Cytotoxicity and gene expression profiling of polyhexamethylene guanidine hydrochloride in human alveolar A549 cells

Toxicology in Vitro 28 (2014) 684–692

Contents lists available at ScienceDirect

Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit

Cytotoxicity and gene expression profiling of polyhexamethylene guanidine hydrochloride in human alveolar A549 cells Ha-Na Jung 1, Tamanna Zerin 1, Biswajit Podder, Ho-Yeon Song ⇑, Yong-Sik Kim ⇑ Department of Microbiology, College of Medicine, Soonchunhyang University, South Korea

a r t i c l e

i n f o

Article history: Received 25 October 2013 Accepted 15 February 2014 Available online 25 February 2014 Keywords: Polyhexamethylene guanidine Microarray ROS Apoptosis Cytotoxicity

a b s t r a c t In Korea, lung disease of children and pregnant women associated with humidifier disinfectant use has become a major concern. A common sterilizer is polyhexamethylene guanidine (PHMG), a member of the guanidine family of antiseptics. This study was done to elucidate the putative cytotoxic effect of PHMG and the PHMG-mediated altered gene expression in human alveolar epithelial A549 cells in vitro. Cell viability analyses revealed the potent cytotoxicity of PHMG, with cell death evident at as low as 5 lg/mL. Death was dose- and time-dependent, and was associated with formation of intracellular reactive oxygen species, and apoptosis significantly, at even 2 lg/mL concentration. The gene expression profile in A549 cells following 24 h exposure to 5 lg/mL of PHMG was investigated using DNA microarray analysis. Changes in gene expression relevant to the progression of cell death included induction of genes related to apoptosis, autophagy, fibrosis, and cell cycle. However, the expressions of genes encoding antioxidant and detoxifying enzymes were down-regulated or not affected. The altered expression of selected genes was confirmed by quantitative reverse transcription-polymerase chain reaction and Western blot analyses. The collective data suggest that PHMG confers cellular toxicity through the generation of intracellular reactive oxygen species and alteration of gene expression. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction The guanidine family of antiseptics has been popular for many decades. One of the family members is polyhexamethylene guanidine phosphate (PHMG), a cationic polymer with low toxicity (class III-toxicity) compared to currently used disinfectants. PHMG is widely-used as an antiseptic in the textile, agriculture, and lumber sectors; in medicine and in waste water treatment because of its water solubility and flavorless, odorless and colorless properties (Kuznetsov, 2004; McDonnell and Russell, 1999; Muller and Kramer, 2005). It can chemically bind to or coat various chemicals to prepare anti-microbial materials that avoid the problems of conventional anti-microbial compounds, such as leakage or elution (Guan et al., 2008; Lee et al., 2000). Even low doses of PHMG, such as 13 lg/mL, have an effective bactericidal effect (Zhou et al., 2010). Epidemiologically, the lethal dose of 50% mortality (LD50)

⇑ Corresponding authors. Address: Department of Microbiology, School of Medicine, Soonchunhyang University, Cheonan, Chungnam 330-090, South Korea. Tel.: +82 41 570 2412; fax: +82 041 577 2415 (H.-Y. Song). Tel.: +82 570 2413; fax: +82 041 577 2415 (Y.-S. Kim). E-mail addresses: [email protected] (H.-Y. Song), [email protected] (Y.-S. Kim). 1 These authors contributed equally to this study. http://dx.doi.org/10.1016/j.tiv.2014.02.004 0887-2333/Ó 2014 Elsevier Ltd. All rights reserved.

value for PHMG has been reported as 450 mg/kg in mice and 630 mg/kg in rats (Condrashov, 1992). In 2011, an incident in Korea linked to the use of sterilizers used in humidifier equipment caused 91 cases of illness, mostly involving pregnant women and children, and 28 deaths due to pulmonary fibrosis. Four of those who died were pregnant women. The Korean Ministry of Health and Welfare ordered a mandatory recall following a warning from the Korea Centers for Disease Control and Prevention (KCDC) against the use of any brand of sterilizer for humidifiers. The warning was based on preliminary tests on mice that revealed the development of pulmonary fibrosis or scarring of lungs. The principal active ingredients among the recalled sterilizer formulations were PHMG and oligo (2-(2-ethoxy)-ethoxyethyl)-guanidinium-chloride (PGH) (Park, 2011). In Russia, acute poisoning of over 12,500 patients, of whom 9.4% died, occurred from August 2006 to May 2007. Many of the victims were regular consumers of surrogate and elicit alcohol not intended for human consumption that contained diethyl phthalate (DEP) and PHMG (Ostapenko et al., 2011). Despite these incidences, PHMG has not garnered enough research attention in connection with adverse effects on human health. It is presumed that consumption of surrogate alcohol containing PHMG hinders lipid metabolism that ultimately results in liver injuries, particularly toxic hepatitis. A study assessing the

