- Email: [email protected]
DA neurons derived from hES cells that express HLA-G1 are capable of immunosuppression
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research Report
DA neurons derived from hES cells that express HLA-G1 are capable of immunosuppression Yajing Zhua, b, 1, 2 , Hongxi Zhaoc, 1, 3 , Li Wangd, 1, 4 , Sanjun Zhaoe, 5 , Feng Jiangc, 6 , Lingsong Lid,⁎, Yuanqing Yaof,⁎⁎ a
Department of Obstetrics and Gynecology, the General Hospital of the People's Liberation Army (PLA), Fuxing Road 28, Beijing 100853, PR China b Nankai University School of Medicine, Weijin Road 94, Tianjin 30071, PR China c Department of Obstetrics and Gynecology, Tangdu Hospital, Fourth Military Medical University, Xi'an, 710038, PR China d Peking University Stem Cell Research Center and China National Center for International Research, Xueyuan Road 38, Beijing 100191, PR China e Department of Anesthesiology, The General Hospital of the People's Liberation Army, Fuxing Road 28, Beijing 100853, PR China f Department of Obstetrics and Gynecology, the General Hospital of the People's Liberation Army, Fuxing Road 28, Beijing, PR China
A R T I C LE I N FO
AB S T R A C T
Article history:
Human embryonic stem (hES) cells have the capacity for self-renewal and exhibit multipo-
Accepted 15 December 2011
tentiality. hES cells have promise for serving as an unlimited source of ideal seed cells for
Available online 23 December 2011
cell transplantation. However, the rejection that occurs between the transplant recipient and the transplanted cell poses a major challenge for therapeutic transplantation. This
Keywords:
study was designed to devise methods to enhance immune tolerance in cell therapy. We
Human embryonic stem cell
established an hES cell line that could stably express human leukocyte antigen-G1 (HLA-
Human leukocyte antigen G
G1). The established HLA-G1-H1 hES cells still retained all the characteristics of normal
Differentiation
human embryonic stem cells. By using the SDIA method, we induced dopaminergic (DA)
Immune rejection
neurons by coculturing HLA-G1-H1 hES cells with the mouse stromal cell line PA6. Tyrosine hydroxylase (TH) + neurons were detected on the 10th day of differentiation, and 70% of the HLA-G1-H1 hES cells were TH + mature DA neurons because the differentiation time was only 3 weeks. Cells that had been differentiating for different periods of time still expressed HLA-G1, and these differentiated DA neurons released dopamine and other catecholamines in response to K + depolarization as measured by HPLC. After careful study, we found that HLA-G1-H1 hES cells are capable of inhibiting the proliferation of mixed T-lymphocytes. DA neurons derived from HLA-G1-H1 hES attenuated the release of proinflammatory
⁎ Corresponding author. Fax: +86 10 8280 2152. ⁎⁎ Corresponding author. Fax: + 86 10 6693 8043. E-mail addresses: [email protected] (L. Li), [email protected] (Y. Yao). Abbreviations: hES, human embryonic stem; HLA-G1, human leukocyte antigen-G1; HPLC, high performance liquid chromatography; TH, Tyrosine hydroxylase; SDIA, stromal-derived inducing activity; SHH, sonic hedgehog homolog; FGF8, fibroblast growth factor 8; DAPI, 4,6-diamidino-2-phenylindole; LPS, lipopolysaccharide 1 The three authors contributed equally to this paper. 2 This author designed the study, conducted the study, analyzed the data, and wrote the manuscript. 3 This author helped design the study, conduct the study, analyze the data, and write the manuscript. 4 This author helped design the study, conduct the study, analyze the data, and write the manuscript. 5 This author helped conduct the study and analyze the data. 0006-8993/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2011.12.033
135
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
cytokines IL-1β and IFN-γ from lipopolysaccharide (LPS)-stimulated BV2 microglia. The efficiency of inhibition was significant and dose-dependent. This method might be used to treat Parkinson's patients via cell transplantation. © 2011 Elsevier B.V. All rights reserved.
1.
Introduction
Human embryonic stem (hES) cells have the capacity for selfrenewal and are multipotent, having the ability to differentiate into advanced derivatives and multiple specialized cell types that can be used for cell transplantation therapy. By utilizing protocols for in vitro derivation, hES cells can be differentiated into neurons (Schulz et al., 2003), cardiomyocytes (Mummery et al., 2003), endothelial cells (Levenberg et al., 2002), hematopoietic precursors (Chadwick et al., 2003), keratinocytes (Green et al., 2003), osteoblasts (Sottile et al., 2003), and hepatocytes (Lavon et al., 2004). Therefore, hES cells can provide an unlimited source of cells due to their ability to produce multiple specialized cell types, which can be exploited in cell transplantation therapy to replace degenerating tissue and cells (Thomson et al., 1998). Many reports have described differentiation of hES cells to dopamine (DA) neurons on immortalized midbrain astrocytes with transplantation into Parkinsonian rats, leading to improvement in circling behavior (Roy et al., 2006). However, there exists a major obstacle for successful cell therapy: immunological rejection after transplantation. To avoid the immune rejection of hES cells or hES derivatives and to achieve the ambitious goals of regenerative medicine, it is necessary to produce a pluripotent cell line that can provide universal seed cells. This goal can be accomplished by transferring somatic cell nucleus to produce pluripotent ES cells, by reprogramming the somatic cells back to a pluripotent state using transcription factors, or by genetically modifying the genes of hES cells (French et al., 2008). Considering the individual differences in patient-specific therapies, one strategy is to engineer a human embryonic stem cell line that can escape immune rejection and serve as a universal donor (Takahashi and Yamanaka, 2006). Such an engineered hES cell line might express either class I and II HLA genes or a nonclassical HLA class I molecule, such as HLA-G. HLA-G belongs to the nonclassical HLA class I family of antigens. Compared to classical HLA class I antigens, HLA-G has the characteristic of limited allelic polymorphism, which produces seven protein isoforms by selectively splicing a single RNA transcript (Carosella et al., 2008a,b). HLA-G is expressed in the fetal trophoblast cells, decidual cells, placental macrophages, and amniotic fluid (Carosella et al., 2008a,b). Neither MHC-I nor MHC-II are expressed in the trophoblast cells of the maternal–fetal surface where the seven protein isoforms of HLA-G are distributed, which indicate that HLA-G perhaps plays an important function in inhibiting the maternal antifetal immune response (Geraghty, 1993). HLA-G can activate cytotoxicity receptors on NK cells to inhibit the antigenspecific cytotoxic lymphocyte (CTL) response and then decrease NK cell function. HLA-G1 is encoded by total HLA-G RNA. Therefore, among other isoforms, HLA-G1 was chosen as a target gene to establish an hES cell line that can stably
express HLA-G1 by over expressing HLA-G1 in normal hESH1. These HLA-G1-H1 hES cells can avoid or alleviate immune rejection. The present study aims to fulfill two major objectives. The first is to establish an hES cell line that can express stable HLA-G1 and then differentiate into midbrain dopaminergic (DA) neurons. The classical method of differentiating hES cells into DA neurons involves several steps: generating embryoid bodies (EBs), selecting nestin-positive neural precursor cells, and differentiating the cells into DA neurons (Hayashi et al., 2008). The most common technique for generating midbrain DA neurons is a coculture method, which, because it uses stromal cells like those of the mouse PA6 cell line, is termed stromal-derived inducing activity (SDIA). The stromal cell line PA6 derived from mouse skull bone marrow serves as a feeder layer and exhibits inducing activity (Chiba et al., 2008). The SDIA method has been adapted for the induction of human dopaminergic neurons in our study. According to the protocol available, we have assessed the ability of growth factors, including sonic hedgehog homolog (SHH) and fibroblast growth factor 8 (FGF8), to enhance the conversion of hES cells into phenotypically stable DA neurons (Vazin et al., 2008). The second objective of this study is to demonstrate if undifferentiated HLA-G1-H1 hES cells and DA neurons derived from HLA-G1-H1 hES cells are capable of immunosuppression, which can facilitate the avoidance or alleviation of immune rejection. HLA-G1-H1 hES cells are able to inhibit the proliferation of mixed T-lymphocytes via coculture. DA neurons derived from HLA-G1-H1 hES cells could reduce the release of inflammatory factors such as IL-1β and IFN-γ when cocultured with BV2 cells activated by LPS. This result provides a mechanistic argument for HLA-G expression in recipient transplants.
2.
