 sites positive for this cytokine. TNFa transcript was not detectable at any site from the horses this group. In abattoir horses that had parasites present in the mucosa (A5±A9), IL-2, IL-4, IL-5 and IL-10 were detected at all sites. TGFb was absent from one site in one horse (A5, LVC). This horse had the lowest worm burden. IFNg was detected at all sites in all horses except A5, where it was not detected at two sites. TNFa was

TABLE 3: Parasites enumerated in the large intestinal samples obtained from a local equine abattoir. The horses are depicted A1^9 and in all cases six sites were analysed in each horse: caecum (C), right ventral colon (RVC), left ventral colon ( LVC), pelvic flexure ( PF ), left dorsal colon ( LDC) and right dorsal colon (RDC). Mucosal larval burdens were assessed by transmural illumination and classified as either late third stage larvae (LL3) or developing fourth stage larvae ( DL4). Ten cm 2 of mucosal tissue was transilluminated to give an estimate of mucosal burden in the vicinity of the area for analysis. In the cases where negative larval burdens were obtained by transillumination, the tissue was digested and examined for early third stage larvae (EL3) Horse

A1* A2* A3* A4* A5 A6 A7 A8 A9

C

RVC

LVC

PF

LL3

DL4

LL3

DL4

LL3

DL4

LL3

0 0 0 0 9 67 324 2400 4500

0 0 0 0 26 35 180 1586 4600

1 0 0 0 14 148 252 1872 2300

0 0 0 0 24 79 252 1392 3500

0 0 0 0 5 52 134 976 1600

0 0 0 0 7 26 90 352 2700

0 0 0 0 10 49 44 35 100

* Following mucosal digestion, no EL3 were observed in samples from A1^A4.

LDC DL4

0 0 0 0 5 20 31 27 200

LL3

0 0 0 0 2 44 33 10 1600

RDC DL4

0 0 0 0 5 11 30 8 1900

LL 3

0 0 0 0 3 45 26 1 1800

DL4

0 0 0 0 2 9 35 1 2100

183

Cytokine mRNA expression in equine colitis TABLE 4: Summary of results of TNFa RT-PCR analysis of mucosal samples taken from all horses. The PCR analysis was performed as described in Materials and Methods. For all sites, each cytokine PCR was performed in duplicate and analysed along with the same positive control sample and a sample to which no DNA had been added.` ‡ ' indicates cytokine detectable,` ÿ ' indicates that no PCR product was obtained and therefore cytokine not detected. The abbreviations for the anatomical locations are as described in Table 1. NB: nd ˆ sample not provided for analysis TNFa detected? Horse

C

RVC

LVC

PF

LDC

RDC

ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ ÿ

ÿ ÿ ÿ ÿ ÿ

ÿ ÿ ÿ nd nd nd nd nd nd ÿ ‡ ‡ nd nd nd

nd ÿ nd nd nd nd nd nd nd ÿ ÿ nd ‡ nd ‡

nd ÿ ÿ nd ÿ ‡ nd nd ÿ ÿ nd nd nd nd ÿ

nd ÿ ÿ ÿ nd ÿ ‡ nd ÿ ÿ ÿ ÿ ‡ nd ÿ

nd ÿ ÿ nd nd nd nd nd nd ÿ ÿ ÿ ‡ nd ÿ

Abattoir group Parasite negative A1 ÿ A2 ÿ A3 ÿ A4 ÿ Parasite positive A5 ÿ A6 ÿ A7 ÿ A8 ‡ A9 ‡ Clinical case group C1 ÿ C2 ÿ C3 ÿ C4 nd C5 nd C6 nd C7 nd C8 ÿ C9 nd C10 ‡ C11 nd C12 ‡ C13 nd C14 ‡ C15 ÿ