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

clinical manifestations and laboratory data from 579 poisoned patients posited that cholestatic hepatitis was caused due to the consumption of PHMG-containing alcohol (Ostapenko et al., 2011). In another study, 50 mg/kg/day of PHMG was intraperitoneally injected in white rats and acute inflammation, toxic hepatitis, immune suppression, and toxic changes in the kidney and pancreas were evident within 2–3 days (Solodun et al., 2011). Another recent study reported that conventional doses of PHMG and PGH are toxic, causing an atherogenic process and aging in human cells and severe inflammation and embryonic toxicity in zebrafish (Kim et al., 2013). Presently, we profiled microarray gene expression following exposure of human alveolar A549 cells to PHMG. The changes of expression were associated with apoptosis- and fibrosis-related genes. The changes of selected genes were confirmed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blot analyses. In addition, generation of intracellular reactive oxygen species (ROS), and apoptosis assays were performed to gain insight into the mode of action of PHMG in A549 cells. 2. Materials and methods 2.1. Reagents PHMG was purchased from Chemner (Chongqing, China). TritonX100, Trypan blue stain and 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT) were obtained from Sigma–Aldrich (St. Louis, MO, USA). Lactate dehydrogenase (LDH) assay kit, total ROS detection kit, and 2,7-dichlorofluorescein diacetate (H2DCFDA) were obtained from Roche (Mannheim, Germany), Enzo Life Sciences (Farmingdale, NY, USA), and Invitrogen (Carlsbad, CA) respectively. Primary antibodies of mouse against p53, Egr-1; rabbit against FAS, goat against NQO1, and horseradish peroxidase-conjugated secondary anti-rabbit, antigoat, and anti-mouse IgG were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit antibodies against Bcl2L1, Mcl-1, Bax, Bid, bbc3, Bak, Claudin-1, and CDK6 were purchased from Cell Signaling Technology (Danvers, MA, USA). Mouse anti-bactin antibody was purchased from Abcam (Cambridge, MA, USA). Rabbit anti-GDF15/NAG1 polyclonal antibody was a generous gift from Dr. Seung Joon Baek (University of Tennessee, Knoxville, USA). 2.2. Cell culture and treatment A549 human lung adenocarcinoma cells (CCL 185; ATCC, Manassas, VA, USA), IMR-90 primary human fibroblasts (CCL 186; ATCC), and HCT116 human colon carcinoma cells (CCL-247; ATCC) were grown in standard Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F-12, DMEM, and McCoy’s 5A cell culture medium, respectively, supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS), 1% (v/v) antibiotic/antimycotic cocktail (100 U/mL penicillin, 100 lg/mL streptomycin, and 0.25 lg/mL amphotericin B; Invitrogen, Carlsbad, CA, USA) at 37 °C under saturating humidity in 5% CO2/95% air. Primary human bronchial epithelial BEAS-2B cells (CRL-9609; ATCC) were maintained in bronchial epithelial growth medium (BEGM; Clonetics, Walkerwille, MD, USA). The PHMG working solution was freshly prepared in distilled water each time prior to the treatment. 2.3. Cell viability assay Cells were cultured in 96-well tissue culture plates overnight under 70–80% confluence and treated with PHMG (1, 5 and 10 lg/mL) for 24 and 48 h. MTT solution (20 lL of 5 mg/mL) was added to each well and incubated at 37 °C for 4 h. Following incubation, media were aspirated and 100 lL dimethyl sulfoxide

685

(DMSO) was added to dissolve the formazan crystals produced by MTT. The plate was incubated for an additional 30 min at 37 °C to fully dissolve the crystals and the absorbance was measured at 590 nm by using a Victor™ X3 multilabel reader (Perkin Elmer, Waltham, MA, USA). Cell density was visually inspected by phase-contrast microscopy using an Axiovert-25 inverted fluorescent Microscope (Carl Zeiss, Jena, Germany). 2.4. Detection of total ROS generation The generation of total ROS was monitored using a total ROS detection kit from Enzo Life Sciences (Farmingdale, NY, USA). A549 cells were seeded in 6-well cell culture plates at a density of 2  105 cells/mL and grown to 60–70% confluence overnight. Medium was aspirated and the ROS detection solution was added and incubated for 1 h at 37 °C. Following incubation, the ROS detection reagent was removed and washed with 1X wash buffer. Then, cells were treated with 0, 5 and 10 lg/mL of PHMG for 3 h and washed twice with 1X wash buffer. Images were obtained using an Axiovert-25 inverted fluorescent microscope (Carl Zeiss). Quantitative measurement of intracellular ROS generation by PHMG was detected using 2,7-dichlorofluorescein diacetate (H2DCFDA) from Invitrogen (Carlsbad, CA). The ROS detection protocol from Invitrogen had been modified little in our current study. In brief, A549 cells were collected and a concentration of 2  105 cells/mL were labeled with 20 lM H2DCF-DA reagent and incubated for 30 min at normal cell culture condition. After incubation, cells were washed with 1X HBSS buffer and then, cells were seeded with indicated concentrations of PHMG and N-acetyl-L-cysteine (NAC) in a black 96-well cell culture plate for additional 2 h incubation. Intracellular fluorescence was detected using a Victor™ X3 multilabel reader (Perkin Elmer, Waltham, MA, USA) with an excitation wavelength of 485 nm and emission wavelength of 530 nm. 2.5. Microarray A549 cells (2  105 cells/mL) were seeded in 6-well plates, incubated overnight, and treated with 5 lg/mL PHMG for 24 h. Cells were harvested and total RNA was extracted using a RNeasy Mini kit (Qiagen, Valencia, CA, USA). For control and test RNAs, the synthesis of target cRNA probes and hybridization were performed using a LowInput QuickAmp Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions. Briefly, each 25 ng total RNA and T7 promoter primer were mixed and incubated at 65 °C for 10 min. cDNA master mix (5X first strand buffer, 0.1 M DTT, 10 mM dNTP mix, RNase-Out, and MMLV-RT) was prepared and added to the reaction mix. The samples were incubated at 40 °C for 2 h and the reverse transcription and dsDNA synthesis was terminated by incubating at 70 °C for 10 min. The transcription master mix was prepared as specified in the manufacturer’s protocol (4X Transcription buffer, 0.1 M dithiothreitol, NTP mix, 50% polyethylene glycol, RNase-Out, inorganic pyrophosphatase, T7-RNA polymerase, and Cyanine 3/5-CTP). Transcription of dsDNA was performed by adding the transcription master mix to the dsDNA reaction samples and incubating at 40 °C for 2 h. Amplified and labeled cRNA was purified on a RNase mini column (Qiagen) according to the manufacturer’s protocol. Labeled cRNA target was quantified using a ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). After checking labeling efficiency, each 850 ng of cyanine 3-labeled and cyanine 5-labeled cRNA target were mixed and the fragmentation of cRNA was performed by adding 10  blocking agent and 25  fragmentation buffer, and incubating at 60 °C for 30 min. The fragmented cRNA was resuspended with 2X hybridization buffer and directly pipetted onto an assembled Human GE 4X 44 K v2 Microarray (Agilent Technologies). The array was hybridized at 65 °C for 17 h using a

