Cytokine profile induced by a primary infection with Ostertagia ostertagi in cattle

Veterinary

ELSEVIER

Immunology and Immunopathology 58 (1997) 63-75

Veterinary immunology and immunopathology

Cytokine profile induced by a primary infection with Ustertagia ostertagi in cattle A. Canals *, D.S. Zarlenga, S. Almeria, L.C. Gasbarre USDA, ARS. LPSI, Immunology and Disease Resistance Laboratory, USA Received 8 December

Bldg. 1180. USDA. Beltsuille. MD 20705,

1996

Abstract Changes that occur in the local draining lymph nodes including, changes in cell surface markers and cytokine gene expression were studied over the first 4 weeks of a primary, Ostertagia ostertugi infection of the abomasum. Cells recovered from the abomasal lymph nodes (ABLN) after infection showed a decrease in the percentage of CD3+ cells, and an increase in the percentage of IgM’ cells and cells bearing the TcRl marker. These changes were coincident with an increase in the proportion of activated cells (Il-2R). Analysis of mitogen-stimulated ABLN cells by RNase protection assay (RPA) showed a dramatic reduction in IL-2 and IFN-?/ transcription after infection. In addition, analysis of unstimulated ABLN cells by competitive RT-PCR showed a similar decrease in demonstrable levels of IL-2 mRNA, but IL-IO, IL-4 and IFN-?/ mRNA levels were elevated. 0 1997 Elsevier Science B.V. Keywords:

Ostertagia ostertagi;

Immunity;

Bovine: Cytokines

1. Introduction

The nematode Ostertagia ostertagi is the predominant cause of parasite-induced production losses in cattle throughout temperate regions of the world (Armour and Ogbourne, 1982). These losses are most commonly seen in young animals; however, subclinical infections and occasional outbreaks of disease in older cattle contribute to the overall cost of animal production (Snyder, 1993, Orpin, 1994). The importance of this parasitosis to the cattle industry is enhanced by the slow and incomplete development of immune responses that protect the host from reinfection (Armour, 1989., Ploeger et al., 1995).

* Corresponding

author. Tel.: (301) 504-8754:

Fax: (301) 504-8979.

0165-2427/97/$17.00 0 1997 Elsevier Science B.V. All rights reserved. PII SO1652427(96)05775-3

64

A. Canals et al./ Veterinary Immunology and Immunopathology

58 (1997) 63-75

Cytokines are biologically active polypeptides that control, among other things, the growth and differentiation of T and B lymphocytes. Many murine and some human CD4+ T-cell clones can be subdivided into subsets according to their distinct patterns of cytokine production: T helper 1 (Thl) lymphocytes produce a number of cytokines most notably IIN-?/ and IL-2, whereas T helper 2 (Th2) cells produce IL-4, IL-5, IL-6 and IL-10 among others. Resistance or susceptibility to a number of pathogens strongly correlates with the preferential expression of cytokines from Thl or Th2 subsets (Mosmann and Sad, 1996). The delineation of T helper cells into these two subtypes is not well defined in other animal species. Although some bovine T-cell clones may be differentiated into Thl or Th2 subsets, none of the clones show the highly restricted cytokine profiles seen in mice (Brown et al., 1993, 1994a). Consequently, because of the potential pluripotentiality of helper T-cells in these species, one must look at overall cytokine expression after immunization or infection to discern if the responses generated can be characterized by a Thl or Th2 profile. In this study, two recently developed assays, the RNase protection assay (RPA) and the competitive reverse transcriptase-polymerase chain reaction (RT-PCR), were used to quantify mRNA levels for selected T-cell cytokines and to define the cytokine profile induced in cattle infected with 0. ostertagi. Definition of cytokine responses in draining lymph nodes after infection may identify the basis for delayed development of protective immunity against 0. ostertagi.