detected in caecal mucosa from A8 and A9. Both horses had high worm burdens (see Table 3) and these sites were grossly inflamed. In the larval cyathostominosis (C1±C3) and focal eosinophilic colitis (C4±C7) cases, IL-2, IL-4 and IFNg transcripts were detected at all sites. IL-10 was detected in 12 out of 13 sites in the larval cyathostominosis cases and in all but one site from the eosinophilic colitis cases. IL-5 was detected at all sites in the eosinophilic colitis cases. IL-5 and TGFb were detected at all sites in C1 and C2, but in one out of five sites in C3. TGFb was detected in four out of five sites from the eosinophilic colitis cases. TNFa was not detected in the larval cyathostominosis cases, but in two out of five sites from the eosinophilic colitis cases. In the site from the caecal non-strangulating infarction (C8), there were detectable levels of IL-2, IL-4, IL-5, IL-10 and TGFb, but no TNFa or IFNg. In the other nonstrangulating infarction (C9), the same result was obtained, however IL-10 and IL-5 PCR were not performed due to insufficient cDNA. In the granulomatous colitis and lymphocytic colitis cases (C10±C13), IL-2, IL-4, IL-10 and IFNg transcripts were detected in all sites. TGFb was detected at all but

TABLE 5: Proportion of horses positive for TNFa by clinical group. To compare differences in cytokine expression, the horses were split into the following groups: (a) inflammatory bowel disease group (including three granulomatous cases and one lymphocytic colitis case); (b) three larval cyathostominosis cases; (c) four eosinophilic colitis cases; (d) two infarction cases; (e) two haemorrhagic colitis cases; (f) four cyathostomin-negative horses from the abattoir; and (g) five cyathostomin-positive horses from the abattoir. The number of horses positive at any site for a given cytokine is shown. Differences between the groups in the proportion positive were investigated using binary logistic regression using the Minitab 13 statistical package (Minitab Inc., State College PA. USA). Epi Info 6 (CDC, Atlanta, Georgia, USA) was used to examine differences between individual groups using Fishers Exact Test and to compute exact binomial confidence intervals (CI ) Clinical case group (C1^ C15)

Granulomatous/lymphocytic colitis (C10^C13) Larval cyathostominosis (C1^C3)1 Eosinophilic colitis (C4^ C7) Infarction (C8^ C9) Haemorrhagic colitis (C14^ C15) Abattoir group (A1^ A9) Parasite positive (A5^ A9) Parasite negative (A1^ A4) 2

Number positive/ Total in group

Percentage positive (95 percent CI)

4/4

100 (40^100)

0/3

0 (0^71)

2/4 0/2 2/2

50 (7^93) 0 (0^84) 100 (16^100)

2/5 0/4

40 (5^85) 0 (0^53)

1 Significantly different from the granulomatous/lymphocytic colitis group (P ˆ 0
028). 2 Significantly different from the granulomatous/lymphocytic colitis group (P ˆ 0
014).

one site and IL-5 detected at all but two sites. In the granulomatous colitis cases, TNFa was detected at four out of 14 sites examined. In the lymphocytic colitis case (C13), TNFa was detected at all sites in the large colon and also at two sites from the jejunum (Fig 2B). In the haemorrhagic colitis case of unknown origin (C14), IL-4 was not detected and neither were IL-5, TGFb or IFNg. Nevertheless, the cDNA was sufficiently intact to allow detection of IL-10, TNFa and IL-2. In the haemorrhagic colitis case confirmed as Salmonellosis (C15), IL-2, IL-4, IL-10 and IFNg were detected at all sites. TGFb and IL-5 were detected at all sites but one and TNFa was detected at one site. There were significant differences between groups in expression of TNFa (P ˆ 0
002). Table 5 shows the number and proportion of horses positive for TNFa in each group. Four out of four (100 per cent) animals with infiltrative IBD expressed TNFa compared with none (0 per cent) of the larval cyathostominosis cases (P ˆ 0
028), and none of the parasite-negative horses from the abattoir (P ˆ 0
014). There were no significant differences in detection of IL-2, IL-4, IL-5, IL-10, TGFb and IFNg transcripts between the groups (P > 0
4). DISCUSSION The work described here demonstrates qualitative differences in cytokine expression amongst the groups. Obviously, more firm conclusions could be made on quantitative measurement, however, given the plethora of cytokines potentially involved in IBD and the size of the equine large intestine, it is imperative to identify on

