- Email: [email protected]
NF-κB signaling pathway
Molecular Immunology 120 (2020) 13–22
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Dapk1 improves inflammation, oxidative stress and autophagy in LPSinduced acute lung injury via p38MAPK/NF-κB signaling pathway
T
Tao Li, Yi-Na Wu, Hui Wang, Jun-Yu Ma, Shan-Shan Zhai, Jun Duan* Surgical Intensive Care Unit, China-Japan Friendship Hospital, Beijing 100029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Dapk1 ALI p38MAPK/NF-κB pathway Autophagy Inflammation Oxidative stress
Objective: To investigate the impact of death-associated protein kinase 1 (Dapk1) on lipopolysaccharide (LPS)induced acute lung injury (ALI) via p38MAPK/NF-κB pathway. Methods: Dapk1+/+ and Dapk1−/− mice were randomized into Control, LPS, SB203580 (a p38MAPK pathway inhibitor) + LPS, and PDTC (a NF-κB pathway inhibitor) + LPS groups. Cell counts, lung wet to dry weight ratio (W/D weight ratio), as well as indicators of oxidative stress were determined followed by the detection with HE staining, ELISA, qRT-PCR, Western blotting and Immunofluorescence. Besides, to explore whether the effect of Dapk1 on ALI directly mediated via p38MAPK/NF-κB pathway, mice were injected with TC-DAPK 6 (a Dapk1 inhibitor) with or without SB203580/PDTC before LPS administration. Results: LPS induced lung injury with increased lung W/D weight ratio, which could be partly reversed by SB203580 and PDTC in LPS-induced mice with activated p38MAPK/NF-κB pathway in lung tissues, especially in Dapk1−/− mice. SB203580 and PDTC reduced total cells and neutrophils in BALF in LPS-induced mice, accompanying with decreased levels of TNF-α, IL-6, MPO, LPO and MDA and the expressions of beclin-1, Atg5 and LC3II, but with the up-regulated activities of SOD and GSH-Px, as well as p62 protein expression. Besides, TCDAPK 6 aggravated the pathologic injury in LPS-induced ALI with more serious inflammatory response, oxidative stress and autophagy as well as the activated p38MAPK/NF-κB pathway, which were reversed by SB203580 or PDTC. Conclusion: Dapk1 improved oxidative stress, inhibited autophagy, and reduce inflammatory response of LPSinduced ALI mice by inhibiting p38MAPK/NF-κB pathway.
1. Introduction Sepsis is a systemic dysregulated host response to infection directly leading to multiple-organ dysfunction which is also a common critical disease frequent in intensive care unit (ICU) (Guo et al., 2017). One of the primary target organ affected by sepsis is lung, with development of acute lung injury (ALI), which may further result in acute respiratory dysfunction syndrome (ARDS) in critical conditions, becoming one of the major causes of critical patients’ death (Xiaoli et al., 2019). Also, the mortality rate of sepsis-induced lung injury is still high, to be the primary death cause of sepsis patients (Ali and Ferguson, 2011). The pathogenesis of sepsis-induced lung injury has not been clearly elucidated even today and effective therapy is still in deficiency. Thus, it is of great implication to study in-depth the pathogenic and physiologic mechanisms of sepsis and to develop effective drugs to treat sepsis ALI. Death-associated protein kinase (Dapk) family contains five kinases, namely, Dapk1, Dapk2, ZIPK, Drak1 and Drak2, among which Dapk1 is
⁎
a Ca2/CaM-dependent Ser/Thr protein kinase (Geering, 2015). In 1995, Deiss et al. discovered Dapk1 gene through functional gene cloning technology when they were inducing the death of Hela cells with interferon-γ (Deiss et al., 1995). This gene, located at chromosome 9q34.1 with the protein molecule weight of 160 kD, has a wide range of functions to participate in many pathologic and physiologic processes, including cell necrosis, apoptosis, and autophagy, and has relations to the biological activity of tumors (Bialik et al., 2004; Wang et al., 2017; Yuan et al., 2017). Lipopolysaccharide (LPS), also known as endotoxin, is the major pathogenic factor of sepsis to be widely used in inducing ALI in many in vitro studies (Qian et al., 2019; Vazquez-Medina et al., 2019). It has been reported that LPS-induced mice had appreciably down-regulated expression of pro-apoptosis dapk1 in B-cells (Yu et al., 2016). Tilija Pun, N et al. discovered Dapk1 inhibited LPS-induced inflammatory cytokine expression (TNF-α and IL-1β) in RAW 264.7 macrophage cell in vitro (Tilija Pun and Park, 2018). Importantly, LPSinduced inflammatory responses in lung leukocytes and in lung
Correspondinf author at: Surgical Intensive Care Unit, China-Japan Friendship Hospital, No.2 Yinghua East Street, Chaoyang District, Beijing 100029, China. E-mail address: [email protected] (J. Duan).