Results
2.1. Differentiation of HLA-G1-H1 hES cells into DA neurons We used the improved SDIA method to promote hES cells differentiation into DA neurons (see Experimental procedures). The undifferentiated HLA-G1-H1 hES cells were seeded onto confluent PA6 cells (Fig. 1A). After 3 days in coculture with the PA6 cells, the hES colonies started to show signs of differentiation, including loss of their compact appearance and tight borders (Fig. 1B). At day 7, hES cells developed into classic rosette-like structures (Fig. 1C). By day 10, these rosettelike structures were more obvious, and there was a “black heart” in the cores of the cell colonies (Fig. 1D). After 2 weeks of differentiation, cells migrating out of the colonies formed a monolayer and displayed a bipolar or multipolar morphology characteristic of neurons, with extensive development of
136
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Fig. 1 – Time course of differentiation of HLA-G1-H1 hES and characterization of cellular phenotypes present. (A–F) Phase contrast images of hES cells cocultured with PA6 cells for 0, 3, 7, 10 days, 2 weeks and 3 weeks. (G–I) The bipolar or multipolar morphological characteristics of neurons are visualized by amplifying the black frame and cells from the colonies that were GFP-positive. Scale bars = 400 μm.
fine processes (Fig. 1E). Although hES cells had been differentiating for 3 weeks, it was still possible to find HLA-G1-GFPpositive cells that migrated out of the colonies (Figs. 1F–I).
By immunostaining HLA-G1-H1 hES colonies after 3 weeks of culture on a layer of PA6 cells, we could see 70% of hES colonies that were positive for the dopaminergic neuronal
Fig. 2 – Cells differentiating from HLA-G1-H1 hES cells for 3 weeks exhibited the bipolar or multipolar morphological characteristics and were positive for TH (A–C) and negative for oct-4 (D). The PA6 cells were negative for TH (E). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (F). Scale bars = 400 μm or 200 μm.
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
marker TH (Figs. 2A–C). No oct4-positive colonies were found after 3 weeks of differentiation on PA6 cells (Fig. 2D). PA6 cells did not express TH (Fig. 2E). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (Fig. 2F). We performed RT-PCR and real-time PCR analysis on the cells at different stages (Figs. 3A–B) and found that TH expression was detected at 10 days of coculture. The real-time PCR data showed that relative TH expression increased 4-fold in cells that had been cocultured for 2 weeks compared to 1 week and that relative TH expression increased in a timedependent manner (P < 0.05). Western blot analysis proved that cells at different stages of differentiation continuously express HLA-G1 and TH (Figs. 3C–D).
2.2. HLA-G1-H1 hES cells-derived DA neurons released dopamine and other catecholamines as measured by HPLC and ELISA HPLC and ELISA were used to examine the ability of HLA-G1H1 hES-derived DA neurons to release dopamine and other catecholamines. After three weeks of differentiation, dopamine and other catecholamines were released into the medium in response to a K+ depolarizing stimulus (Fig. 4A). Dopamine was not detected in the supernatant before KCl treatment. HPLC traces demonstrated the evoked release of 2390 pg/ml norepinephrine (NE), 398 pg/ml epinephrine (E), 2477 pg/ml dopamine (DA), and 3161 pg/ml 3,4-
137
dihyroxphenylactic acid (DOPAC) per 106 cells, and the times of peak values were 3.767 min, 4.458 min, 6.333 min and 8.492 min. Dopamine was detected in the cell medium and cell lysate by ELISA after KCL was used for depolarization. The dopamine released was 54.25 ± 3.58 ng/ml in the cell medium and 344.48± 15.35 ng/ml in the cell lysate. Dopamine was not detected in the supernatant without K+ treatment (Fig. 4B) (P < 0.05).
2.3. HLA-G1-H1 hES cells suppressed the proliferative activity of mixed T-lymphocytes in vitro With routine passage method, HLA-G1-H1 hES cells were dissociated to small colonies and seeded at a density of 5 × 103 cells per well in 96-well plates which were coated with 0.1% gelatin. HLA-G1-H1 hES cells were cultured for 48 h and were exposed by Co60γ radiation for 1 h (20 Gy), and then mixed T-lymphocyte was added into 96-well plates according to effector ratio target cell was 10:1, 5:1, 2.5:1, 1.25:1 and 0.625:1. The cell mixture was incubated at 37 °C for 0 h, 12 h, 24 h, 36 h, 48 h and 60 h. Proliferation of mixed T-lymphocytes was measured using a colorimetric assay after HLA-G1-H1 hES cells had been cocultured with human peripheral blood mixed T-lymphocytes for 48 h. The analysis from the absorbance at 450 nm showed that HLA-G1-H1 hES cells could restrain the proliferative activity of mixed T-lymphocytes at different ratios of effector to target cells and that the efficiency of inhibition was significant in a dose-dependent manner
Fig. 3 – Cells expressed HLA-G1 and TH throughout different stages of differentiation. (A) RT-PCR data shows that cells that had differentiated for 10 days can express TH from our modified SDIA treatment. (B) Real-time PCR data shows that the expression of TH increases over the time course of differentiation. (C) Western blot analysis for TH differentiated cells derived from HLA-G1-H1 hES cells and mouse mesencephalon. Data shows the existence of DA neurons that have differentiated from HLA-G1-H1 hES cells. (D) HLA-G1 is expressed continually at different points, but oct-4 is not expressed. Mouse mesencephalon served as positive control for TH. JEG-3 cell served as positive control and K562 cell as negative control for HLA-G.
138
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Fig. 4 – HLA-G1-H1 hES-derived dopaminergic neurons released dopamine and other catecholamines. (A) Representative superimposed chromatogram shows the retention time of the dopamine peak for standards (blue), a sample treated with 56 mM KCl for 15 min (red), and a control sample without KCl treatment (green). (B) Dopamine was detected in the cell medium and cell lysate by ELISA.
(Fig. 5A). We observed the proliferation of mixed Tlymphocytes for 60 h and drew a T-lymphocyte growth curve for the 10:1 effector to target cell ratio. From the curve, we discovered that the growth of a primary culture of mixed T-
lymphocytes was accelerated after 12 h in culture and reached a maximum at 48 h. Therefore, 48 h is sufficient as the testing time for HLA-G1-H1 hES cells cocultured with mixed Tlymphocytes. This experiment was repeated three times,
Fig. 5 – HLA-G1-H1 hES cells and DA neurons derived from HLA-G1-H1 hES cells are capable of immunosuppression. (A, B) HLA-G1-H1 hES cells suppressed the proliferative activity of mixed T-lymphocytes. (C, D) DA neurons differentiated from HLA-G1-H1 hES attenuated the release of proinflammatory cytokines IL-1β and IFN-γ and the efficiency was significant in a dose-dependent manner.
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
and its data are presented as the mean ± SD of three independent experiments as shown in Fig. 5B (P < 0.05).
2.4. DA neurons differentiated from HLA-G1-H1 hES attenuated the release of proinflammatory cytokines from LPS-stimulated BV2 microglia To evaluate the anti-inflammatory effects of DA neurons differentiated from HLA-G1-H1 hES on LPS-stimulated BV2 microglia, DA neurons were cocultured with activated BV2 microglia for 48 h. The negative control was DA neurons differentiated from H1. Cell culture media, IL-1β, and IFN-γ were measured by ELISA. In the negative control experiment, the amount of IL-1β significantly increased from 368± 0.107 pg/ml to 585.5 ± 0.089 pg/ml 48 h after LPS stimulation, and the secretory volume of IL-1β corresponded with the BV2 microglia in a dosedependent manner. In this experiment, the BV2 microglia population was from 5 × 105 to 5 × 104/ml. DA neurons differentiated from HLA-G1-H1 hES cells suppressed IL-1β production in LPSstimulated BV2 microglia from 123 ± 0.083 pg/ml to 183 ± 0.0648 pg/ml. The amount of IFN-γ increased from 15.474 ± 0.005 ng/ml to 24.789 ± 0.0031 ng/ml in the negative control, and DA neurons differentiated from HLA-G1-H1 hES cells suppressed IFN-γ production from 10.73± 0.007 ng/ml to 20.211 ± 0.007 ng/ml. The efficiency of DA neurons differentiated from HLA-G1-H1 hES cells in attenuating the release of proinflammatory cytokines IL-1β and IFN-γ was significant in a dosedependent manner compared to the negative control (Figs. 5C– D) (P < 0.05).
3.