686

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

Table 1 List of primers for qRT-PCR. Gene bank

Gene

Forward primers (50 ? 30 )

Reverse primers (50 ? 30 )

Amplicon (bp)

NM_002228 NM_000602 NM_000600 NM_000043 NM_000565 NM_015675 NM_138764

JUN SERPINE1 IL6 FAS IL6R GADD45B BAX

GGTAGCAGATAAGTGTTGAG CATGACCAGGCTGCCCCGCC CTGCAGGCACAGAACCAGTG TAACTCTACTGTATGTGAAC GTACCACTGCCCACATTCCT ACACGGACGCCTGGAAGAGC CAGCTCTGAGCAGATCATGA

CAGTTCGGACTATACTGCCG TCAGCCTGAAACTGTCTGAA TCTGAGGTGCCCATGCTACA CACTTGGTGTTGCTGGTGAG TACGGCGGATGCATGCTTGT GCAACTCAACAGATTCTGCT CCGATGCGCTTGAGACACT

150 120 120 90 140 140 159

hybridization oven (Agilent Technology, USA). The hybridized microarrays were washed as the manufacturer’s washing protocol (Agilent Technologies). The hybridization images were analyzed by a DNA microarray scanner (Agilent Technologies) and the data were quantified using Feature Extraction software 10.7 (Agilent Technologies). The average fluorescence intensity for each spot was calculated and local background was subtracted. All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 (Agilent Technologies). Genes were filtered with removing flag-out genes in each experiment. Intensity-dependent normalization (LOWESS) was performed, where the ratio was reduced to the residual of the Lowess fit of the intensity vs. ratio curve. The averages of normalized ratios were calculated by dividing the average of normalized signal channel intensity by the average of normalized control channel intensity. Functional annotation of genes was performed according to the

100 80

* *

40 20

A549 cells (2  105 cells/mL) were seeded in 6-well plates, incubated overnight, and then treated with the specified concentrations of drugs for indicated periods. Cells were harvested by trypsinization and total RNA was extracted using the RNeasy Mini Kit (Qiagen) and quantified using a ND-1000 spectrophotometer (NanoDrop Technologies) at 260 nm. The purity of RNA was assessed using the 260 nm/280 nm ratio, which was always within 1.8–2.0, indicating high purity. cDNA synthesis was performed

B

IMR-90

60

2.6. qRT-PCR

* *

* *

100

0

24 h 48 h

*

80

*

60 40

*

20

0

1

5

10

D

HCT116

120 100

*

*

*

80

*

60 40

*

20 0

* *

0

Cell viability (%)

Cell viability (%)

C

A549

120

Cell viability (%)

Cell viability (%)

A 120

Gene Ontology™ Consortium (http://www.geneontology.org/ index.shtml) of GeneSpringGX 7.3.1. The significant changes in gene expression by PHMG are available in the supplemental data and the whole gene list has been deposited in the NCBI public database as accession number GSE41156.

0

1

5

10 (µg/mL)

BEAS-2B

120 100

*

80 60 40 20

* *

* *

0 0

1

5

10

0

E

F

G

H

I

J

1

5

10 (µg/mL)

Fig. 1. Cell viability assessment performed with 0, 1, 5 and 10 lg/mL of PHMG on IMR-90 (A), A549 (B), HCT116 (C), and BEAS-2B (D) cells for 24 and 48 h. Morphological changes of IMR-90 (E–G) and A549 (H–J) cells with 0 (E, H), 2 (F, I), and 5 (G, J) lg/mL of PHMG were observed by phase-contrast microscopy. Asterisk () denotes significant differences between PHMG treatment and control groups at each time point, P < 0.05, one-way ANOVA with Dunnett’s test.