184

A. J. Davidson, G. B. Edwards, C. J. Proudman, P. J. Cripps, J. B. Matthews

a qualitative basis first, those cytokines that are of most relevance. This work represents the first step to analysis of cytokines involved in homeostasis and disease in the equine large intestine and the results indicated that differences in TNFa expression amongst the groups were the most informative. TNFa has been shown in many studies to have a key role in the development of human IBD. It has been proposed that, intestinal bacterial components stimulate the initial mucosal immune response, the magnitude of which is controlled by the genetic background of the individual (Rath et al 1996). Attempts to treat human IBD by modulating local production, or action, of TNFa have shown potential. Initially, a specific inhibitor of TNFa and IL-1 (CGP47969) was shown to significantly reduce intestinal inflammation in rabbits (Casiniraggi et al 1995). Subsequently, a monoclonal antibody raised against TNFa was shown to reduce the severity of IBD in humans (Sands et al 1996, Plevy and Targen 1996.) This antibody was shown to be effective in Crohn's disease patients that were refractive to corticosteroid therapy (Stack et al 1997). In the clinical cases analysed in the present study, TNFa was not detected at any sites in the three horses that presented with colitis associated with larval cyathostominosis. Cytokine production in a tissue is likely to vary on a temporal basis according to the progression of the clinical disease. As these samples were obtained at post mortem, only a single time point was measured. However, this cytokine was not detected at any of the 13 sites analysed in the three horses. Furthermore, in two of these horses, multiple sites were analysed which represented the length of large intestine, from the caecum, proximally, to the right dorsal colon, distally. From gross examination of the large intestine of these cases it was clear that larval reactivation was most obvious in the caecum and right ventral colon, where more parasites were present. Therefore, it could be argued that on the basis of analysis of multiple sites in different clinical cases at various stages of disease, the results presented here represent more than a single snapshot of the disease process in larval cyathostominosis. In contrast to the results obtained with the larval cyathostominosis cases, TNFa was detected more consistently in the four IBD cases that were not associated with parasitic infection. In fact, TNFa was detected at all sites in the lymphocytic IBD case. Lymphocyticplasmacytic enteritis (LPE) is a morphological diagnosis given to an equine infiltrative disease within the complex of IBD (Kemper et al 2000). A previous study performed on 14 cases of LPE found that this disease had no age, breed or sex predilection and predisposing factors were not identified (Kemper et al 2000). These authors indicated that defective immunoregulation of intestinal immunity may play a role. From our, albeit, preliminary results this may be the case. The results here agree with previous studies where increased serum TNF activity was most prevalent in horses with intestinal inflammatory disorders (Morris et al 1991), however, these authors did not assay mucosal TNF. The difference in detection of TNFa between these two clinical colitis groupings may be associated with the fact that, in