Discussion
Human embryonic stem cells are multipotent and have the capacity for self-renewal, for this reason, hES cells have promise for replacing degenerating tissue and eventually for cell replacement therapy. However, the incompatible immunological rejection that often occurs after transplantation constrains cell replacement therapy. In this study, we devised a strategy to engineer an hES cell line that can avoid the immune response and thus might serve as a universal donor through genetic modification of hES cells. By transfecting lentivirus containing the plasmid iDuet101-IRES-GFP-HLA-G, the HLA-G1 gene was overexpressed in hES cell line H1 (Supplementary Fig. 1A–F). Our data showed that lentivirus could infect hES cells and the target gene could be stably expressed in hES cells through lentiviral transfection. Dopaminergic neurons have been generated from mouse, primate, and human embryonic stem cells by coculture with the PA6 stromal cell line (Kawasaki et al., 2000; Yan et al., 2005; Zeng et al., 2004). In this study, HLA-G1-H1 hES cells were made to differentiate into midbrain DA neurons using the SDIA method. After modifying the available protocols for derivation in vitro, the expression of DA neurons was improved. In our experiments, the differentiation culture medium was supplemented with conditioned medium (CM) of PA6, 40 ng/ml SHH and 40 ng/ml FGF8 on the 7th day of differentiation. TH+ neurons could be observed on the 10th day using RT-PCR, and 70% of HLA-G1-H1 hES cells were TH + mature DA neurons due to only 3 weeks. SHH and FGF8 are two
139
key molecules in the development of midbrain dopaminergic neurons (Ye et al., 1998; Hynes et al., 2000). Several studies suggest that soluble factors secreted by PA6 cells can promote neural differentiation and increase the generation of DA neurons from hES cells (Schwartz et al., 2005; Yamazoe et al., 2005). Dopaminergic induction of hES cells which were cocultured with PA6 cells in the presence of PA6-conditioned medium could be increased by synergistic effects of PA6 cell surface activity and secreted molecules (Vazin et al., 2008). Our modified induction method not only shortened the period of differentiation but also improved efficiency. According to Western blotting, HLA-G1 can still be stably expressed in differentiated cells after different amounts of time spent differentiating. Differentiated dopaminergic neurons could release dopamine and other catecholamines in response to a K+ depolarizing stimulus, as measured by HPLC and ELISA, which indicated that differentiated DA neurons were biologically functional. Although there is an inverse relationship between brain noradrenaline (NE) level and dopamine loss in Parkinson's disease (PD), investigation indicated that NE might have a protective effect on dopamine neurons. Exogenous NE may play a positive role in symptomatic purposes in PD, so our research may provide a new idea in the therapy of PD. Thus, this method is well suited as an in vitro model to study development of DA neurons and for examination of the mechanism of DA neurodegeneration in Parkinson's disease. To confirm whether HLA-G1-H1 hES cells had the capacity to avoid or alleviate the immune response, we analyzed the growth of mixed T-lymphocytes using a CCK-8 kit by coculturing HLA-G1-H1 hES cells with mixed T-lymphocytes. The result showed that HLA-G1-H1 hES cells could not only significantly restrain the proliferative activity of mixed Tlymphocytes but also that the efficiency of inhibition was dose dependent. Many studies have already shown that microglia produce a marked effect on host defense and tissue repair in the central nervous system (CNS) (Perry and Gordon, 1988). Microglia can be activated by LPS, and activated microglia release many proinflammatory cytokines such as interleukin IL-1β, IL-6, TNF-α and interferon IFN-γ (Meda et al., 1995), which are responsible for CNS disease and neuronal death. DA neurons differentiated from HLA-G1-H1 hES cells could attenuate IL-1β secretion from LPS-stimulated BV2 microglia by 3-fold and significantly suppress the amount of IFN-γ released. The efficiency of DA neurons differentiated from HLA-G1-H1 hES cells in attenuating the release of proinflammatory cytokines IL-1β and IFN-γ was dose-dependent. The findings in our study may shed light on how to avoid or alleviate immunological rejection after transplantation in clinical practice and might be able to be used to treat Parkinson's patients via cell transplantation.
4.
Experimental procedures
4.1. line
Cell culture and establishment of the HLA-G1-H1 hES cells
hES cells line H1 was cultured at the Peking University Stem Cell Research Center according to a routine method
140
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
(Levenberg et al., 2002; Schulz et al., 2003). We overexpressed HLA-G1 in the hES cells line H1 using a lentivirus plasmid. The device with which we constructed the lentivirus plasmid was established by Dr. Zhao. The 293T cells were 70–90% confluent for transfection and were cultured with 24 μg of a HLA–G1 DNA mixture (9 μg of iDuet101-IRES-GFP-HLA-G1, 12 μg CMVΔ8.92 and 3 μg pMDG) for 48 h. Cell supernatant was collected, and the viral supernatant was concentrated. For transfection, H1 cells were dissociated into small clusters and transferred to a 35-mm cell culture dish and treated with 20 μl condensed viral supernatant and 3–5 μg/ml polybrene (Sigma, USA). Cells were cultured for 4 h, and then, cells were washed with fresh medium and plated on new MEF feeder layers for culturing. hES cells expressed HLA-G1 after transfection for 48–72 h, and 100 μg/ml hygromycin B (Sigma, USA) was added to the conditioned medium (CM). Drug screening lasted for three passages, and HLA-G1+hES cells were picked and expanded. 4.2.
Induction of DA neurons
The PA6 mouse stromal cell line was cultured at the Peking University Stem Cell Research Center. PA6 cells are mouse skull bone marrow stromal cells, serve as feeder layer and exhibit inducing activity in SDIA method. PA6 cells were cultured according to published methods (Freed et al., 2008; Vazin et al., 2008). Briefly, PA6 cells were seeded at 2 × 106 cells per well in a 60-mm dish coated with collagen type I. The culture medium of PA6 consisted of α-minimum essential medium (Gibco) supplemented with 10% fetal bovine serum (Atlanta Biologicals) and 50 U/ml Penn-Strep. Culturing for 24 h, the medium was replaced with differentiation Glasgow minimum essential medium supplemented with 10% KSR, 1 mM sodium pyruvate (Sigma-Aldrich), 0.1 mM nonessential amino acids (Gibco) and 0.1 mM β-mercaptoethanol (Millipore). To differentiate HLA-G1-H1 hES cells in vitro, hES cells were dissociated from the MEF feeder cells into small colonies and added to the PA6 layer at a density of approximately 50,000–100,000 cells per well. The differentiation culture medium was not changed until cells had differentiated for 4 days, and thereafter, it was changed every day. After cells had cocultured for 7 days, the differentiation culture medium was supplemented with conditioned medium (CM) of PA6 which contained 40 ng/ml SHH and 40 ng/ml FGF8 (Sigma, USA). The HLA-G1-H1 hES cells were allowed to differentiate using this SDIA method for 28 days (Tandis Vazin et al., 2008). 4.3.
Evoked release of dopamine and HPLC
After hES cells had differentiated in culture with PA6 cells for 3 weeks, cultures were depolarized with 56 mM KCl/Hanks’ balanced salt solution (HBSS) for 15 min. The cells that were not treated with KCL were served as a negative control. Metabisulfite and orthophosphoric acid were then added to samples for stabilizing. HPLC detection of dopamine was performed at the Peking University School of Pharmaceutical Science. Briefly, samples were injected by an automatic sampler (SIL-10AC) into an inertsil ODS-3 column (4.6 × 150 mm, 5 μm), and catecholamines were extracted by adsorption to solid Al203 followed by eluting and deadsorption with 0.1 N
acetic acid. The HPLC system consisted of a LC-20AD pump, CBM-20A commander, CTO-20AC column cell, SIL-10AC automatic sampler, and SPD-M20A Diode array Electrochemical Detector. A calibration curve run along with the samples was used to calibrate the instrument. At the same time, cocultured cells that were either treated or untreated with KCL were collected to examine the ability of HLA-G1-H1 hES-derived neurons to release dopamine using an enzyme linked immunosorbent assay (ELISA) (ELISA kit 17-DOPHU-E01, Alpco, USA). Cells untreated with KCL served as a negative control and mice mesencephal as a positive control. 4.4. The proliferative response of mixed T-lymphocytes to HLA-G1-H1 hES cells in vitro The effects of HLA-G1-H1 hES cells on the proliferation of human peripheral blood mixed T-lymphocytes were measured using a colorimetric assay kit (CCK-8 assay kit, Dojindo, Japan). With a routine passage method, HLA-G1-H1 hES cells were dissociated to small colonies and seeded at a density of 5 × 103 cells per well in 96-well plates coated with 0.1% gelatin. HLA-G1-H1 hES cells that had been in culture for 48 h were exposed to Co60γ radiation for 1 h (20 Gy), and then, the mixed T-lymphocytes were added to 96-well plates to produce effector cell to target cell ratios of 10:1, 5:1, 2.5:1, 1.25:1 and 0.625:1. The cell mixture was incubated at 37 °C for 0 h, 12 h, 24 h, 36 h, 48 h and 60 h. Mixed T-lymphocyte cell proliferation was determined by adding 10 μl of the CCK-8 solution to each well and incubating the plate for 1 h in the incubator. Negative controls were hES-H1. We measured the absorbance at 495 nm using a microplate reader and prepared a calibration curve using the data. 4.5. DA neurons derived from HLA-G1-H1 hES cells attenuated the release of proinflammatory cytokines from LPS-stimulated BV2 microglia HLA-G1-H1 hES cells were dissociated and seeded at a density of 5 × 105 on the PA6 cell layer in 6-well plates for differentiation. Three weeks later, the BV2 microglia that had been activated by LPS were reseeded into the 6-well plates that had been differentiating. In this experiment, with activated BV2 cells as the target cell, the quantity of BV2 cells added was determined to meet the effector:target cell ratios of 10:1, 5:1, 2:1 and 1:1. Cells were incubated at 37 °C for 48 h, and the coculture cell supernatant was collected. Pooled supernatant was filtered to remove cell debris, and IL-1β and IFN-γ were measured using ELISA kits (B&D, USA). The negative control was DA neurons differentiated from hES-H1. 4.6. Reverse transcription polymerase chain reaction and real-time PCR Total RNA was extracted from cell or tissue samples using Trizol (Invitrogen, USA). RNA samples were reverse transcribed using random primers (SuperScript III First-Stand kit, Invitrogen). The resultant cDNA was amplified by polymerase chain reaction (PCR, GeneAmp PCR System 9600). For the amplification of cDNA encoding TH and GAPDH the
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
following forward (F) and reverse (R) primer sequences were generated to the target mRNA using the Primer3 program. RT-PCR Primers, TH: F, CCGTGCTAAACCTGCTCTTC; R, CGTGGTGTAGACCTCCTTCC. GAPDH: F, ACCACAGTCCATGCCATCAC; R, TCCACCACCCTGTTGCTGTA. Real-time PCR Primers, TH: F, CAGTTCTCGCAGGACATTGG; R, CCCGTTCTGCTTACACAGC; GAPDH: F, ATGAGAAGTATGACAACAGCCT; R, AGTCCTTCCACGATACCAAAGT. All real-time PCR assays were performed with QuantiTect™ SYBR Green PCR kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The 2-delta delta CT relative quantification method was performed to analyze the data from the Real-time PCR experiment as previously described. 4.7.