687

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

with 500 ng of each RNA sample with a random primer (Maxime RT Premix kit, Intron Biotechnology, Korea) following the company instruction in a VeritiÒ 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). qRT-PCR was performed for the amplification of cDNA using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) kit with a CFX96TM real-time PCR detection system (BioRad). PCR was performed with 5 lL of 20-fold diluted cDNA sample in triplicate using the following protocol: 95 °C for 5 min followed by 40 cycles of 95 °C for 10 s, 42 °C for 10 s, and 72 °C for 20 s. A dissociation curve was acquired to ensure the specificity of the PCR product in every PCR assay. The assay results were normalized to the endogenous control gene, glyceraldehyde 3-phosphate dehydrogenase, GAPDH (F: 50 -TCCCATCACCATCTTCCA-30 and R: 50 -CATCACGCCACAGTTTCC-30 ). Relative quantification was acquired using the comparative threshold cycle (DDCT) method. All other primer sequences are listed in Table 1, except for GSR, and GPX2, that were used from AccuTarget™ validated Human Antioxidant Real-Time PCR primer set (PHS-001050; Bioneer, Korea). 2.7. Western blot Western blot analysis was performed as previously described (Zerin et al., 2012). In brief, following treatment of cells with indicated doses of PHMG for indicated periods, proteins were collected using RIPA lysis buffer containing 1X lysis buffer, phenylmethylsulfonyl fluoride (PMSF) in DMSO, sodium orthovanadate in water and protease inhibitor cocktail in DMSO (Santa Cruz Biotechnology). Protein concentrations were measured using Pierce BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). Subsequently, 15 lg of proteins were separated by sodium dodecyl sulfate 4–20% polyacrylamide gradient electrophoresis (Mini-PROTEANÒ TGX™ Precast Gel; Bio-Rad) at 100 V for 1.30 h and transferred to a polyvinylidene fluoride membrane (Trans-Blot SD Semi-Dry Cell; Bio-Rad). The membranes were blocked with 5% skim milk for 1 h and were incubated with primary antibody overnight followed by a second incubation with specific horseradish peroxidase-conjugated secondary antibody for 1.30 h. Bound antibodies was visualized using enhanced chemiluminescence (ECL) Western blotting detection reagents (Bio-Rad) and images were acquired by the ChemiDoc Imaging system (ChemiDoc™ XRS + System with Image Lab™ Software; Bio-Rad).

correlation was achieved between the results of each individual experiments. Significance was considered at P < 0.05. 3. Results 3.1. PHMG-induced cytotoxicity To investigate the toxic effect of PHMG in cells, MTT and LDH analyses were performed. Cell viability assay was carried out by MTT analysis using various cells including IMR-90 (Fig. 1A), A549 (Fig. 1B), HCT116 (Fig. 1C), and BEAS-2B (Fig. 1D). The viability of all four cell lines was both time- and concentration-dependently reduced by PHMG. Interestingly, IMR-90 primary human fibroblasts and BEAS-2B primary human bronchial epithelial cells were more susceptible compared to A549 human lung adenocarcinoma, and HCT116 human colon carcinoma cells. Treatment of IMR-90 and BEAS-2B cells with 5 lg/mL of PHMG reduced cell viability by greater than 90% at 24 h, while the viability of A549 and HCT116 cell populations exceeded 60% at the same time. Even with only 1 lg/mL of PHMG, the viability of IMR-90 cell populations was markedly diminished compared to the other cell types at both 24 and 48 h time periods (Fig. 1A). Furthermore, we also checked the morphological changes of IMR-90 and A549 cells exposed to

A

C

E

B

D

F

G

300 #

#

250

*

*

A549 cells (5  105 cells/mL) were seeded in a 6-well plate and treated with selected concentrations of PHMG for 24 h. Following treatment, cells were washed twice with 1X phosphate buffered saline (PBS) and harvested by trypsinization following centrifugation at 10,000g for 30 s. Cells were stained with fluorescein isothiocynate (FITC)-conjugated annexinV and propidium iodide (PI) for 15 min at room temperature. Following staining, cells were diluted with 400 ll of 1X annexin-binding buffer for fluorescence measurement and apoptosis was assessed by fluorescence-activated cell sorting (FACS; Becton Dickinson, San Jose, CA, USA). The assay was followed by the AF488 Alexa FluorÒ 488 Annexin V/Dead cell apoptosis kit (Invitrogen). The data were analyzed using FACS DIVA software ver 6.1.3. FITC and PI emissions were detected with 515–545 nm and 564–606 nm fluorescence detectors respectively, and a minimum of 10,000 cells per data point was examined. 2.9. Statistical analyses Data was expressed as the mean ± standard deviation. Data analysis was performed using ANOVA with Dunnett’s post hoc test, and Student’s t test was performed where applicable. At least three individual experiments were conducted, and satisfactory

Fluorescence Intensity (% of Control)

2.8. Apoptosis assay 200

#

*

150

100

50

0 NAC (10 µM)

-

PHMG (µg/mL)

-

-

+

2

-

+

5

-

+

10

+

-

Fig. 2. Generation of intracellular ROS in A549 cells by qualitative and quantitative analyses. Fluorescence images indicate untreated control (A), 2 (C), and 5 (E) lg/mL of PHMG treated cells for 3 h. The lower panel images, (B), (D), and (F) are phase contrast images for (A), (C), and (E), respectively. Scale bar denotes 100 lm. Quantitative measurement of intracellular ROS generation was detected by H2DCFDA assay on A549 cells treated with 2, 5, 10 lg/mL of PHMG and/or 10 lM of NAC (G). Asterisk () denotes significant differences between PHMG treatment and control, and a pound sign (#) denotes significant differences between PHMG treatment and combination treatment with PHMG and NAC at respective concentrations. P < 0.05, one-way ANOVA with Dunnett’s test; #P < 0.05, Students’s t test.

688

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

Table 2 Changes in gene expression between control and 5 lg/mL PHMG treated A549 cells. The alteration of gene expression by PHMG treatment was examined by microarray analysis. The selected list of genes was presented for 2-fold up- and down-regulation by PHMG treatment comparative to control. Bold font indicates genes that were confirmed either by qRT-PCR or Western blot analyses. Gene bank

Symbol

Normalized changes (PHMG vs. cont.)