2. Materials and methods 2. I. Animals The details of the experimental animals have been described elsewhere (Almeria et al., 1997). Briefly, eighteen castrated Holstein bull calves, 12 weeks of age, were used for these studies. Calves were acquired at 1 day of age and kept housed indoors in concrete-floored pens throughout the experiment to preclude extraneous parasite exposure. Calves were raised on whole milk until weaned at 8 weeks of age onto a 16% protein diet supplemented with alfalfa and orchard grass hay. Water was available ad libitum. 2.2. Host infection and sample collection Animals were infected and sacrificed as described (Almeria et al., 1997). Briefly, calves were experimentally infected with 2 X lo5 infective Ostertagia ostertagi larvae and groups of three calves were killed on the day of infection (day O), and on days 4, 11, 14, 21 and 28 after infection. Results of the experimental inoculation (worm burdens) were described in Almeria et al., 1997. Abomasal lymph nodes (ABLN) were collected aseptically at slaughter into ice-cold Hanks balanced salt solution without calcium and magnesium and supplemented with 1OOU ml-’ penicillin, 100 p,g ml-’ streptomycin, and 50 pgml-’ kanamycin. Lymph nodes were trimmed of adherent fat then weighed

65

A. Canals et al. / Veterinav Immunology and Immunopathology 58 (1997) 63-75 Table 1 Isotypes and predominant Monoclonal

specificity

of the monoclonal

antibody

MMIA CACTI38A CACTSOC CACTII6A CACT6IA PIg45A

antibodies

used in the study

Ig isotype

Predominant

IgGl IgG 1 IgG 1 IgG I

CD3 CD4 CD8 IL-‘R TcRI-N12

IgM IgG2b

specificity

IgM

and gently teased apart. The resulting cell suspensions were allowed to produce gravity sediment on ice for 10min. The supematant was removed and centrifuged at 4°C for 10 min at 300g. The cell pellet was resuspended in RPMI- 1640 and the cells counted. An aliquot of cells was subjected to RNA extraction procedures according to Chomczynski and Sacchi (1987). The remaining cells were cultured at 3 X lo6 cells per ml in complete medium (CM: RPM1 1640 with 5 X lop5 2-mercaptoethanol, 25 mM Hepes, 100 units per ml penicillin, 100 pg ml-’ streptomycin and 2.5 Fg ml- ’ gentomycin)

Table 2 Characteristics of cytokine and B-actin cDNA probes: size of the probes (bp), transcription vector, cloning site. the direction of the transcription (TS) and the restriction enzyme needed for sense and antisense linearization Interleukin

Size (bp)

Vector

Site

TS

Antisense-sense

BIL-2 BIFh-7 BP-Actin

480 470 190

pGEM 42 pGEM 1 pGEM 42

S S B-RI

T7 T7 T7

RI-B B-RI B-RI

d Anti-sense is used for normal in-vitro transcription; S (Sma I); B (Barn HI); RI (Eco RI).

sense is used to generate positive control RNA.

Table 3 Cytokine competitors. size (bp) of the fragment amplified reverse primer sequences used in the competitive RT-PCR Cytokine competitor

Size (bp)

a

from cDNA

and competitor.

and forward

Primer

cDNA

Competitor

IL-2

488

323

IL-4

400

310

IL-10

590

465

IFN-y

440

310

HPRT

230

186

GTACAAGATACAACTCTTGTCTTGC (F) TCAAGTCA-ITGTTGTTGAGTAGATGATGCTT ATGGGTCTCACCTACCAGCTG (F) CAACAC-ITGGAGTATITCTCCT (R) ATGCATAGCTCAGCACTACTCTGTTGCCTG TCACTTTTGCATCTTCGTTGTCATGTAGGTT TATGGCCAGGGCCAAT AGAGAAATA ‘ITACG’I-TGATGCTCTCCGGCCTCGAAAGAG GGAGATGATCTCTCAAC’I”ITAACTGG (F) CAlTATAGTCAAGGGCATATCCCAC(R)

(R)

(F) (R) (F) (R)

and

66

A. Canals et al./ Veterinary Immunology and Immunopathology

Table 4 Changes in the percentages

58 (1997) 63-75

of surface markers in cells isolated from the ABLN

Day

CD3

IL-2R

IGM

CD4

CD8

TcRl

0 4 11 14 21 28

1.00 1.13 a 1.00 0.85 0.81 0.92

1.00 2.12 2.55 2.03 I .88 1.70

1.00 1.Ol 1.73 a 1.64a 1.58 3. 1.56 a

1.00 1.27 a 1.30 1.00 1.03 1.17

1.00 1.82 B 1.51 I .43 0.98 1.39

1.00 2.08 3.08 3.91 3.01 3.40

a a a a a

Results are expressed as ratios of the mean of three individual animals at the different divided by the mean at day 0. Surface marker percentages were analyzed using analysis of variance.

a a = d a

days after infection

supplemented with 10% fetal bovine serum. Cultures were stimulated with 2.5 pg ml-’ concanavalin A (conA) and 5 ngml - * Phorbol 1Zmyristate 13-acetate (PMA). The cultures were maintained for 20 h before cells were recovered.