Controls
The human choriocarcinoma cell line JEG-3 (American Type Culture Collection) was used; this cell line is known to express detectable levels of HLA-G. JEG-3 cells were cultured in MEM (Sigma-Aldrich) supplemented with 10% fetal calf serum (Shido et al., 2006; Kovats et al., 1990; Shaikly et al., 2008). The HLA-G negative K562 cell line was culture in MEM supplemented with 10% FCS to serve as a control (A.van der Meer et al., 2006). Tyrosine hydroxylase (TH) is a key enzyme in the dopamine (DA) biosynthesis. The substantia nigra is a brain structure located in the mesencephalon (midbrain) that contains high levels of dopaminergic neurons. In this experiment, TH is the marker of DA neurons and mouse mesencephalon (midbrain) served as positive control. 4.8.
Western blots
The membranes were incubated with primary antibodies to HLA-G1 (1:10,000, ab52455, Abcam, UK), TH (1:1000, Cell Signaling 2792, CST, USA), Oct-4 (1:1000, ab27985, Abcam, UK), β-actin (1:10,000, Sigma, USA) overnight at 4 °C. Secondary antibodies consisted of goat anti-mouse IgG and mouse antirabbit IgG (1:10,000, Abcam, UK) and were incubated for 1 h at room temperature. Protein bands were visualized by exposure with the Odyssey system. 4.9.
Immunocytochemistry
Cells were fixed with 4% paraformaldehyde for 30 min, incubated with blocking buffer, and then stained for TH (1:500, cat2792, CST, USA), and Oct-4 (1:250, ab27985, Abcam, UK). Primary antibody localization was performed by incubating with fluorescent-labeled secondary antibodies (Alexa Fluor 488labeled or Alexa Fluor 568-labeled goat IgG, 1:500, Invitrogen). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (1:100, Santa Cruz, USA). The control protocols for the antibodies revealed neither nonspecific staining nor antibody cross-reactivity. 4.10.
Statistical analysis
The comparison of relative TH expression by differentiated cells in the PA6 CM was analyzed using a Student's t test. The suppression of T-lymphocyte proliferative activity by
141
HLA-G1-H1 hES cells was compared with negative controls using repeated measurement analysis of variance and Tukey–Kramer post hoc testing. Analysis of whether DA neurons differentiated from HLA-G1-H1 hES cells attenuated the release of IL-1β and IFN-γ compared to negative controls was done with a Student's t test. Supplementary materials related to this article can be found online at doi:10.1016/j.brainres.2011.12.033.
Acknowledgment This work was supported by a grant from the Chinese National 973 Projects (2007CB948102) to Yuanqing Yao. REFERENCES Carosella, E.D., Favier, B., Rouas-Freiss, N., et al., 2008a. Beyond the increasing complexity of the immunomodulatory HLA-G molecules. Blood 111, 4862–4870. Carosella, E.D., Moreau, P., Lemaoult, J., et al., 2008b. HLA-G: from biology to clinical benefits. Trends Immunol. 3, 125–132. Chadwick, K., Wang, L., Li, L., et al., 2003. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood 102, 906–915. Chiba, S., Lee, Y.M., Zhou, W., et al., 2008. Noggin enhances dopamine neuron production from human embryonic stem cells and improves behavioral outcome after transplantation into Parkinsonian rats. Stem Cells 26, 2810–2820. Freed, W.J., Chen, J., Bäckman, C.M., et al., 2008. Gene expression profile of neuronal progenitor cells derived from hESCs: activation of chromosome 11p15.5 and comparison to human dopaminergic neurons. PLoS One 3, 1422–1434. French, A.J., Adams, C.A., Anderson, L.S., et al., 2008. Development of human cloned blastocysts following somatic cell nuclear transfer with adult fibroblasts. Stem Cells 26, 485–493. Geraghty, D.E., 1993. Structure of the HLA class I region and expression of its resident genes. Curr. Opin. Immunol. 5, 3–7. Green, H., Easley, K., Iuchi, S., 2003. Marker succession during the development of keratinocytes from cultured human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 100, 15625–15630. Hayashi, H., Morizane, A., Koyanagi, M., et al., 2008. Meningeal cells induce dopaminergic neurons from embryonic stem cells. Eur. J. Neurosci. 27, 261–268. Hynes, M., Ye, W., Wang, K., et al., 2000. The seven-transmembrance receptor smoothened cell-autonomously induces multiple ventral cell type. Nat. Neurosci. 3, 41–46. Kawasaki, H., Mizuseki, K., Nishikawa, S., et al., 2000. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31–34. Kovats, S., Main, E.K., Librach, C., et al., 1990. A class I antigen, HLA-G, expressed in human trophoblasts. Science 248, 220–223. Lavon, N., Yanuka, O., Benvenisty, N., 2004. Differentiation and isolation of hepatic-like cells from human embryonic stem cells. Differentiation 72, 230–238. Levenberg, S., Golub, J.S., Amit, M., et al., 2002. Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 99, 4391–4396. Meda, L., Cassatella, M.A., Szendrei, G.I., et al., 1995. Activation of microglial cells by β-amyloid protein and IFN-γ. Nature 374, 647–650. Mummery, C., Ward-van Oostwaard, D., Doevendans, P., et al., 2003. Differentiation of human embryonic stem cells to cardiomyocytes: role of coculture with visceral endoderm-like cells. Circulation 107, 2733–2740.
142
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Perry, V.H., Gordon, S., 1988. Macrophages and microglia in the nervous system. Trends Neurosci. 11, 273–277. Roy, N.S., Cleren, C., Singh, S.K., et al., 2006. Functional engraftment of human ES cell-derived dopaminergic neurons enriched by coculture with telomerase-immortalized midbrain astrocytes. Nat. Med. 12, 1259–1268. Schulz, T.C., Palmarini, G.M., Noggle, S.A., et al., 2003. Directed neuronal differentiation of human embryonic stem cells. BMC Neurosci. 4, 27–40. Shaikly, V.R., Morrison, I.E., Taranissi, M., et al., 2008. Analysis of HLA-G in maternal plasma, follicular fluid, and preimplantation embryos reveal an asymmetric pattern of expression. J. Immunol. 180, 4330–4337. Schwartz, C.M., Spivak, C.E., Baker, S.C., et al., 2005. NTera2: a model system to study dopaminergic differentiation of human embryonic stem cells. Stem Cells Dev. 14, 517–534. Shido, F., Ito, T., Nomura, S., et al., 2006. Endoplasmic reticulum aminopeptidase-1 mediates leukemia inhibitory factor-induced cell surface human leukocyte antigen-G expression in JEG-3 choriocarcinoma cells. Endocrinology 147, 1780–1788. Sottile, V., Thomson, A., McWhir, J., 2003. In vitro osteogenic differentiation of human ES cells. Cloning Stem Cells 5, 149–155. Takahashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., et al., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147. van der Meer, A., Lukassen, H.G.M., van Cranenbroek, B., et al., 2006. Soluble HLA-G promotes Th1-type cytokine production by cytokine-activated uterine and peripheral natural killer cells. Mol. Hum. Reprod. 13, 123–133. Vazin, T., Chen, J., Lee, C.T., et al., 2008. Assessment of stromal-derived inducing activity in the generation of dopaminergic neurons from human embryonic stem cells. Stem Cells 26, 1517–1525. Yan, Y., Yang, D., Zarnowska, E.D., et al., 2005. Directed differentiation of dopaminergic neuronal subtypes from human embryonic stem cells. Stem Cells 23, 781–790. Yamazoe, H., Murakami, Y., Mizuseki, K., et al., 2005. Collection of neural inducing factors from PA6 cells using heparin solution and their immobilization on plastic culture dishes for the induction of neurons from embryonic stem cells. Biomaterials 26, 5746–5754. Ye, W., Shimamura, K., Rubenstein, J.L., et al., 1998. FGF and Shh signals conrrol dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93, 755–766. Zeng, X., Cai, J., Chen, J., et al., 2004. Dopaminergic differentiation of human embryonic stem cells. Stem Cells 22, 925–940.