Categories (G.O)

NM_005450 NM_021101 NM_003238 NM_181054 NM_001964 NM_004864 NM_000602 NM_000041 NM_000903 NM_002084 NM_000637 NM_001008367 NM_002083 NM_014417 NM_002228 NM_004083 NM_015675 NM_001924 NM_014330 NM_000600 NM_005658 NM_005257 NM_002192 NM_001731 NM_000024 NM_000043 NM_005655 NM_018941 NM_000565 NM_001130845 NM_021960 NM_003842 NM_004323 NM_001025370 NM_001455 NM_003844 NM_001188 NM_006218 NM_002133 NM_138578 NM_138764 NM_000465 NM_197966 NM_014380 NM_004282 NM_002758 NM_018370 NM_052936 NM_006395 NM_032885 NM_031482 NM_030803 NM_017983 NM_004083 NR_024549 NM_078467 NM_020307 NM_058241 NM_004071 NM_000076 NM_016399 NM_002229 NM_001546 NM_005426 NM_004060 NM_003885 NM_031267 NM_001949 NM_001259 NM_004064 NM_198219 NM_003858

NOG CLDN1 TGFB2 HIF1 EGR1 GDF15 SERPINE1 APOE NQO1 GPX3 GSR GPX8 GPX2 BBC3 JUN CHOP GADD45B GADD45A GADD34 IL6 TRAF1 GATA6 EDF BTG1 BAR FAS TIEG1 EPMR IL6R BCL5 MCL1 DR5 BAG1 VEGF FOXO2 DR4 BAK PI3K HMOX1 BCL2L1 BAX BARD1 BID NGFRAP1 BAG2 MEK6 DRAM1 ATG4 ATG7 ATG4 ATG10 ATG16 WIPI1 DDIT3 DMTF1 CDKN1A CCNL1 CCNT2 CLK1 CDKN1C TRIAP1 JUNB ID4 TP53BP2 CCNG1 CDK5R1 CDK13 E2F3 CDK6 CDKN1B ING1 CCNK

11.05 4.87 3.33 2.05 43.04 29.74 8.86 3.99 0.49 0.43 0.23 0.22 0.10 37.87 32.57 25.09 24.20 16.25 15.69 14.07 10.8 9.08 9.04 8.59 8.14 6.80 6.64 6.59 6.17 5.92 5.10 4.65 3.11 3.10 3.02 2.22 2.11 2.09 2.09 2.07 2.01 0.43 0.43 0.34 0.26 0.10 5.39 2.13 2.11 2.02 0.49 0.48 0.47 25.09 14.40 10.43 9.25 4.76 4.17 4.15 3.91 3.75 3.19 3.03 3.00 2.83 2.77 2.65 2.57 2.48 2.40 2.40

EMT (1837)

Fibrosis (0042980)

Antioxidant (16209)

Apoptosis (0006915)

Autophagy (6914)

Cell cycle (7049)

689

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692 Table 2 (continued) Gene bank

Symbol

Normalized changes (PHMG vs. cont.)

NM_001786 NM_006569 NM_001238 NM_001142571 NM_033031 NM_198433 NM_031966 NM_002105 NM_004217 NM_001761 NM_004091 NM_004337 NM_145862 NM_001237 NM_032637

CDK1 CGREF1 CCNE1 RAD51L3 CCNB3 AURKA CCNB1 H2AX AURKB CCNF E2F2 OSGIN2 CHEK2 CCNA2 SKP2

0.47 0.47 0.47 0.43 0.43 0.36 0.36 0.29 0.28 0.27 0.27 0.26 0.25 0.11 0.10

Categories (G.O)

2 and 5 lg/mL of PHMG for 24 h (Fig. 1E–J). IMR-90 cells treated with 5 lg/mL were markedly reduced in size, with clear evidence with shrinkage and condensation of cells, as compared to control and cells exposed to 2 lg/mL of PHMG (Fig. 1E–G). A549 cells displayed gradually decreased cell density with increasing PHMG concentrations, although the cell morphology was not appreciably different (Fig. 1H–J). 3.2. Effects of PHMG on intracellular ROS generation We further investigated whether PHMG could induce intracellular ROS generation in A549 cells. Fluorescence was detected with 2 lg/mL of PHMG (Fig. 2C) and was markedly increased with 5 lg/ mL of PHMG (Fig. 2E) compared to control cells (Fig. 2A) following 3 h of treatment. The lower panel phase-contrast images (Fig. 2B, D and F) are the seeding control for the respective fluorescent images (Fig. 2A, C and E). We also confirmed the induction of intracellular ROS generation quantitatively by H2DCFDA fluorescence detection. The intracellular ROS generation by PHMG treatment was significantly reduced by a negative control, NAC (N-acetyl-cysteine) (Fig. 2G). These data suggested that PHMG can induce intracellular ROS generation with increasing dosage, even at 1 h.

Fig. 3. Functional categories of A549 altered genes affected by 5 lg/mL of PHMG for 24 h using microarray analysis.

FAS

3.0

* * 2.0

Relative mRNA expression

12.0

4.0

GADD45B 10.0

25.0

*

20.0

* *

15.0

JUN

*

8.0

*

6.0

2.0

10.0

4.0

1.0

5.0

2.0

1.0

0.0

0.0

0.0

0

6 12 24

IL6

5.0

*

10.0

IL6R

*

0.0

SERPINE1

4.0

* *

* 3.0

* 3.0 2.0

6.0

*

2.0 1.0

1.0

2.0 0.0

0.0

0.0 0 12 24 48

0 12 24 48

0

0 12 24 (h)

0 12 24 48

12 24 48

4.0

8.0

4.0

*

3.0

0

B

BAX

5.0

*

6 12 24 (h)

C

Relative mRNA expression

Relative mRNA expression

A

1.6

GSR

1.6

1.4

1.4

1.2

1.2

1.0

1.0

0.8

0.8

0.6

0.6 0.4

0.4 0.2 0.0

*

*

*

0 24 48 72

GPX2

*

0.2 0.0 0 24 48 72 (h)

Fig. 4. Expression of apoptosis (A), fibrosis (B), and antioxidant (C) related genes were analyzed by qRT-PCR with 5 lg/mL of PHMG treated A549 cells for the indicated times.  P < 0.05, one-way ANOVA with Dunnett’s test.