DAYSAFTERINFECTION 0

0

411

142128

411142128 Y-IFN

Fig. 1. Analysis of cytokine mRNA levels using the RNase protection assay. ABLN cell populations from the 18 experimental animals were stimulated in vitro with ConA and PMA for 20 h, and mRNA levels encoding IL-2 and y-EN were assayed using the RPA. Results are for a representative experiment in which three animals were sacrificed on each of the days 0, 4, 11, 14, 21 and 28 (18 animals in total). Purified total RNA was hybridized with probes for IL2 (480 bp) and II%-y (470 bp). A probe for the bovine P-Actin (194 bpl was used as control of equal RNA loading.

.4. Canals et al. / Veterinary Immunology and lmmunopathology

2.3. Immunojluorescent

58 (1997) 63-75

61

staining

ABLN cells were stained by indirect immunofluorescence (Almeria et al., 1997). The primary monoclonal antibodies (mAb) and their specificities for bovine leukocyte surface antigens are indicated in Table 1. Flow cytometry analysis was performed with an Epics Profile II flow cytometer (Coulter Corp., Hialeah, FL). The data were analyzed for significance using analysis of variance procedures (ANOVA). Test results were judged to be significant where P I 0.05. 2.4. RNase protection assay The IFN-7 and IL-2 probes were provided by Dr. M. Widmer (The Immunex Corporation) and were cloned into the Sma I site of pGem 1 and the BamHl-EcoRl site of pGem 42, respectively (Table 2). For control of the amount of RNA loaded in the gel a B-actin probe was generated in our laboratory by PCR amplification, and cloned into the BamHl-EcoRl site of pGem 42. The synthesis of radio-labelled antisense RNA (riboprobes) was performed using the Maxiscript in-vitro transcription kit (Ambion, Austin, TX) according to manufacturer’s instructions. The RPA was performed using the RNase protection kit from Boehringer Mannheim (Indianapolis, IN 46250) as follows: total RNA (5-20 p,g) was first ethanol precipitated with 3 X lo5 cpm of the 32P-labelled probe and then centrifuged. The resulting pellets were resuspended in 20 pl of hy-

IL-2

TRANSCRIPTION

DAY 0

DAY

dscDNA(488) Competitor(323)

11

fg 900 180 35 7.2 1.4 Fig. 2. Analysis of IL-2 mRNA expression in unstimulated ABLN cell populations using competitive RT-PCR. cDNAs (488 bp) were coamplified with 900, 180, 35, 7.2 and 1.4 fg of competitor (323 bp), separated by agarose gel electrophoresis and stained with ethidium bromide. Results are for a representative experiment of three animals sacrificed on each of the days 0. 11, 21 and 28 after infection.

68

A. Canals et al. / Veterinary immunology

and Immunopathology

58 (1997) 63-75

IL 10 TRANSCRIPTION

DAY

0

DAY

11

DAY

21

DAY

28

fg 50

20

4

0.8

0.1

Fig. 3. Analysis of IL-10 mRNA expression in unstimulated AESLN cell populations using competitive RT-PCR. cDNAs (590 bp) were coamplified with 50, 20.4,O.S and 0.1 fg of competitor (465 bp) separated by agarose gel electrophoresis and stained with ethidium bromide. Results are for a representative experiment of three animals sacrificed on each of the days 0, 11, 21 and 28 after infection.