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research Report
DA neurons derived from hES cells that express HLA-G1 are capable of immunosuppression Yajing Zhua, b, 1, 2 , Hongxi Zhaoc, 1, 3 , Li Wangd, 1, 4 , Sanjun Zhaoe, 5 , Feng Jiangc, 6 , Lingsong Lid,⁎, Yuanqing Yaof,⁎⁎ a
Department of Obstetrics and Gynecology, the General Hospital of the People's Liberation Army (PLA), Fuxing Road 28, Beijing 100853, PR China b Nankai University School of Medicine, Weijin Road 94, Tianjin 30071, PR China c Department of Obstetrics and Gynecology, Tangdu Hospital, Fourth Military Medical University, Xi'an, 710038, PR China d Peking University Stem Cell Research Center and China National Center for International Research, Xueyuan Road 38, Beijing 100191, PR China e Department of Anesthesiology, The General Hospital of the People's Liberation Army, Fuxing Road 28, Beijing 100853, PR China f Department of Obstetrics and Gynecology, the General Hospital of the People's Liberation Army, Fuxing Road 28, Beijing, PR China
A R T I C LE I N FO
AB S T R A C T
Article history:
Human embryonic stem (hES) cells have the capacity for self-renewal and exhibit multipo-
Accepted 15 December 2011
tentiality. hES cells have promise for serving as an unlimited source of ideal seed cells for
Available online 23 December 2011
cell transplantation. However, the rejection that occurs between the transplant recipient and the transplanted cell poses a major challenge for therapeutic transplantation. This
Keywords:
study was designed to devise methods to enhance immune tolerance in cell therapy. We
Human embryonic stem cell
established an hES cell line that could stably express human leukocyte antigen-G1 (HLA-
Human leukocyte antigen G
G1). The established HLA-G1-H1 hES cells still retained all the characteristics of normal
Differentiation
human embryonic stem cells. By using the SDIA method, we induced dopaminergic (DA)
Immune rejection
neurons by coculturing HLA-G1-H1 hES cells with the mouse stromal cell line PA6. Tyrosine hydroxylase (TH) + neurons were detected on the 10th day of differentiation, and 70% of the HLA-G1-H1 hES cells were TH + mature DA neurons because the differentiation time was only 3 weeks. Cells that had been differentiating for different periods of time still expressed HLA-G1, and these differentiated DA neurons released dopamine and other catecholamines in response to K + depolarization as measured by HPLC. After careful study, we found that HLA-G1-H1 hES cells are capable of inhibiting the proliferation of mixed T-lymphocytes. DA neurons derived from HLA-G1-H1 hES attenuated the release of proinflammatory
⁎ Corresponding author. Fax: +86 10 8280 2152. ⁎⁎ Corresponding author. Fax: + 86 10 6693 8043. E-mail addresses: [email protected] (L. Li), [email protected] (Y. Yao). Abbreviations: hES, human embryonic stem; HLA-G1, human leukocyte antigen-G1; HPLC, high performance liquid chromatography; TH, Tyrosine hydroxylase; SDIA, stromal-derived inducing activity; SHH, sonic hedgehog homolog; FGF8, fibroblast growth factor 8; DAPI, 4,6-diamidino-2-phenylindole; LPS, lipopolysaccharide 1 The three authors contributed equally to this paper. 2 This author designed the study, conducted the study, analyzed the data, and wrote the manuscript. 3 This author helped design the study, conduct the study, analyze the data, and write the manuscript. 4 This author helped design the study, conduct the study, analyze the data, and write the manuscript. 5 This author helped conduct the study and analyze the data. 0006-8993/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2011.12.033
135
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
cytokines IL-1β and IFN-γ from lipopolysaccharide (LPS)-stimulated BV2 microglia. The efficiency of inhibition was significant and dose-dependent. This method might be used to treat Parkinson's patients via cell transplantation. © 2011 Elsevier B.V. All rights reserved.
1.
Introduction
Human embryonic stem (hES) cells have the capacity for selfrenewal and are multipotent, having the ability to differentiate into advanced derivatives and multiple specialized cell types that can be used for cell transplantation therapy. By utilizing protocols for in vitro derivation, hES cells can be differentiated into neurons (Schulz et al., 2003), cardiomyocytes (Mummery et al., 2003), endothelial cells (Levenberg et al., 2002), hematopoietic precursors (Chadwick et al., 2003), keratinocytes (Green et al., 2003), osteoblasts (Sottile et al., 2003), and hepatocytes (Lavon et al., 2004). Therefore, hES cells can provide an unlimited source of cells due to their ability to produce multiple specialized cell types, which can be exploited in cell transplantation therapy to replace degenerating tissue and cells (Thomson et al., 1998). Many reports have described differentiation of hES cells to dopamine (DA) neurons on immortalized midbrain astrocytes with transplantation into Parkinsonian rats, leading to improvement in circling behavior (Roy et al., 2006). However, there exists a major obstacle for successful cell therapy: immunological rejection after transplantation. To avoid the immune rejection of hES cells or hES derivatives and to achieve the ambitious goals of regenerative medicine, it is necessary to produce a pluripotent cell line that can provide universal seed cells. This goal can be accomplished by transferring somatic cell nucleus to produce pluripotent ES cells, by reprogramming the somatic cells back to a pluripotent state using transcription factors, or by genetically modifying the genes of hES cells (French et al., 2008). Considering the individual differences in patient-specific therapies, one strategy is to engineer a human embryonic stem cell line that can escape immune rejection and serve as a universal donor (Takahashi and Yamanaka, 2006). Such an engineered hES cell line might express either class I and II HLA genes or a nonclassical HLA class I molecule, such as HLA-G. HLA-G belongs to the nonclassical HLA class I family of antigens. Compared to classical HLA class I antigens, HLA-G has the characteristic of limited allelic polymorphism, which produces seven protein isoforms by selectively splicing a single RNA transcript (Carosella et al., 2008a,b). HLA-G is expressed in the fetal trophoblast cells, decidual cells, placental macrophages, and amniotic fluid (Carosella et al., 2008a,b). Neither MHC-I nor MHC-II are expressed in the trophoblast cells of the maternal–fetal surface where the seven protein isoforms of HLA-G are distributed, which indicate that HLA-G perhaps plays an important function in inhibiting the maternal antifetal immune response (Geraghty, 1993). HLA-G can activate cytotoxicity receptors on NK cells to inhibit the antigenspecific cytotoxic lymphocyte (CTL) response and then decrease NK cell function. HLA-G1 is encoded by total HLA-G RNA. Therefore, among other isoforms, HLA-G1 was chosen as a target gene to establish an hES cell line that can stably
express HLA-G1 by over expressing HLA-G1 in normal hESH1. These HLA-G1-H1 hES cells can avoid or alleviate immune rejection. The present study aims to fulfill two major objectives. The first is to establish an hES cell line that can express stable HLA-G1 and then differentiate into midbrain dopaminergic (DA) neurons. The classical method of differentiating hES cells into DA neurons involves several steps: generating embryoid bodies (EBs), selecting nestin-positive neural precursor cells, and differentiating the cells into DA neurons (Hayashi et al., 2008). The most common technique for generating midbrain DA neurons is a coculture method, which, because it uses stromal cells like those of the mouse PA6 cell line, is termed stromal-derived inducing activity (SDIA). The stromal cell line PA6 derived from mouse skull bone marrow serves as a feeder layer and exhibits inducing activity (Chiba et al., 2008). The SDIA method has been adapted for the induction of human dopaminergic neurons in our study. According to the protocol available, we have assessed the ability of growth factors, including sonic hedgehog homolog (SHH) and fibroblast growth factor 8 (FGF8), to enhance the conversion of hES cells into phenotypically stable DA neurons (Vazin et al., 2008). The second objective of this study is to demonstrate if undifferentiated HLA-G1-H1 hES cells and DA neurons derived from HLA-G1-H1 hES cells are capable of immunosuppression, which can facilitate the avoidance or alleviation of immune rejection. HLA-G1-H1 hES cells are able to inhibit the proliferation of mixed T-lymphocytes via coculture. DA neurons derived from HLA-G1-H1 hES cells could reduce the release of inflammatory factors such as IL-1β and IFN-γ when cocultured with BV2 cells activated by LPS. This result provides a mechanistic argument for HLA-G expression in recipient transplants.
2.
Results
2.1. Differentiation of HLA-G1-H1 hES cells into DA neurons We used the improved SDIA method to promote hES cells differentiation into DA neurons (see Experimental procedures). The undifferentiated HLA-G1-H1 hES cells were seeded onto confluent PA6 cells (Fig. 1A). After 3 days in coculture with the PA6 cells, the hES colonies started to show signs of differentiation, including loss of their compact appearance and tight borders (Fig. 1B). At day 7, hES cells developed into classic rosette-like structures (Fig. 1C). By day 10, these rosettelike structures were more obvious, and there was a “black heart” in the cores of the cell colonies (Fig. 1D). After 2 weeks of differentiation, cells migrating out of the colonies formed a monolayer and displayed a bipolar or multipolar morphology characteristic of neurons, with extensive development of
136
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Fig. 1 – Time course of differentiation of HLA-G1-H1 hES and characterization of cellular phenotypes present. (A–F) Phase contrast images of hES cells cocultured with PA6 cells for 0, 3, 7, 10 days, 2 weeks and 3 weeks. (G–I) The bipolar or multipolar morphological characteristics of neurons are visualized by amplifying the black frame and cells from the colonies that were GFP-positive. Scale bars = 400 μm.
fine processes (Fig. 1E). Although hES cells had been differentiating for 3 weeks, it was still possible to find HLA-G1-GFPpositive cells that migrated out of the colonies (Figs. 1F–I).