690

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

3.3. Alteration of gene expression by PHMG To further investigate the role of PHMG in gene expression, we conducted microarray analysis. Genes that were significantly altered (either 2-fold up- or down-regulated compared to normalized control) were selected. The analysis revealed 2653 up-regulated genes and 2322 down-regulated genes. Many genes related to apoptosis, cell damage, cell cycle, and fibrosis were greatly up-regulated, and many genes related with self-defense functions, oxidation and detoxification were down-regulated (Table 2). PHMG mostly affected binding-related genes (GO:4599) followed by genes involved with catalytic activity (GO:3824), transcriptional activity (GO:30528), signal transduction (GO:4875), transporter activity (GO:5215), enzyme regulator activity (GO:30234), structure molecule activity (GO:5198), and molecular function (GO:3674) (Fig. 3). However, genes related to motor activity (GO:3774), translation regulator activity (GO:45182), and antioxidant activity were not greatly affected (Fig. 3). To confirm the alteration of gene expression by PHMG, qRT-PCR and Western blot

analyses were performed for the expression of some selected genes and proteins respectively (Figs. 4 and 5). Induction of apoptosis-related genes (GADD45B, BAX, FAS, and JUN), fibrosis-related genes (SERPINE1, IL6, and IL6R), and reduction of antioxidant-related genes (GSR and GPX2) were confirmed by qRT-PCR analysis (Fig. 4). The expression of apoptosis related protein, p53, and the pro-survival proteins Bcl2L1 and Mcl-1 were significantly induced at 24 h (Fig. 5A). The Bax and Bak pro-apoptosis proteins were gradually increased in a dose-dependent manner. Bid expression was slightly reduced with time and bbc3 expression was markedly induced by 10 lg/mL PHMG (Fig. 5B). The antioxidant-related protein, NADPH: quinine oxireductase-1 (NQO1) was greatly reduced with 10 lg/mL of PHMG, whether fibrosis related early response proteins, Egr-1 and GDF15/NAG1, were markedly induced by increasing concentrations of PHMG. The expression of epithelial mesenchymal transition (EMT) related Claudin-1, and cell cycle related CDK6 proteins were also strongly induced with dose. The expression of FAS cell signaling related protein was highly induced at 24 h compared to 6 h or 12 h of treatment.

(µg/mL)

A

0

2

5

10 (µg/mL)

p53 Bcl2L1 Mcl-1 β-actin

B

Bax Bid bbc3 Bak β-actin

C

NQO1 GDF15 Egr-1

Normalized Fold Expression

β- actin

D Claudin-1 CDK6 β-actin

1.4 1.2 1 0.8 0.6 0.4 0.2 0

*

*

* * *

Claudin-1

CDK6

5

E

0

6

12

24 (h)

FAS β-actin

Fig. 5. Effects of PHMG on the expression of apoptosis, fibrosis, antioxidant, and cell cycle-related proteins in A549 cells analyzed by Western blot. Whole cell extracts were prepared for cells treated with indicated concentrations of PHMG for specified time points. (A) Expression of apoptosis and pro-survival related p53, Bcl2L1, and Mcl-1 proteins. (B) Expression of pro-apoptosis related Bax, Bid, bbc3, and Bak proteins. (C) Expression of fibrosis related GDF15, Egr-1, and antioxidant related NQO1 proteins. (D) Expression of EMT and cell cycle related Claudin-1, and CDK6 proteins. (E) Expression of apoptosis related FAS protein. The densitometry analyses were presented at the respective right side of the Western blot data. P < 0.05, one-way ANOVA with Dunnett’s test.

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

3.4. Induction of apoptosis by PHMG To assess the capacity of A549 cells to undergo apoptosis in response to increasing concentrations of PHMG exposure for 24 h, cells were double stained with annexin V and PI and analyzed by flow cytometry. Increasing PHMG doses from 1 to 5 lg/mL led to the development of apoptosis (Fig. 6). Cells that stain positive for annexin-V and negative for PI are early apoptotic cells, those that are positive for both annexin V and PI are in the late stage of apoptosis or undergoing necrosis or already dead, and cells that stain negative for both are alive and not undergoing measurable apoptosis. The lower left panel showed the live cells, the lower right panel shows the early apoptotic cells, the upper right panel showed the late apoptotic cells or undergoing necrotic cells, and the upper left panel is for necrotic cells. Interestingly, a concurrent increase in early apoptotic and necrotic sub-populations by PHMG was evident. 4. Discussion PHMG is an inexpensive and effective disinfectant that is widely-used globally. However, its cytotoxicity has not been adequately assessed. In the present study, we demonstrated the toxicity, generation of ROS, induction of apoptosis, and alteration of global gene expression by PHMG treatment in human alveolar A549 cells. The expression of over 4000 genes was altered in PHMG-treated cells compared to control using DNA-microarray. The altered genes might be the best candidates to elucidate the