the larval cyathostominosis cases, large numbers of nematodes were present. These parasites may have influenced the local mucosal environment to promote responses associated with a Th2 type. This sort of response is typified by increased expression of cytokines such as IL-4, IL-5 and IL-10 and has been observed in most nematode infections so far studied (Else and Finkelman 1998). The presence of the cyathostomin larvae does not appear to drive the response to a total Th2 type here, as IFNg (a classical Th1 cytokine) was detected in most horses, irrespective of the worm burden. This included both larval cyathostominosis cases and parasite-positive horses from the abattoir. Furthermore, IL-4, IL-5 and IL-10 mRNA transcripts were detected at most sites from the horses that presented with IBD not associated with parasite infection. However, the difference in responses between these two groups may be more subtle than simple detection of transcript and, to address this, we are currently quantifying the levels of IL-4, IL-10 and IL-5 in these horses. In the samples that were obtained from the abattoir, TNFa was not detected in parasite-negative horses, however, in the parasite-positive mucosal samples, TNFa was detected in two of the 12 sites obtained from the two most heavily infected horses. In these horses, TNFa was detected at the sites where the parasite burdens were highest and where severe gross inflammation was observed. Due to the methodology of sample collection, these horses could not be classified clinically (when alive) as larval cyathostominosis cases. It may be that up-regulation of TNFa in these horses was associated with the presence of other pathogens, such as bacteria. Alternatively, these horses may have had such a severe response to the large numbers of reactivating larvae that at the time they were necropsied, the balance of the local immune response had polarised to a more proinflammatory (i.e. Th1) type. This highlights the disadvantage of this type of clinical study where samples can only be assayed at one time-point. The balance between inflammatory and regulatory cytokines is of crucial importance in gut homeostasis and the fact that several anti-inflammatory cytokines were detected at most sites was not surprising. No significant differences in detection of any the antiinflammatory cytokines was observed amongst the groups and, as mentioned above, these responses are being investigated further by quantification of these cytokines by competitive RT-PCR. IL-2 is of central importance in development of an appropriate T-cell immune response and was detected at all sites. Likewise, IL-2 has been detected at biologically significant levels in normal human intestinal mucosal cells and, when quantified, there was less transcript in colitis versus control patients (Kusugami et al 1991). Thus, it is unsurprising that this important regulatory cytokine was present at all sites. In summary, TNFa was absent in the large intestine of animals not suffering from IBD or in cases of colitis which were clearly associated with parasitism, but was found more consistently in IBD cases where the aetiology of the disease was unknown and where there was no evidence of parasitism. The horses with IBD studied

Cytokine mRNA expression in equine colitis

here may have a compromised intestinal barrier allowing stimulation of increased TNFa and these results indicate that local expression of this cytokine may have a possible role in inflammation at this site. ACKNOWLEDGEMENTS We thank the Home of Rest for Horses for funding this project, and Dr Tim Mair (Bell Equine Veterinary Clinic, Kent), Dr Peter Clegg and Miss Meredith Smith (both University of Liverpool) and Nantwich Abattoir for samples. We also thank the pathologists (at Liverpool and Bristol Veterinary Schools) who performed the histopathology, particularly Richard Fox (Home of Rest for Horses Resident in Equine Pathology, University of Liverpool). JBM is funded by the ILPH. REFERENCES AUTENRIETH, I. B., BUCHELER, N., BOHN, E., HEINZE, G. & HORAK, I. (1997) Cytokine mRNA expression in intestinal tissue of interleukin-2 deficient mice with bowel inflammation. Gut 41, 793±800 CASINIRAGGI, V., MONSACCHI, L., VOSBECK, K., NAST, C. C., PIZARRO, T. T. & COMINELLI, F. (1995) Anti-inflammatory effects of CGP 47969A, a novel inhibitor of proinflammatory cytokine synthesis, in rabbit immune colitis. Gastroenterology 109, 812±818 EDWARDS, G. B., KELLY, D. F. & PROUDMAN, C. J. (2000) Segmental eosinophilic colitis: a review of 22 cases. Equine Veterinary Journal Supplement 32, 86±93 ELSE, K. J. & FINKELMAN, F. D. (1998) Intestinal nematode parasites, cytokines and effector mechanisms. International for Parasitology 28, 1145±1158 GROUX, H., O'GARRA, A., BIGLER, M., ROULEAU, M., ANTONENKO, S., DEVRIES, J. E. & RONCARLO, M. G. (1997). A CD4( ‡ ) subset inhibits antigen-specific T cell responses and prevent colitis. Nature 389, 737±742 KEMPER, D. L., PERKINS, G. A., SCHUMACHER, J., EDWARDS, J. F., VALENTINE, B. A., DIVERS, T. J. & COHEN, N. D. (2000) Equine lymphocytic-plasmacytic enterocolitis: a retrospective study of 14 cases. Equine Veterinary Journal Supplement 32, 108±112