By immunostaining HLA-G1-H1 hES colonies after 3 weeks of culture on a layer of PA6 cells, we could see 70% of hES colonies that were positive for the dopaminergic neuronal
Fig. 2 – Cells differentiating from HLA-G1-H1 hES cells for 3 weeks exhibited the bipolar or multipolar morphological characteristics and were positive for TH (A–C) and negative for oct-4 (D). The PA6 cells were negative for TH (E). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (F). Scale bars = 400 μm or 200 μm.
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
marker TH (Figs. 2A–C). No oct4-positive colonies were found after 3 weeks of differentiation on PA6 cells (Fig. 2D). PA6 cells did not express TH (Fig. 2E). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (Fig. 2F). We performed RT-PCR and real-time PCR analysis on the cells at different stages (Figs. 3A–B) and found that TH expression was detected at 10 days of coculture. The real-time PCR data showed that relative TH expression increased 4-fold in cells that had been cocultured for 2 weeks compared to 1 week and that relative TH expression increased in a timedependent manner (P < 0.05). Western blot analysis proved that cells at different stages of differentiation continuously express HLA-G1 and TH (Figs. 3C–D).
2.2. HLA-G1-H1 hES cells-derived DA neurons released dopamine and other catecholamines as measured by HPLC and ELISA HPLC and ELISA were used to examine the ability of HLA-G1H1 hES-derived DA neurons to release dopamine and other catecholamines. After three weeks of differentiation, dopamine and other catecholamines were released into the medium in response to a K+ depolarizing stimulus (Fig. 4A). Dopamine was not detected in the supernatant before KCl treatment. HPLC traces demonstrated the evoked release of 2390 pg/ml norepinephrine (NE), 398 pg/ml epinephrine (E), 2477 pg/ml dopamine (DA), and 3161 pg/ml 3,4-
137
dihyroxphenylactic acid (DOPAC) per 106 cells, and the times of peak values were 3.767 min, 4.458 min, 6.333 min and 8.492 min. Dopamine was detected in the cell medium and cell lysate by ELISA after KCL was used for depolarization. The dopamine released was 54.25 ± 3.58 ng/ml in the cell medium and 344.48± 15.35 ng/ml in the cell lysate. Dopamine was not detected in the supernatant without K+ treatment (Fig. 4B) (P < 0.05).
2.3. HLA-G1-H1 hES cells suppressed the proliferative activity of mixed T-lymphocytes in vitro With routine passage method, HLA-G1-H1 hES cells were dissociated to small colonies and seeded at a density of 5 × 103 cells per well in 96-well plates which were coated with 0.1% gelatin. HLA-G1-H1 hES cells were cultured for 48 h and were exposed by Co60γ radiation for 1 h (20 Gy), and then mixed T-lymphocyte was added into 96-well plates according to effector ratio target cell was 10:1, 5:1, 2.5:1, 1.25:1 and 0.625:1. The cell mixture was incubated at 37 °C for 0 h, 12 h, 24 h, 36 h, 48 h and 60 h. Proliferation of mixed T-lymphocytes was measured using a colorimetric assay after HLA-G1-H1 hES cells had been cocultured with human peripheral blood mixed T-lymphocytes for 48 h. The analysis from the absorbance at 450 nm showed that HLA-G1-H1 hES cells could restrain the proliferative activity of mixed T-lymphocytes at different ratios of effector to target cells and that the efficiency of inhibition was significant in a dose-dependent manner
Fig. 3 – Cells expressed HLA-G1 and TH throughout different stages of differentiation. (A) RT-PCR data shows that cells that had differentiated for 10 days can express TH from our modified SDIA treatment. (B) Real-time PCR data shows that the expression of TH increases over the time course of differentiation. (C) Western blot analysis for TH differentiated cells derived from HLA-G1-H1 hES cells and mouse mesencephalon. Data shows the existence of DA neurons that have differentiated from HLA-G1-H1 hES cells. (D) HLA-G1 is expressed continually at different points, but oct-4 is not expressed. Mouse mesencephalon served as positive control for TH. JEG-3 cell served as positive control and K562 cell as negative control for HLA-G.
138
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Fig. 4 – HLA-G1-H1 hES-derived dopaminergic neurons released dopamine and other catecholamines. (A) Representative superimposed chromatogram shows the retention time of the dopamine peak for standards (blue), a sample treated with 56 mM KCl for 15 min (red), and a control sample without KCl treatment (green). (B) Dopamine was detected in the cell medium and cell lysate by ELISA.
(Fig. 5A). We observed the proliferation of mixed Tlymphocytes for 60 h and drew a T-lymphocyte growth curve for the 10:1 effector to target cell ratio. From the curve, we discovered that the growth of a primary culture of mixed T-
lymphocytes was accelerated after 12 h in culture and reached a maximum at 48 h. Therefore, 48 h is sufficient as the testing time for HLA-G1-H1 hES cells cocultured with mixed Tlymphocytes. This experiment was repeated three times,
Fig. 5 – HLA-G1-H1 hES cells and DA neurons derived from HLA-G1-H1 hES cells are capable of immunosuppression. (A, B) HLA-G1-H1 hES cells suppressed the proliferative activity of mixed T-lymphocytes. (C, D) DA neurons differentiated from HLA-G1-H1 hES attenuated the release of proinflammatory cytokines IL-1β and IFN-γ and the efficiency was significant in a dose-dependent manner.
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
and its data are presented as the mean ± SD of three independent experiments as shown in Fig. 5B (P < 0.05).
2.4. DA neurons differentiated from HLA-G1-H1 hES attenuated the release of proinflammatory cytokines from LPS-stimulated BV2 microglia To evaluate the anti-inflammatory effects of DA neurons differentiated from HLA-G1-H1 hES on LPS-stimulated BV2 microglia, DA neurons were cocultured with activated BV2 microglia for 48 h. The negative control was DA neurons differentiated from H1. Cell culture media, IL-1β, and IFN-γ were measured by ELISA. In the negative control experiment, the amount of IL-1β significantly increased from 368± 0.107 pg/ml to 585.5 ± 0.089 pg/ml 48 h after LPS stimulation, and the secretory volume of IL-1β corresponded with the BV2 microglia in a dosedependent manner. In this experiment, the BV2 microglia population was from 5 × 105 to 5 × 104/ml. DA neurons differentiated from HLA-G1-H1 hES cells suppressed IL-1β production in LPSstimulated BV2 microglia from 123 ± 0.083 pg/ml to 183 ± 0.0648 pg/ml. The amount of IFN-γ increased from 15.474 ± 0.005 ng/ml to 24.789 ± 0.0031 ng/ml in the negative control, and DA neurons differentiated from HLA-G1-H1 hES cells suppressed IFN-γ production from 10.73± 0.007 ng/ml to 20.211 ± 0.007 ng/ml. The efficiency of DA neurons differentiated from HLA-G1-H1 hES cells in attenuating the release of proinflammatory cytokines IL-1β and IFN-γ was significant in a dosedependent manner compared to the negative control (Figs. 5C– D) (P < 0.05).
3.