bridization buffer, heated for 5 min at 90°C and then incubated overnight at 45°C. The next day, 300 pl of hybridization buffer containing RNase A (23 kg ml-‘) and RNase TI (82 U ml-‘) was added and the solution incubated for 30min at 30°C. RNase digestion was terminated by the addition of 10 p,l of a freshly prepared proteinase K-SDS solution (20mgml-’ proteinase K and 20% SDS) followed by a 15 min incubation at 37°C. The samples were phenol-chloroform extracted and ethanol precipitated using 5 pl of tRNA (5 mgml- ’ ) as a carrier. Pellets containing the protected fragments were dissolved in 5 l.~l of loading buffer, heated for 4 min at 90°C and electrophoresed on a 5% bis:acrylamide/8M urea sequencing gel. Dried gels were exposed to XAR film at -70°C. 2.5. Competitiue

RT-PCR

Competitor molecules for bovine IL-2, IL-4, IL-lo, IPN-?I and hypoxanthine phosphoribosyltransferase (HPRT) were constructed as previously described (Zarlenga et al., 1995). The characteristics of each competitor, including cloning vector and primer

A. Canals et al. / Veterinary

Immunologyand Immunopathology58 (1997)63-75

69

sequences are given in Table 3. The cDNA was synthesized in a total volume of 40 pl using 10 pg of total RNA using the Superscript Preamplification System (Life Technologies, GibcoBRL). For competitive PCR, 120 ~1 of a master mix containing 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl,, 50 mM KCl, 200 PM dNTP, 0.2 t.r,M of each primer and 3 ~1 of cDNA was prepared for each cDNA sample and each cytokine. Five serial dilutions of the competitor molecule were made and 5 ~1 of each were added separately to the PCR tubes, followed by 20 pl of the master mix. The mixture was cycled 35 times at 94°C for 1 min, 55°C for 1 min and 72°C for 2 min. PCR products from each tube were separated on a 2% Metaphore:GTG (1.8:0.2 wt/wt) agarose gel and stained with ethidium bromide.

3. Results 3. I. Sugace

marker phenogpes

Abomasal lymph node cells from calves exposed to a primary experimental infection with 0. ostertagi showed a number of changes in the ratios of cells expressing subset

IL-4

DAY 0

DAY

11

DAY

21

TRANSCRIPTION

dscDNA(400) Competitor(310)

Fig. 4. Analysis of IL-4 mRNA expression in unstimulated ABLN cell populations using competitive RT-PCR. cDNAs (400 bp) were coamplified with 40, 13, 4.4, 1.5 and 0.4 fg of competitor (310 bp) separated by gel electrophoresis and stained with ethidium bromide. Results are for a representative experiment of three animals sacrificed on each of the days 0, 11, 21 and 28 after infection.

70

A. Canals et al./

Veterinary Immunology and lmmunopathology

58 (1997) 63-75

and activation markers after infection (Table 4). There was a two-fold increase, as early as 4 days after infection, in the numbers of IL2R+ and TcRl+ cells. When the actual percentages of stained cells were analyzed these increases were found to be statistically significant, and remained significant throughout the remainder of the experiment. Additionally, the proportion of IgM+ cells also increased two-fold. However, in this case, the change was delayed until 11 days post-infection when differences became statistically significant, and remained as such until the end of the experiment. Following an initial increase at day 4, the ratios of CD3+ cells decreased throughout the remainder of the experiment. Ratios of CD4+ and CD8+ cells showed inconsistent changes during the first 4 weeks of infection; however, a significant increase was observed only at day 4 after infection. 3.2. Cytokine mRNA profiles in conA-Ph4A stimulated ABLN Abomasal lymph node cells of the 18 animals killed at different times after 0. ostertagi infection were stimulated in vitro with ConA and PMA for 20 h, and subsequent induction of transcripts for IL2 and IFN-)I was examined using the RPA.

IFN- y

TRANSCRIPTION

DAY 0

DAY 11

DAY 21

Fig. 5. Analysis of IFNq mRNA expression in unstimulated ABLN cell populations using competitive RT-PCR. cDNAs (440 bp) were coamplified with 11.2, 2.2, 0.45, 0.09 and 0.01 fg of competitor (310 bp), separated by gel electrophoresis and stained with ethidium bromide. Results are for a representative experiment of three animals sacrificed on each of the days 0, 11. 21 and 28 after infection.