https://doi.org/10.1016/j.molimm.2020.01.014 Received 6 November 2019; Received in revised form 25 December 2019; Accepted 22 January 2020 0161-5890/ © 2020 Elsevier Ltd. All rights reserved.
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
levels of inflammatory factors TNF-α and IL-6 by enzyme-linked immunosorbent assay (ELISA). After blood collecting, the left lower lobe of the lung was obtained for calculating the lung wet to dry weight weight ratio (W/D weight ratio) (Sibilla et al., 2002). A part of right lung tissues was perfused with 4 % polyformaldehyde to observe the morphological changes of lung tissues. The remaining part of right lung tissues was preserved in liquid nitrogen for subsequent molecular detection. Based on the instructions of Nanjing Jiancheng Biotechnology Co., Ltd, we detected the levels of myeloperoxidase (MPO), Superoxide dismutase (SOD), Glutathione peroxidase (GSH-Px), lipid peroxides (LPO) and malondialdehyde (MDA).
epithelial cells were also prevented by Dapk1 activation (Cui et al., 2019; Nakav et al., 2012). In addition, Dapk1 can mediate p38MAPK/ NF-κB signaling pathway to participate in development of many diseases. For example, Dapk1 inhibited the innate immune process of skin injury caused by p38MAPK cascade reaction-mediated Caenorhabditis elegans (Tong et al., 2009). Besides, TNF-α-induced NF-κB activation was suppressed by Dapk1 to inhibit the generation of COX-2 and ICAM1 in ovarian cancer cell line (Yoo et al., 2012). It has been well documented that p38MAPK/NF-κB signaling pathway activation was closely related to the progression of sepsis-induced ALI (Dong et al., 2018; Tu et al., 2019). However, it has not been clarified whether Dapk1 can regulate sepsis-induced ALI through the modulation of p38MAPK/NFκB signaling pathway. In this regard, Dapk1+/+ mice and Dapk1−/− mice were conducted in this study to inject with LPS to establish sepsis-induced ALI model, and SB203580 (p38MAPK pathway inhibitor) and PDTC (NF-κB pathway inhibitor) were used to explore the impact of Dapk1 on LPSinduced ALI via mediating p38MAPK/NF-κB pathway.
2.5. The collection of bronchoalveolar lavage fluid (BALF) BALF was collected through cannulating the trachea and lavaging the lung, followed by the wash slowly with sterilized phosphate buffered saline (PBS), which was then placed directly on ice for centrifugation at 2000 rpm for 3 min at 4 °C. The cell-free supernatant was collected for the determination. In addition, the sediment cells were resuspended in PBS. And the total cell count was obtained using a hemocytometer. Meanwhile, the percentage of neutrophils was determined by Gr-1 staining using flow cytometry followed by the formula: total cell count × percentage of neutrophils.
2. Materials and methods 2.1. Ethics statement Animal experiments were approved by Ethics Committee of Laboratory Animals in our hospital and performed in strict accordance with the requirements on the care and use of laboratory animals by International Association for the Study Pain (IASP) (Orlans, 1997).