Discussion
Human embryonic stem cells are multipotent and have the capacity for self-renewal, for this reason, hES cells have promise for replacing degenerating tissue and eventually for cell replacement therapy. However, the incompatible immunological rejection that often occurs after transplantation constrains cell replacement therapy. In this study, we devised a strategy to engineer an hES cell line that can avoid the immune response and thus might serve as a universal donor through genetic modification of hES cells. By transfecting lentivirus containing the plasmid iDuet101-IRES-GFP-HLA-G, the HLA-G1 gene was overexpressed in hES cell line H1 (Supplementary Fig. 1A–F). Our data showed that lentivirus could infect hES cells and the target gene could be stably expressed in hES cells through lentiviral transfection. Dopaminergic neurons have been generated from mouse, primate, and human embryonic stem cells by coculture with the PA6 stromal cell line (Kawasaki et al., 2000; Yan et al., 2005; Zeng et al., 2004). In this study, HLA-G1-H1 hES cells were made to differentiate into midbrain DA neurons using the SDIA method. After modifying the available protocols for derivation in vitro, the expression of DA neurons was improved. In our experiments, the differentiation culture medium was supplemented with conditioned medium (CM) of PA6, 40 ng/ml SHH and 40 ng/ml FGF8 on the 7th day of differentiation. TH+ neurons could be observed on the 10th day using RT-PCR, and 70% of HLA-G1-H1 hES cells were TH + mature DA neurons due to only 3 weeks. SHH and FGF8 are two
139
key molecules in the development of midbrain dopaminergic neurons (Ye et al., 1998; Hynes et al., 2000). Several studies suggest that soluble factors secreted by PA6 cells can promote neural differentiation and increase the generation of DA neurons from hES cells (Schwartz et al., 2005; Yamazoe et al., 2005). Dopaminergic induction of hES cells which were cocultured with PA6 cells in the presence of PA6-conditioned medium could be increased by synergistic effects of PA6 cell surface activity and secreted molecules (Vazin et al., 2008). Our modified induction method not only shortened the period of differentiation but also improved efficiency. According to Western blotting, HLA-G1 can still be stably expressed in differentiated cells after different amounts of time spent differentiating. Differentiated dopaminergic neurons could release dopamine and other catecholamines in response to a K+ depolarizing stimulus, as measured by HPLC and ELISA, which indicated that differentiated DA neurons were biologically functional. Although there is an inverse relationship between brain noradrenaline (NE) level and dopamine loss in Parkinson's disease (PD), investigation indicated that NE might have a protective effect on dopamine neurons. Exogenous NE may play a positive role in symptomatic purposes in PD, so our research may provide a new idea in the therapy of PD. Thus, this method is well suited as an in vitro model to study development of DA neurons and for examination of the mechanism of DA neurodegeneration in Parkinson's disease. To confirm whether HLA-G1-H1 hES cells had the capacity to avoid or alleviate the immune response, we analyzed the growth of mixed T-lymphocytes using a CCK-8 kit by coculturing HLA-G1-H1 hES cells with mixed T-lymphocytes. The result showed that HLA-G1-H1 hES cells could not only significantly restrain the proliferative activity of mixed Tlymphocytes but also that the efficiency of inhibition was dose dependent. Many studies have already shown that microglia produce a marked effect on host defense and tissue repair in the central nervous system (CNS) (Perry and Gordon, 1988). Microglia can be activated by LPS, and activated microglia release many proinflammatory cytokines such as interleukin IL-1β, IL-6, TNF-α and interferon IFN-γ (Meda et al., 1995), which are responsible for CNS disease and neuronal death. DA neurons differentiated from HLA-G1-H1 hES cells could attenuate IL-1β secretion from LPS-stimulated BV2 microglia by 3-fold and significantly suppress the amount of IFN-γ released. The efficiency of DA neurons differentiated from HLA-G1-H1 hES cells in attenuating the release of proinflammatory cytokines IL-1β and IFN-γ was dose-dependent. The findings in our study may shed light on how to avoid or alleviate immunological rejection after transplantation in clinical practice and might be able to be used to treat Parkinson's patients via cell transplantation.
4.
Experimental procedures
4.1. line
Cell culture and establishment of the HLA-G1-H1 hES cells
hES cells line H1 was cultured at the Peking University Stem Cell Research Center according to a routine method
140
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
(Levenberg et al., 2002; Schulz et al., 2003). We overexpressed HLA-G1 in the hES cells line H1 using a lentivirus plasmid. The device with which we constructed the lentivirus plasmid was established by Dr. Zhao. The 293T cells were 70–90% confluent for transfection and were cultured with 24 μg of a HLA–G1 DNA mixture (9 μg of iDuet101-IRES-GFP-HLA-G1, 12 μg CMVΔ8.92 and 3 μg pMDG) for 48 h. Cell supernatant was collected, and the viral supernatant was concentrated. For transfection, H1 cells were dissociated into small clusters and transferred to a 35-mm cell culture dish and treated with 20 μl condensed viral supernatant and 3–5 μg/ml polybrene (Sigma, USA). Cells were cultured for 4 h, and then, cells were washed with fresh medium and plated on new MEF feeder layers for culturing. hES cells expressed HLA-G1 after transfection for 48–72 h, and 100 μg/ml hygromycin B (Sigma, USA) was added to the conditioned medium (CM). Drug screening lasted for three passages, and HLA-G1+hES cells were picked and expanded. 4.2.
Induction of DA neurons
The PA6 mouse stromal cell line was cultured at the Peking University Stem Cell Research Center. PA6 cells are mouse skull bone marrow stromal cells, serve as feeder layer and exhibit inducing activity in SDIA method. PA6 cells were cultured according to published methods (Freed et al., 2008; Vazin et al., 2008). Briefly, PA6 cells were seeded at 2 × 106 cells per well in a 60-mm dish coated with collagen type I. The culture medium of PA6 consisted of α-minimum essential medium (Gibco) supplemented with 10% fetal bovine serum (Atlanta Biologicals) and 50 U/ml Penn-Strep. Culturing for 24 h, the medium was replaced with differentiation Glasgow minimum essential medium supplemented with 10% KSR, 1 mM sodium pyruvate (Sigma-Aldrich), 0.1 mM nonessential amino acids (Gibco) and 0.1 mM β-mercaptoethanol (Millipore). To differentiate HLA-G1-H1 hES cells in vitro, hES cells were dissociated from the MEF feeder cells into small colonies and added to the PA6 layer at a density of approximately 50,000–100,000 cells per well. The differentiation culture medium was not changed until cells had differentiated for 4 days, and thereafter, it was changed every day. After cells had cocultured for 7 days, the differentiation culture medium was supplemented with conditioned medium (CM) of PA6 which contained 40 ng/ml SHH and 40 ng/ml FGF8 (Sigma, USA). The HLA-G1-H1 hES cells were allowed to differentiate using this SDIA method for 28 days (Tandis Vazin et al., 2008). 4.3.
Evoked release of dopamine and HPLC
After hES cells had differentiated in culture with PA6 cells for 3 weeks, cultures were depolarized with 56 mM KCl/Hanks’ balanced salt solution (HBSS) for 15 min. The cells that were not treated with KCL were served as a negative control. Metabisulfite and orthophosphoric acid were then added to samples for stabilizing. HPLC detection of dopamine was performed at the Peking University School of Pharmaceutical Science. Briefly, samples were injected by an automatic sampler (SIL-10AC) into an inertsil ODS-3 column (4.6 × 150 mm, 5 μm), and catecholamines were extracted by adsorption to solid Al203 followed by eluting and deadsorption with 0.1 N
acetic acid. The HPLC system consisted of a LC-20AD pump, CBM-20A commander, CTO-20AC column cell, SIL-10AC automatic sampler, and SPD-M20A Diode array Electrochemical Detector. A calibration curve run along with the samples was used to calibrate the instrument. At the same time, cocultured cells that were either treated or untreated with KCL were collected to examine the ability of HLA-G1-H1 hES-derived neurons to release dopamine using an enzyme linked immunosorbent assay (ELISA) (ELISA kit 17-DOPHU-E01, Alpco, USA). Cells untreated with KCL served as a negative control and mice mesencephal as a positive control. 4.4. The proliferative response of mixed T-lymphocytes to HLA-G1-H1 hES cells in vitro The effects of HLA-G1-H1 hES cells on the proliferation of human peripheral blood mixed T-lymphocytes were measured using a colorimetric assay kit (CCK-8 assay kit, Dojindo, Japan). With a routine passage method, HLA-G1-H1 hES cells were dissociated to small colonies and seeded at a density of 5 × 103 cells per well in 96-well plates coated with 0.1% gelatin. HLA-G1-H1 hES cells that had been in culture for 48 h were exposed to Co60γ radiation for 1 h (20 Gy), and then, the mixed T-lymphocytes were added to 96-well plates to produce effector cell to target cell ratios of 10:1, 5:1, 2.5:1, 1.25:1 and 0.625:1. The cell mixture was incubated at 37 °C for 0 h, 12 h, 24 h, 36 h, 48 h and 60 h. Mixed T-lymphocyte cell proliferation was determined by adding 10 μl of the CCK-8 solution to each well and incubating the plate for 1 h in the incubator. Negative controls were hES-H1. We measured the absorbance at 495 nm using a microplate reader and prepared a calibration curve using the data. 4.5. DA neurons derived from HLA-G1-H1 hES cells attenuated the release of proinflammatory cytokines from LPS-stimulated BV2 microglia HLA-G1-H1 hES cells were dissociated and seeded at a density of 5 × 105 on the PA6 cell layer in 6-well plates for differentiation. Three weeks later, the BV2 microglia that had been activated by LPS were reseeded into the 6-well plates that had been differentiating. In this experiment, with activated BV2 cells as the target cell, the quantity of BV2 cells added was determined to meet the effector:target cell ratios of 10:1, 5:1, 2:1 and 1:1. Cells were incubated at 37 °C for 48 h, and the coculture cell supernatant was collected. Pooled supernatant was filtered to remove cell debris, and IL-1β and IFN-γ were measured using ELISA kits (B&D, USA). The negative control was DA neurons differentiated from hES-H1. 4.6. Reverse transcription polymerase chain reaction and real-time PCR Total RNA was extracted from cell or tissue samples using Trizol (Invitrogen, USA). RNA samples were reverse transcribed using random primers (SuperScript III First-Stand kit, Invitrogen). The resultant cDNA was amplified by polymerase chain reaction (PCR, GeneAmp PCR System 9600). For the amplification of cDNA encoding TH and GAPDH the
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
following forward (F) and reverse (R) primer sequences were generated to the target mRNA using the Primer3 program. RT-PCR Primers, TH: F, CCGTGCTAAACCTGCTCTTC; R, CGTGGTGTAGACCTCCTTCC. GAPDH: F, ACCACAGTCCATGCCATCAC; R, TCCACCACCCTGTTGCTGTA. Real-time PCR Primers, TH: F, CAGTTCTCGCAGGACATTGG; R, CCCGTTCTGCTTACACAGC; GAPDH: F, ATGAGAAGTATGACAACAGCCT; R, AGTCCTTCCACGATACCAAAGT. All real-time PCR assays were performed with QuantiTect™ SYBR Green PCR kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The 2-delta delta CT relative quantification method was performed to analyze the data from the Real-time PCR experiment as previously described. 4.7.