A. Canals et al./ Veterinary Immunology and lmmunopathology

58 (1997) 63-75

71

Preliminary studies indicated that a 20 h, in-vitro stimulation was optimal for the simultaneous analysis of IL-2 and IFN-y mRNA synthesis (data not shown). Following stimulation, high levels of both cytokines were found in two of the three uninfected animals. However, in infected calves, mRNA levels for IFN-)I and IL-2 decreased as early as 4 days post-infection and remained low through to day 21 before returning to preinfection levels 28 days post-infection (Fig. 11. To corroborate the results obtained in stimulated samples using the RPA, cDNA was prepared from one set of six animals. This cDNA was analyzed for both IL-2 and IFN-y using the competitive RT-PCR. Results obtained by this method were comparable to the RPA (data not shown). 3.3. Cytokine mRNA profiles in unstimulated

ABLN

Equal amounts of total RNA (10 pg) isolated from nonstimulated ABLN populations were reverse transcribed to cDNA for use in RT PCR. Amplification was performed in duplicate for each set of samples using HPRT as an internal control (data not shown). Transcripts for both IL-10 and IL-4 increased after infection with 0. ostertugi. Competitive RT-PCR performed at days 11, 21 and 28 post-infection showed a five-fold increase in the IL-10 mRNA by day 11, and remained elevated throughout the experiment, Representative results from three animals are shown in Fig. 2. Similarly, there was a dramatic increase in IL-4 mRNA by day 11 post-infection. Levels of IL-4 mRNA remained elevated until day 28 when the levels decreased slightly but remained substantially above control values (Fig. 3). In contrast, IL-2 mRNA levels decreased five-fold by day 11, and remained at this level throughout the experiment (Fig. 4). Levels of mRNA for IFN=y increased 25fold over uninfected levels by day 11, and remained elevated through to day 28 (Fig. 51.

4. Discussion It has been previously documented that protective immune responses against 0. ostertugi are both weak and delayed (Armour, 19891. Reductions in the number of adult worms can only be initiated by repeated experimental infections or prolonged exposure to naturally contaminated pastures (Michel et al., 1973; Armour, 1989; Hilderson et al., 1995). It is also well established that cytokines play important roles in the regulation of immune responses against infectious agents. Thus, to better understand the basis for the delayed functional immunity against this parasite, changes in cell surface phenotype and mRNA levels of T-cell cytokines were investigated in cattle following a primary infection with 0. ostertagi. Previous studies have shown that the ABLN are the primary site of antigen presentation in 0. ostertugi infections (Gasbarre, 1994). In agreement with this, following infection within the ABLN, a rapid increase in both B-cell and y&T-cell numbers occurs. In young sheep and cattle, y&T-cells account for up to 30-50% of PBMC T-cells. It has been proposed that the expansion of this subset is associated with rejection of Trichostrongylus colubrifovnis in sheep (McClure et al., 1992); however, in the present report, a significant increase in the percentages of TcRl’ cells occurs even