185

KUSUGAMI, K., MATSUURA, T., WEST, G. A., YOUNGMAN, K. R., RACHMILEWITZ, D. & FIOCCHI, C. (1991) Loss of interleukin-2producing intestinal CD4 ‡ T cells in inflammatory bowel disease. Gastroenterology 101, 1594±1605 LOVE, S. & MCKEAND, J. B. (1997) Cyathostomosis: practical issues of treatment and control. Equine Veterinary Education 9, 253±256 LOVE, S., MAIR, T. S. & HILLYER, M. H. (1992) Chronic diarrhoea in adult horses: a review of 51 referred cases. Veterinary Record 130, 217±219 MCDERMOTT, R. P. (1997) Etiology and pathogenesis of inflammatory bowel disease. Current Opinion in Gastroenterology 13, 302±306 MAIR, T. S., WESTERLAKEN, L. VDE., CRIPPS, P. J. & LOVE, S. (1990) Diarrhoea in adult horses: A survey of clinical cases and an assessment of some prognostic indices. Veterinary Record 126, 479±481 MORRIS, D. D., MOORE, J. N. & CROEW, N. (1991) Serum tumor necrosis factor activity in horses with colic attributable to gastrointestinal tract disease. American Journal of Veterinary Research 52, 1565±1569 MURPHY, D. M., EDWARDS, S. E., RUSSELL, T., SAMMIN, D. & LOVE, S. (1996) Diagnosis, management and outcome of 18 cases of chronic diarrhoea in adult horses. Equine Medicine 49, 216±220 MURPHY, D. & LOVE, S. (1997) The pathogenic effects of experimental cyathostome infection in ponies. Veterinary Parasitology 70, 99±110 PLEVY, S. E. & TARGEN, S. R. (1996) Anti-tumor necrosis factor-alpha therapy in Crohns-disease ± a magic bullet finally hits its mark. Inflammatory Bowel Disease 2, 158±159 RATH, H. C., HERFARTH, H. H., IKEDA, J. S., GRENTHER, W. B., HAMM, T. E., BALISH, E., TAUROG, J. D., HAMMER, R. E., WILSON, K. H. & SARTOR, B. (1996) Normal luminal bacteria, especially Bacteroides species, mediate chronic colitis, gastritis, and arthritis in HLAB27/human beta(2) microglobulin transgenic rats. Journal Clinical Investigation, 98, 945±953 SANDS, B. E., PODOLSKY, D. K., TREMAINE, W. J., SANDBAR, W. J., RUTGEERTS, P. J., HANAUER, S. B., MAYER, L., TARGEN, S. R., DEWOODY, K. L., BRAAKMAN, T. A. J. & WOODY, J. (1996) Chimeric monoclonal and tumor necrosis factor antibody (cA2) in the treatment of severe, steroid refractory ulcerative colitis. Gastroenterology 110, A1008 SCHREIBER, S., HEINIG, T., PANZER, U., REINKING, R., BOUCHARD, A., STAHL, P. D. & RAEDLER, A. (1995) Impaired response of activated mononuclear phagocytes to interleukin-4 in inflammatory bowel disease. Gastroenterology 108, 21±33 SCHREIBER, S., NIKOLAUS, S., HAMPE, J., HAMLING, J., KOOP, I., GROESSNER, B., LOCHS, H. & RAEDLER, A. (1999) Tumour necrosis factor a and interleukin 1b in relapse of Crohn's disease. Lancet 353, 459±461 STACK, W. A., MANN, S. D., ROY, A. J., HEATH, P., SOPWITH, M., FREEMAN, J., HOLMES, G., LONG, R., FORBES, A. & KAMM, M. A. (1997) Randomised control trial of CDP571 antibody to tumour necrosis factor alpha in Crohn's disease. Lancet 349, 521±524

Accepted October 30, 2001