Controls
The human choriocarcinoma cell line JEG-3 (American Type Culture Collection) was used; this cell line is known to express detectable levels of HLA-G. JEG-3 cells were cultured in MEM (Sigma-Aldrich) supplemented with 10% fetal calf serum (Shido et al., 2006; Kovats et al., 1990; Shaikly et al., 2008). The HLA-G negative K562 cell line was culture in MEM supplemented with 10% FCS to serve as a control (A.van der Meer et al., 2006). Tyrosine hydroxylase (TH) is a key enzyme in the dopamine (DA) biosynthesis. The substantia nigra is a brain structure located in the mesencephalon (midbrain) that contains high levels of dopaminergic neurons. In this experiment, TH is the marker of DA neurons and mouse mesencephalon (midbrain) served as positive control. 4.8.
Western blots
The membranes were incubated with primary antibodies to HLA-G1 (1:10,000, ab52455, Abcam, UK), TH (1:1000, Cell Signaling 2792, CST, USA), Oct-4 (1:1000, ab27985, Abcam, UK), β-actin (1:10,000, Sigma, USA) overnight at 4 °C. Secondary antibodies consisted of goat anti-mouse IgG and mouse antirabbit IgG (1:10,000, Abcam, UK) and were incubated for 1 h at room temperature. Protein bands were visualized by exposure with the Odyssey system. 4.9.
Immunocytochemistry
Cells were fixed with 4% paraformaldehyde for 30 min, incubated with blocking buffer, and then stained for TH (1:500, cat2792, CST, USA), and Oct-4 (1:250, ab27985, Abcam, UK). Primary antibody localization was performed by incubating with fluorescent-labeled secondary antibodies (Alexa Fluor 488labeled or Alexa Fluor 568-labeled goat IgG, 1:500, Invitrogen). Negative controls were performed by substituting the primary antibodies with nonimmune rabbit IgG (1:100, Santa Cruz, USA). The control protocols for the antibodies revealed neither nonspecific staining nor antibody cross-reactivity. 4.10.
Statistical analysis
The comparison of relative TH expression by differentiated cells in the PA6 CM was analyzed using a Student's t test. The suppression of T-lymphocyte proliferative activity by
141
HLA-G1-H1 hES cells was compared with negative controls using repeated measurement analysis of variance and Tukey–Kramer post hoc testing. Analysis of whether DA neurons differentiated from HLA-G1-H1 hES cells attenuated the release of IL-1β and IFN-γ compared to negative controls was done with a Student's t test. Supplementary materials related to this article can be found online at doi:10.1016/j.brainres.2011.12.033.
Acknowledgment This work was supported by a grant from the Chinese National 973 Projects (2007CB948102) to Yuanqing Yao. REFERENCES Carosella, E.D., Favier, B., Rouas-Freiss, N., et al., 2008a. Beyond the increasing complexity of the immunomodulatory HLA-G molecules. Blood 111, 4862–4870. Carosella, E.D., Moreau, P., Lemaoult, J., et al., 2008b. HLA-G: from biology to clinical benefits. Trends Immunol. 3, 125–132. Chadwick, K., Wang, L., Li, L., et al., 2003. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood 102, 906–915. Chiba, S., Lee, Y.M., Zhou, W., et al., 2008. Noggin enhances dopamine neuron production from human embryonic stem cells and improves behavioral outcome after transplantation into Parkinsonian rats. Stem Cells 26, 2810–2820. Freed, W.J., Chen, J., Bäckman, C.M., et al., 2008. Gene expression profile of neuronal progenitor cells derived from hESCs: activation of chromosome 11p15.5 and comparison to human dopaminergic neurons. PLoS One 3, 1422–1434. French, A.J., Adams, C.A., Anderson, L.S., et al., 2008. Development of human cloned blastocysts following somatic cell nuclear transfer with adult fibroblasts. Stem Cells 26, 485–493. Geraghty, D.E., 1993. Structure of the HLA class I region and expression of its resident genes. Curr. Opin. Immunol. 5, 3–7. Green, H., Easley, K., Iuchi, S., 2003. Marker succession during the development of keratinocytes from cultured human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 100, 15625–15630. Hayashi, H., Morizane, A., Koyanagi, M., et al., 2008. Meningeal cells induce dopaminergic neurons from embryonic stem cells. Eur. J. Neurosci. 27, 261–268. Hynes, M., Ye, W., Wang, K., et al., 2000. The seven-transmembrance receptor smoothened cell-autonomously induces multiple ventral cell type. Nat. Neurosci. 3, 41–46. Kawasaki, H., Mizuseki, K., Nishikawa, S., et al., 2000. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31–34. Kovats, S., Main, E.K., Librach, C., et al., 1990. A class I antigen, HLA-G, expressed in human trophoblasts. Science 248, 220–223. Lavon, N., Yanuka, O., Benvenisty, N., 2004. Differentiation and isolation of hepatic-like cells from human embryonic stem cells. Differentiation 72, 230–238. Levenberg, S., Golub, J.S., Amit, M., et al., 2002. Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 99, 4391–4396. Meda, L., Cassatella, M.A., Szendrei, G.I., et al., 1995. Activation of microglial cells by β-amyloid protein and IFN-γ. Nature 374, 647–650. Mummery, C., Ward-van Oostwaard, D., Doevendans, P., et al., 2003. Differentiation of human embryonic stem cells to cardiomyocytes: role of coculture with visceral endoderm-like cells. Circulation 107, 2733–2740.
142
B RA I N R ES E A RC H 1 4 3 7 ( 2 01 2 ) 1 3 4 –14 2
Perry, V.H., Gordon, S., 1988. Macrophages and microglia in the nervous system. Trends Neurosci. 11, 273–277. Roy, N.S., Cleren, C., Singh, S.K., et al., 2006. Functional engraftment of human ES cell-derived dopaminergic neurons enriched by coculture with telomerase-immortalized midbrain astrocytes. Nat. Med. 12, 1259–1268. Schulz, T.C., Palmarini, G.M., Noggle, S.A., et al., 2003. Directed neuronal differentiation of human embryonic stem cells. BMC Neurosci. 4, 27–40. Shaikly, V.R., Morrison, I.E., Taranissi, M., et al., 2008. Analysis of HLA-G in maternal plasma, follicular fluid, and preimplantation embryos reveal an asymmetric pattern of expression. J. Immunol. 180, 4330–4337. Schwartz, C.M., Spivak, C.E., Baker, S.C., et al., 2005. NTera2: a model system to study dopaminergic differentiation of human embryonic stem cells. Stem Cells Dev. 14, 517–534. Shido, F., Ito, T., Nomura, S., et al., 2006. Endoplasmic reticulum aminopeptidase-1 mediates leukemia inhibitory factor-induced cell surface human leukocyte antigen-G expression in JEG-3 choriocarcinoma cells. Endocrinology 147, 1780–1788. Sottile, V., Thomson, A., McWhir, J., 2003. In vitro osteogenic differentiation of human ES cells. Cloning Stem Cells 5, 149–155. Takahashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., et al., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147. van der Meer, A., Lukassen, H.G.M., van Cranenbroek, B., et al., 2006. Soluble HLA-G promotes Th1-type cytokine production by cytokine-activated uterine and peripheral natural killer cells. Mol. Hum. Reprod. 13, 123–133. Vazin, T., Chen, J., Lee, C.T., et al., 2008. Assessment of stromal-derived inducing activity in the generation of dopaminergic neurons from human embryonic stem cells. Stem Cells 26, 1517–1525. Yan, Y., Yang, D., Zarnowska, E.D., et al., 2005. Directed differentiation of dopaminergic neuronal subtypes from human embryonic stem cells. Stem Cells 23, 781–790. Yamazoe, H., Murakami, Y., Mizuseki, K., et al., 2005. Collection of neural inducing factors from PA6 cells using heparin solution and their immobilization on plastic culture dishes for the induction of neurons from embryonic stem cells. Biomaterials 26, 5746–5754. Ye, W., Shimamura, K., Rubenstein, J.L., et al., 1998. FGF and Shh signals conrrol dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93, 755–766. Zeng, X., Cai, J., Chen, J., et al., 2004. Dopaminergic differentiation of human embryonic stem cells. Stem Cells 22, 925–940.