12

A. Canals et al. / Veterinary Immunology and lmmunopathology

58 (1997) 63-75

though primary 0. ostertagi infections do not elicit strong protective immune responses. As such, it is unlikely that, in cattle, this subset is linked to protective immunity against 0. ostertagi. An increase in the level of B cells (IgM+) has been reported elsewhere (Baker et al., 1993) and is consistent with the strong serum antibody responses elicited by the parasite (Canals and Gasbarre, 1990; Hilderson et al., 1993). Associated with these changes, we also observed an increase in the proportion of activated cells as measured by the expression of IL-2 receptors. Identical changes in the percentages of cell surface markers were found at the mucosal level (lamina propria and intraepithelial populations) in a simultaneous study performed with the same group of animals (Almeria et al., 1997). Although cellular changes in lymphoid tissues of 0. ostertagi-infected cattle have been reported (Baker et al., 1993; Gasbarre, 1994) no information is currently available on changes in cytokine gene expression in infected cattle. Measurement of cytokine mRNA transcription in cattle has proven to be a reliable indicator of protein production (Hutchinson et al., 1994; Prud’homme et al., 1995; Schulze-Koops et al., 1995). In order to determine the capacities for cytokine production, ABLN cells were taken from infected animals and polyclonally stimulated in vitro. These cells showed a substantial reduction after infection in the transcription of both IL-2 and EN-y. Transient decreases in T-lymphocyte reactivity to T-cell mitogens after 0. ostertagi infections have been reported elsewhere (Klesius et al., 1984; Snider et al., 1986; Wiggin and Gibbs, 1990). This diminished capacity of ABLN cells to respond positively to mitogenic stimulation may be a result of a general decrease in T-lymphocyte reactivity. Alternatively, these results may indicate a down-regulation of Thl responses. Previous reports have indicated problems in equating the potential for cytokine mRNA synthesis, measured by polyclonal stimulation, with actual cytokine mRNA synthesis in vivo (Hobbs et al., 1993). Similarly in this study, cytokine mRNA assayed in cells taken directly from calves without in-vitro stimulation exhibited high levels of IFN-?/ in contrast to the decrease IFN-y seen after in-vitro stimulation. The high expression levels of IFN-v transcription were accompanied by elevation in the percentages of y&T-cells within the population. Since bovine y&T-cells (Skeen and Ziegler, 1995; Reiner and Locksley, 1995) and y&T-cell lines (Brown et al., 1994b) have both been described as capable of expressing IFN-y, the high levels of this cytokine observed in unstimulated populations may have its origin in the expansion of this subset of cells. Analysis of unstimulated ABLN cells also showed moderate changes in IL-2 and IL-10 mRNA in parasite-infected animals. These cytokines exhibited a five-fold decrease and a five-fold increase in transcription, respectively. Greater changes might be seen after antigen-specific restimulation of the cells; however, 0. ostertagi antigen possesses weak immunogenicity in cellular proliferation assays. Alternatively, since whole ABLN populations were tested, the observed effects on specific cell subsets may have been diluted, and, as such, isolation of the cytokine producer T-cell subsets might result in greater differences as observed in other cytokine quantification studies (Flynn et al., 1995). The most pronounced changes resulting from 0. ostertagi infections, however, were seen in the elevation of transcription of both IL-4 and IFN-y using unstimulated ABLN cells. Assenmacher et al. (1994) have shown that these cytokines are mutually exclusive

A. Canals et al. / Veterinar?, Immunology and lmmunopathology

58 (1997) 63-75

73

in individual murine T-cells, However, in the present study, infection caused an increase in both IgM+ and TcRl+ cells. The increase in IgM+ (B cells) cells is consistent with an increase in IL-4. However, as previously indicated, the increase of TcRl+ may also be responsible for the elevated levels of IFN=y mRNA. Although IL-4 and EN-), are usually equated with opposite effector mechanisms, concurrent increases in these cytokines have been described both in vivo (Henderson et al., 1992) and in vitro (Nishimura et al., 1996). Classically, in murine models, Thl cytokines, including IL-2 and EN-y, are involved in protection against intracellular pathogens, and Th2 cytokines, including IL-4 and IL-lo, are required for protection against extracellular pathogens (review Finkelman and Urban, 1992). However, exceptions have been described for Trichinellu spiralis (Pond et al., 1989), Schistosoma mansoni @her et al., 1990), and Coccidioides immitis (Magee and Cox, 1995). In addition, others have proposed that in-vivo cytokine immune responses may not be only restricted to the response of discrete subsets but that different combinations of cytokine responses can be elicited by infectious agents (Kelso, 1995). In the present study of ABLN, a non-protective 0. ostertagi primary infection resulted in a reduction in the percentage of T-cells, an increase in the percentage of B cells, and changes in cytokine mRNA expression characterized by decreased levels of IL-2 and increases in IL-4 and IL-10 transcription. These observations are consistent with a Th2 immune response; however, the infected cattle also show elevated amounts of mRNA for IFN-1, in unstimulated ABLN cells. These facts, together with the unrestricted cytokine secretion patterns of bovine T-cell clones (Brown et al., 1993, 1994a) suggest that, in cattle, the Thl and Th2 paradigm may not be as clearly delineated as in the mouse model.

Acknowledgements The authors would like to thank Lisa Davis for her skilled technical

assistance.