2.6. HE staining Lung tissues were dehydrated with gradient alcohol, hyalinized with xylene, embedded with paraffin, and sliced into sections of 4 μm thick. Sections were routinely dehydrated, stained with Hematoxylin (C0007, Baomanbio Co., Ltd, Shanghai, China) for 10 min, quickly rinsed with tap water for 30−60 s, differentiated with 1 % alcohol hydrochloride for 1 min, rinsed with tap water for 1 min. After that, the tissues were stained with Eosin, and dehydrated with gradient alcohol (1 min/time), hyalinized with xylene, mounted with neutral resin, and finally observed under an optical microscope (XSP-36, Boshida Optical Instrument Co., Ltd, Shenzhen, China) for morphological changes. The lung injury score range was 0–5 (Y. S. Kim et al., 2016).
2.2. Experimental animals Wild-type (WT, Dapk1+/+) or Dapk1 knockout (Dapk1−/−) male C57BL/6 J background mice (6∼8 weeks old, weighing 20∼25 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China) and kept at animal room at 21−23 °C, with humidity 60 % ± 5 %, regular ventilation, as well as enough drinking water and food. The adaptive feeding lasted one week. 2.3. Establishment of sepsis-induced ALI model Dapk1−/− mice were generated previously (Gozuacik et al., 2008). Dapk1+/+ mice (n = 24) and Dapk1-/- mice (n = 24) were randomized into control group (mice received equal volume of normal saline). LPS group (mice received intranasal administration of 2.5 mg/kg LPS (Park et al., 2018)), SB203580 + LPS group (14 d before intranasal administration of LPS, mice receiving the intravenous (i.v.) injection of 40 mg/kg/day SB203580 (Shah et al., 2017), a p38MAPK pathway inhibitor), PDTC + LPS group (14 d before intranasal administration of LPS, mice received (i.v.) 30 mg/kg/day PDTC, a NF-κB pathway inhibitor (H. Li et al., 2019). To directly explore the impact of Dapk1 for regulating ALI through p38MAPK/NF-κB pathway, C57BL/6 J mice (n = 24) were randomly divided in the following group: LPS group (mice received intranasal administration of 2.5 mg/kg LPS), TC-DAPK 6 + LPS group (before LPS administration, mice intraperitoneally (i.p.) injected with TC-DAPK 6 (1 mg/kg/day, a DAPK1 inhibitor) for 14 days (Cui et al., 2019)), TC-DAPK 6 + SB203580 + LPS group (14 d before intranasal administration of LPS, mice received 1 mg/kg/day TC-DAPK 6 and 40 mg/kg/day SB203580), and TC-DAPK 6 + PDTC + LPS group (14 d before intranasal administration of LPS, mice received 1 mg/kg/ day TC-DAPK 6 and 30 mg/kg/day PDTC). Mice were separately kept in cages for 24 h before sample collection and testing.
2.7. qRT-PCR RNeasy midi kit (Qiagen GmbH, Hilden, Germany) was used to extract total RNA. On-column DNase digestion during the RNA purification was performed using an RNase-free DNase set (Qiagen, Valencia, CA, USA), followed by a second DNase treatment using DNAfree kit (Ambion, Austin, TX) to ensure elimination of all DNA contamination. And the concentrations of RNA and DNA were determined using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE). PrimeScript RT kit (RR014A, Takara Biomedical Technology Co., Ltd, Beijing, China) was used to reverse transcribe into RNA into cDNA. Primer sequences were designed with software Primer 5.0 and synthesized by Nanjing Genscript Co., Ltd (Table 1). According to the procedures on PCR kit (KR011A1, Tiangen Biotech Co., Ltd, Beijing, China), qRT-PCR was performed with the reaction conditions as follows: pre-denaturalization at 95 °C for 5 m in. 30 cycles of 95 °C 40 s, 57 °C 40 s and 72 °C 40 s, and extending 72 °C 10 min and 4 °C 5 min. With GAPDH as internal reference, 2−△△Ct method was used to Table 1 PCR primer sequences used in the experiment. Gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
Dapk1 TNF-α IL-6 GAPDH
CCTGGGTCTTGAGGCAGATA CCTGTAGCCCACGTCGTAG TTCTCTGGGAAATCGTGGAAA GGACGCATTGGTCGTCTGG
TCGCTAATGTTTCTTGCTTGG GGGAGTAGACAAGGTACAACCC TCAGAATTGCCATTGCACAAC TTTGCACTGGTACGTGTTGAT
2.4. Sample collection After 24 h of LPS administration, mice were anesthetized with intraperitoneal ketamine-xylazine (100 mg/kg: 20 mg/kg). The sample blood from abdominal aorta was collected to determine the serum 14
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
treatment groups (namely SB203580 + LPS group and PDTC + LPS group, P > 0.05, Fig. 1C).