691

mechanism of potential toxicity. Microarray data revealed that the altered expression of 325 genes was related to apoptosis. Apoptosis follows intrinsic and/or extrinsic pathways. Intrinsic apoptosis is induced by intercellular signals such as DNA damage, oxidative stress, and scarcity of nutrients. Extrinsic apoptosis is triggered by the extracellular signals that activate the death receptor family (Elmore, 2007). The Fas/FasL system is a member of the tumor necrosis factor (TNF) receptor superfamily, and has dual pro-apoptotic and pro-inflammatory functions (Waring and Müllbacher, 1999). The expression of FAS gene was induced in both microarray and qRT-PCR analyses, coinciding with the Western blot data. The pro-apoptosis and pro-survival Bcl-2 family proteins perform key roles by forming a permeability transition pore in the mitochondrial membrane, through which proteins like cytochrome c enter the cytoplasm. This is the hallmark of apoptosis (Gross et al., 1999). Among them, the genes for BBC3, BAK, and BAX increased by 37.87-, 2.11-, and 2.01-fold, respectively, but the expression of BID was reduced by 0.43-fold. The expression of the pro-survival genes MCL1 and BCL2L1 was also induced 5.10and 2.07-fold, respectively, and was confirmed by Western blot analysis. Mcl-1 is an important anti-apoptotic protein, belonging to the Bcl-2 protein family, which is highly expressed in a variety of malignant tumors, and which has an important role in the inhibition of apoptosis and in the promotion of tumor formation (Gores and Kaufmann, 2012; Pritchard et al., 2008; Rassidakis et al., 2002). The expression of GADD45B (DNA damage-inducible 45 b) gene was increased by 24.2- and 16-fold in microarray and qRT-PCR analysis, respectively, indicating stressful growth inhibitory and

A

B

C

D

Fig. 6. Induction of apoptosis by PHMG detected by FACS analysis. A549 cells were stained with FITC-conjugated annexinV and propidium iodide (PI) for control (A), 1 (B), 2 (C), and 5 (D) lg/mL of PHMG treated cells.

692

H.-N. Jung et al. / Toxicology in Vitro 28 (2014) 684–692

DNA damage conditions, as these genes are induced following those circumstances. Fibrosis occurs in most chronic inflammatory diseases due to the accumulation of excess extracellular matrix components. Fibrosis leads to organ malfunction and ultimately to death. The pro-fibrogenic cytokine, connective tissue growth factors (CTGFs) function in the development and progression of fibrosis in many organ systems (Ponticos et al., 2009). Early growth response protein 1 (Egr-1) is a nuclear transcription factor that functions in a broad spectrum of biological responses to injury and stress. EGR1 gene expression is related in inflammation, cancer, atherosclerosis, and fibrosis. In the fibrotic process, EGR1 gene expression is induced during pro-fibrotic responses (Bhattacharyya et al., 2011). SERPINE1 encodes a member of the serine proteinase inhibitor (serpin) superfamily that functions as an inhibitor of fibrinolysis. However, excess production of the gene product is associated with thrombophilia (Marchand et al., 2012). Growth differentiation factor 15 (GDF15) encodes a protein belonging to the transforming growth factor beta (TGFb) superfamily, which is involved in inflammation and apoptosis (Lajer et al., 2010). The present microarray data revealed 43.04-, 29.74-, and 29.74-fold induction of EGR1, GDF15, and SERPINE1, respectively. JUN (Jun proto oncogene) is a pro-inflammatory gene in c-Jun signaling that was also markedly increased (29.74-fold) by PHMG treatment. Interleukin 6 (IL6) is a pro-inflammatory mediator that participates in the maturation of B cells. Following induction of inflammation, IL6 is produced and IL6R induces a transcriptional inflammatory response (Chalaris et al., 2007). The microarray data revealed the increased expression of the pro-inflammatory genes IL6, and IL6R by 14.07- and 6.17fold, respectively. ROS has powerful oxidizing capability that leads to the generation of active oxidation molecular products that induce destruction of cellular and sub-cellular structures in the lung, which includes DNA, proteins, lipids, cell membranes and mitochondria (Marchi et al., 2012). The generation of intracellular ROS by PHMG was confirmed by both qualitative and quantitative analyses. Surprisingly, most of the common and established antioxidant-related genes including as NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione peroxidase 3 (GPX3), 8 (GPX8), 2 (GPX2), and glutathione reductase (GSR) were markedly down-regulated in microarray analysis; these findings were somewhat confirmed by qRT-PCR/Western blot analyses for some selected genes. So, the exuberant generation of ROS and the reduction of cellular defense-related antioxidant genes might be one of the reasons for PHMG-induced cytoxicity. Our accumulated data demonstrated that PHMG at even very low concentration prompted cell death that might be triggered by the generation of ROS and apoptosis. Microarray data evidenced induction of apoptosis-, autophagy-, fibrosis-, and cell cycle-related genes and reduction of antioxidant-related genes that were to some extent confirmed by qRT-PCR and Western blot analyses. Hence, it can be anticipated that the altered genes might be the best candidates to elucidate the mechanism of potential toxicity of PHMG. Further in detail studies are required to elucidate the proper mechanism of action of PHMG by both in vitro and in vitro studies. Conflict of Interest The authors declare that there are no conflicts of interest. Transparency Document The Transparency document associated with this article can be found in the online version.