References Almeria, S.. Canals, A., Zarlenga, D.S., Gasbarre, L.C., 1997. Isolation and phenotypic characterization of abomasal mucosal lymphocytes in the course of a primary Ostertagia ostertagi infection. Veterinary Immunology and Immunopathology, (in press). Armour, J., Ogboume, C.P., 1982. Bovine Ostertagiasis: A Review and Annotated Bibliography. Commonwealth Agricultural Bureaux Publication No. 7. 93 pp. Armour, J., 1989. The influence of host immunity on the epidemiology of trichostrongyle infections in cattle. Veterinary Parasitology 32, 5- 19. Assenmacher. M., Schmitz. J.. Radbruch, A., 1994. Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-IO in interferon-y and in interleukin-4.expressing cells. European Journal of Immunology 24, 1097-l 101. Baker, D.G., Scott, J.L., Gershwin, L.J., 1993. Abomasal lymphatic lymphocyte subpopulations in cattle infected with Ostertagia ostertagi and Cooperia sp. Veterinary hnmunology and Immunopathology 39, 467-473.

14

A. Canals et al. / Veterinary Immunology and Immunopathology

58 (1997) 63-75

Brown, W.C., Woods, V.M., Dobbelaere, A.E., Logan, KS., 1993. Heterogeneity in cytokine profiles of Babesia bobis-specific bovine CD4+ T-cell clones activated in vitro. Infection and Immunity 61 (8). 3273-3281. Brown, W.C., Davis, W.C., Dobblelaere, A.E., Rice-Ficht, A.C., 1994a. CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles. Infection and Immunity 62 (3), 818-827. Brown, W.C., Davis, W.C., Choi, S.H., Dobbelaere, D.A., Splitter. G.A., 1994b. Functional and phenotypic characterization of WCI+ y/S T-cells isolated from Babesia bouis-stimulated T-cell lines. Cellular Immunology 153, 9-27. Canals, A., Gasbarre, L.C., 1990. Osterragia ostertagi: isolation and partial characterization of somatic and metabolic antigens. International Journal of Parasitology 20, 1047-1054. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanatephenol-chloroform extraction. Analytical Biochemistry 162, 156-159. Finkelman, F.D., Urban. J.F., 1992. Cytokines: making the right choice. Parasitology Today 8 (91, 311-314. Flynn, J.L., Golstein, M.M., Triebold. K.J.. Sypek, J., Wolf, S., Bloom, B.R.. 1995. IL-12 increases resistance of BALB/c mice to Mycobacterium tuberculosis infection, Journal of Immunology 155, 2515-2524. Gasbatre, L.C., 1994. Ostertagia ostertagi: changes in lymphoid populations in the local lymphoid tissues after primary or secondary infection. Veterinary Parasitology 55, 105- 114. Henderson, G.S., Lu, X., McCurley, T.L., Colley, D.G., 1992. In vivo molecular analysis of lymphokines involved in the murine immune response during Schistosoma mansoni infection. Jounal of Immunology 148, 2261-2269. Hilderson, H., Degraaf, D.C.. Vercruysse, J.. Berghen, P.. 1993. Characterization of Ostertagia ostertagi antigens by different bovine immunoglobulin types. Research in Veterinary Science 55, 203-208. Hilderson, H., Vercruysse, J., Claerebout. E., De Graaf, D.C., Fransen, J., Berghen, F.P., 1995. Interactions between Ostertagia ostertagi and Cooperia oncophora in calves. Veterinary Parasitology 56, 107-I 19. Hobbs, M.V., Weigle, W.O.. Noonan, D.J., Torbett, B.E., McEvilly, R.J., Koch, R.J., Cardenas, G.J., Ernst. D.N., 1993. Patterns of cytokine gene expression by CD4+ T-cells from young and old mice. Journal of Immunology 150, 3602-3614. Hutchinson. L.E.. Stevens, M.G., Olsen. S.C., 1994. Cloning bovine cytokine cDNA fragments and measuring bovine cytokine mRNA using the reverse transcription-polymerase chain reaction, Veterinary Immunology and Immunopathology 44, 13-29. Kelso. A., 1995. Thl and Th2 subsets: paradigms lost? Immunology Today 16 (81, 374-379. Klesius, P.H., Washburn, S.M., Ciordia, H.. Haynes, T.B., Snider, T.G., 1984. Lymphocyte reactivity to Ostertagia ostertagi L, antigen in type I ostertagiasis. American Journal of Veterinary Research 45 (21, 230-233. Magee, D.M., Cox. R.A., 1995. Roles of gamma interferon and interleukin-4 in genetically determined resistance to Coccidioides immitis. Infection and Immunity 63 (91, 33 14-35 19. McClure. S.J., Elmery, D.L.. Wagland, B.M., Jones. W.O.. 1992. A serial study of rejection of Trichostrongyhrs colub$ormis by immune sheep. International Journal of Parasitology 22 (21. 227-234. Michel. J.F., Lancaster, M.B., Hong, C., 1973. Ostertagia ostertagi: protective immunity in calves: the development in calves of a protective immunity to infection with Ostertagia ostertagi. Experimental Parasitology 33. 1799186. Mosmann, T.R., Sad. S.. 1996. The expanding universe of T-cell subsets: Thl, Th2 and more. Immunology Today 17 (31, 138-146. Nishimura, H., Hiromatsu, K.. Kobayashi, N., Grabstein. K.H., Paxton, R., Sugamura, K., Bluestone, J.A., Koshikai, Y.. 1996. IL-15 is a novel growth factor for murine ~8 T-cells induced by Salmonella infection. Journal of Immunology 156. 663-669. Orpin, P.G., 1994. Ostertagiasis in suckler cows. Veterinary Record, December 10, 584. Ploeger, H.W., Kloosterman, A., Rietveld, F.W., 1995. Acquired immunity against Cooperia “pp., Ostertagia spp. in calves: effect of level of exposure and timing of the midsummer increase. Veterinary Parasitology 58, 61-74. Pond, L.. Wassom, D.L.. Hayes, C.E., 1989. Evidence for differential induction of helper T-cell subsets during Trichinella spiralis infection. Journal of Immunology 143, 4232-4240. Prud’homme. G.J., Kono, D.H., Theofilopoulos, N.. 1995. Quantitative polymerase chain reaction analysis