calculate the expression of target genes. 2.8. Western blotting
3.2. Expressions of Dapk1 and p38MAPK/NF-κB signaling pathway in lung tissues of mice
Nuclear proteins and total proteins were extracted with reagent kit (Pierce Biotechnology, Rockford, IL, USA), and the concentrations was determined by BCA kit (Pierce Biotechnology, Rockford, IL, USA). After adding loading buffer, protein samples were heated for 10 min at 100 °C. Electrophoresis with 10 % polyacrylamide gel was used to transfer proteins to PVDF membrane. Then the proteins were blocked for 1 h in 5 % BSA at room temperature, followed by the addition of primary antibodies Dapk1 (Product # 702862, 1:1000), p-p38 (Product # PA5-37536, 1:500), p38 (Product # 702273, 2 μg/mL), p65 NF-κB (Product # 436700, 2 μg/mL), LC3 II Product # PA5-35195, 2 μg/mL, Beclin-1 Product # PA5-96649, 1:3000, Atg5 Product # PA5-86100, 1:1000, p62 Product # PA5-78268, 1:1000, β-actin Product # PA585490, 1:10,000, Lamin B Product # PA5-19468, 0.5 μg/mL, for overnight reaction at 4 °C. Next, the protein was washed with TBST, and secondary antibodies were added for 1 h of incubation at room temperature. Roche’s ECL chemiluminescence reagent was used for visualization. The gray value of target bands was analyzed with the software Image J.
The mRNA and protein expression of Dapk1 was not detected in Dapk1−/− mice. In Dapk1+/+ mice, LPS significantly reduced the Dapk1 expression in lung tissues (all P < 0.05), but SB203580 and PDTC didn’t affect the expression of Dapk1 (P > 0.05, Fig. 2A, B, E). To further investigate the impact of Dapk1 on p38MAPK pathway and NFκB pathway in lung tissues of LPS-induced mice (Fig. 2C-E), we found that LPS could effectively up-regulate p-p38 and p65 NF-κB in nuclear in lung tissues of Dapk1+/+ and Dapk1−/−mice by performing western blotting, especially in Dapk1-/- mice, indicating Dapk1 knockout can activate the p38MAPK pathway and NF-κB pathway. In addition, SB203580 reversed the p-p38 up-regulation and p65 NF-κB nuclear translocation in lung tissues of LPS-induced mice (all P < 0.05); meanwhile, PDTC also reduced p65 NF-κB in nuclear without affecting p-p38 in lung tissues of LPS-induced Dapk1+/+ mice and Dapk1-/- mice (all P < 0.05). 3.3. Impact of Dapk1 knockout on cell counts in BALF of LPS-induced mice
2.9. Immunofluorescence
As shown in Fig. 3A-B, LPS significantly increased the total cells and neutrophils in BALF from Dapk1+/+ mice and Dapk1−/− mice, and it was more obvious in Dapk1−/− mice (all P < 0.05). SB203580 reduced the total cells and neutrophils in BALF from Dapk1+/+ mice and Dapk1−/− mice, and PDTC could achieve the similar effect (all P < 0.05).