Acknowledgements This research was partly supported by the National Research Foundation of Korea (NRF; NRF-2012R1A1A2040626 for Y.-S. Kim) and Soonchunhyang University. References Bhattacharyya, S., Wu, M., Fang, F., Tourtellotte, W., Feghali-Bostwick, C., Varga, J., 2011. Early growth response transcription factors: key mediators of fibrosis and novel targets for anti-fibrotic therapy. Matrix Biol. 30, 235–242. Chalaris, A., Rabe, B., Paliga, K., Lange, H., Laskay, T., Fielding, C.A., Jones, S.A., RoseJohn, S., Scheller, J., 2007. Apoptosis is a natural stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of neutrophils. Blood 110, 1748–1755. Condrashov, S.A., 1992. Hygienic evaluation of new polymer flocculant polyhexamethylene guanidine. Gig. Sanit. 54, 11–13. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. Gores, G.J., Kaufmann, S.H., 2012. Selectively targeting Mcl-1 for the treatment of acute myelogenous leukemia and solid tumors. Genes Dev. 26, 305–311. Gross, A., McDonnell, J.M., Korsmeyer, S.J., 1999. BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 13, 1899–1911. Guan, Y., Qian, L., Xiao, H., Zheng, A.N., 2008. Preparation of novel antimicrobialmodified starch and its adsorption on cellulose fibers: Part I. Optimization of synthetic conditions and antimicrobial activities. Cellulose 15, 609–618. Kim, J.Y., Kim, H.H., Cho, K.H., 2013. Acute cardiovascular toxicity of sterilizers, PHMG, and PGH: severe inflammation in human cells and heart failure in zebrafish. Cardiovasc. Toxicol. 13, 148–160. Kuznetsov, Y.I., 2004. Physicochemical aspects of metal corrosion inhibition in aqueous solutions. Russ. Chem. Rev. 73, 75–87. Lajer, M., Jorsal, A., Tarnow, L., Parving, H.H., Rossing, P., 2010. Plasma growth differentiation factor-15 independently predicts all-cause and cardiovascular mortality as well as deterioration of kidney function in type 1 diabetic patients with nephropathy. Diabetes Care 33, 1567–1572. Lee, B.H., Kim, W.S., Kim, Y.J., Bang, S.G., Lim, K.M., Choi, S.R., Joo, K.C., 2000. Polyalkylene guanidine salts or polyalkylene biguanidine salts having a branched silane compound, method for preparing same and uses thereof, U.S. Patent 6,031,119. Marchand, A., Proust, C., Morange, P.E., Lompré, A.M., Trégouët, D.A., 2012. MiR-421 and miR-30c inhibit SERPINE 1 gene expression in human endothelial cells. PLoS ONE 7, 44532. Marchi, S., Giorgi, C., Suski, J.M., Agnoletto, C., Bononi, A., Bonora, M., Marchi, E.D., Missiroli, S., Patergnani, S., Poletti, F., Rimessi, A., Duszynski, J., Wieckowski, M.R., Pinton, P., 2012. Mitochondria-ros crosstalk in the control of cell death and aging. J. Signal Trans. (Article ID 329635). McDonnell, G., Russell, A.D., 1999. Antiseptics and disinfectants: activity, action, and resistance. Clin. Microbiol. Rev. 12, 147–179. Muller, G., Kramer, A., 2005. Effect of selected wound antiseptics on adult articular cartilage (bovine sesamoid bone) in the presence of Escherichia coli and Staphylococcus aureus. J. Orthop. Res. 23, 127–133. Ostapenko, YN., Brusin, KM., Zobnin, YV., Shchupak, AY., Vishnevetskiy, MK., Sentsov, VG., Novikova, OV., Alekseenko, SA., Lebed’ko, OA., Puchkov, YB., 2011. Acute cholestatic liver injury caused by polyhexamethylene guanidine hydrochloride admixed to ethyl alcohol. Clin. Toxicol. (Philadelphia, Pa) 49, 471–477. Park, Y.M., 2011. Six sterilizers for humidifiers recalled. (accessed 11.08.11). Ponticos, M., Holmes, A.M., Shi-wen, X., Leoni, P., Khan, K., Rajkumar, V.S., Hoyles, R.K., Bou-Gharios, G., Black, C.M., Denton, C.P., Abraham, D.J., Leask, A., Lindahl, G.E., 2009. Pivotal role of connective tissue growth factor in lung fibrosis: MAPK-dependent transcriptional activation of type I collagen. Arthritis Rheumtism 60, 2142–2155. Pritchard, D.M., Berry, D., Przemeck, S.M.C., Campbell, F., Edwards, S.W., Varro, A., 2008. Gastrin increases mcl-1 expression in type I gastric carcinoid tumors and a gastric epithelial cell line that expresses the CCK-2 receptor. Am. J. Physiol. – Gastr. Liver Physiol. 295, 798–805. Rassidakis, G.Z., Lai, R., McDonnell, T.J., 2002. Overexpression of Mcl-1 in anaplastic large cell lymphoma cell lines and tumors. Am. J. Pathol. 160, 2309–2310. Solodun, Y.V., Monakhova, Y.B., Kuballa, T., Samokhvalov, A.V., Rehm, J., Lachenmeier, W., 2011. Unrecorded alcohol consumption in Russia: toxic denaturants and disinfectants pose additional risks. Interdiscipl. Toxicol. 4, 198–205. Waring, P., Müllbacher, A., 1999. Cell death induced by the Fas/Fas ligand pathway and its role in pathology. Immunol. Cell Biol. 77, 312–317. Zerin, T., Kim, Y.S., Hong, S.Y., Song, H.Y., 2012. Protective effect of methylprednisolone on paraquat-induced A549 cell cytotoxicity via induction of efflux transporter, P-glycoprotein expression. Toxicol. Lett. 208, 101–107. Zhou, Z.X., Wei, D.F., Guan, Y., Zheng, A.N., Zhong, J.J., 2010. Damage of Escherichia coli membrane by bactericidal agent polyhexamethylene guanidine hydrochloride: micrographic evidences. J. Appl. Microbiol. 108, 898–907.