A. Canals et al. / Veterinq

Immunology and Immunopathology

58 (1997) 63-75

75

reveals marked overexpression of interleukin-lB, interleukin-10 and interferon-y mRNA in the lymph nodes of lupus-prone mice. Molecular Immunology 32 (71. 495-503. Reiner, S.L., Locksley. R.M., 1995. The regulation of immunity to Lrishmatzia mayor. Annual Review ot Immunology 13, 151-177. Schulze-Koops, H., Lipsky, P.E., Kavanaugh. A.F., Davis. L.S., 1995. Elevated Thl- or ThO-like cytokine mRNA in peripheral circulation of patients with rheumatoid arthritis. Journal of Immunology 155, 5029-5037. Sher, A.. Coffman, R.L., Hieny, S., Scott, P., Cheever, A.W., 1990. Interleukin-5 is required for the blood and tissue eosinophilia hut not the granuloma formation induced by infection with Schistosoma mansoni. Proceedings of the National Academy of Science USA 87, 61-69. Skeen, M.J., Ziegler, H.K., 1995. Activation of y8-T cells for production of IFN-y is mediated by bacteria via macrophage-derived cytokines IL-l and IL-12. Journal of Immunology 154, 5832-5841. Snider, T.G., Williams. J.C., Kams, P.A.. Romaire. T.L.. Trammel. H.E., Keamey. M.T., 1986. lmmunosuppression of lymphocyte blastogenesis in cattle infected with Ostertagin mtertagi and/or TricAostrong&u axei. Veterinary Immunology and Immunopathology 1 I, 25 l-264. Snyder, D.E.. 1993. Epidemiology of Ostertagia ostertagi in cow calf herds in the Southeastern USA. Veterinary Parasitology 46, 277-288. Wiggin. C.J.. Gibbs. H.C., 1990. Adverse Immune reactions and the pathogenesis of Ostertagia ostertagi infections in calves. American Journal of Veterinary Research 5 1 (51, 825-832. Zarlenga, D.S., Canals. A.. Gasbarre. L.C., 1995. Method for constructing internal standards for use in competitive PCR. Biotechniques 19 (31, 324-326.