Paraffin embedded lung tissues were baked in a 60 °C constanttemperature oven for 20 min. After deparaffinization in xylene and dehydration with graded ethanols, heat-mediated antigen retrieval was performed in Tris-EDTA buffer (pH 9.0). And lung sections were then sliced and incubated with antibody against Beclin-1 (1: 200) and LC3 (1: 300) at 4 °C overnight, which were incubated with the second antibodies at room temperature for 1 h in a lucifugal environmental after washing with PBS buffer. Subsequently, the tissue sections were counterstained and rinsed, then observed with the OLYMPUS Fluoview flv1000 confocal laser scanning microscope (Olympus, Tokyo, Japan).
3.4. Dapk1 knockout aggravates inflammatory responses of LPS-induced mice To further understand the impact of Dapk1 on LPS-induced lung inflammatory factors, we used ELISA and qRT-PCR separately to detect TNF-α and IL-6 expressions in BALF and lung tissues (Fig. 3C-F). As a result, LPS remarkably increased the levels of TNF-α and IL-6 in Dapk1+/+ mice, which was much higher in Dapk1−/− mice (all P < 0.05). SB203580 and PDTC apparently inhibited the up-regulation of TNF-α and IL-6 in BALF and lung tissues from Dapk1+/+ mice and Dapk1-/- mice (all P < 0.05).
2.10. Statistical methods SPSS18.0 was used for statistical data analysis. Measurement data were presented by mean ± standard deviation ( x¯ ± s ). Comparison between two groups was tested by Student’s t-test and among multiple groups was performed with One-Way ANOVA. Inter-group difference was analyzed by using Turkey’s test. P < 0.05 indicated the statistical significance of differences.
3.5. Dapk1 knockout aggravates oxidative stress of LPS-induced mice 3. Results
Dapk1+/+ mice and Dapk1−/− mice in the Control groups didn’t differ from each other in the levels of MPO, SOD, GSH-Px, LPO and MDA from lung tissues, as illustrated in Fig. 4 (all P > 0.05). However, after injection of LPS, the SOD and GSH-Px activities were appreciably reduced, while MPO, LPO and MDA levels were dramatically increased, and LPS-induced Dapk1+/+ mice had more obvious oxidative stress than Dapk1−/− mice (all P < 0.05). SB203580 and PDTC improved the oxidative stress of lung tissues from LPS-induced mice (all P < 0.05).
3.1. Dapk1 knockout aggravates LPS-induced lung injury in mice As demonstrated in Fig. 1A, LPS could lead to the significant increase of lung W/D weight ratio in LPS-induced mice, especially in Dapk1−/− mice, while the injection of SB203580 and PDTC appreciably reduced the lung W/D weight ratio (all P < 0.05). Besides, Dapk1+/+ mice and Dapk1−/− mice in the Control group had normal pulmonary histology After 24 h of LPS injection, Dapk1+/+ mice showed interstitium infiltration of inflammatory cells in lung with alveolar wall-thickening and interstitial spaces, which were all improved by the pretreatment of SB203580 and PDTC. However, LPS-induced Dapk1−/− mice had much more severe pathologic injury than LPS-induced Dapk1+/+ mice, which also could be improved by injection of SB203580 and PDTC (all P < 0.05, Fig. 1B). The lung injury score of mice was much higher in the LPS-induced groups than Control groups, which was more obvious in Dapk1−/− mice. However, mice in the SB203580 + LPS group and PDTC + LPS group showed significantly lower lung injury score than the LPS group (all P < 0.05). Besides, mice showed no statistical difference in lung injury score between the
3.6. Dapk1 knockout aggravates cell autophagy of LPS-induced mice LPS significantly up-regulated the protein expressions of beclin-1, Atg5 and LC3II, with the down-regulated p62 in lung tissues of Dapk1+/ + mice and Dapk1−/− mice, especially in Dapk1−/− mice (all P < 0.05). SB203580 and PDTC reduced the protein expressions of beclin-1, Atg5 and LC3II, but increased the p62 expression in lung tissues from LPS-induced Dapk1+/+ mice and Dapk1−/− mice (all P < 0.05, Fig. 5). Additionally, the co-expression of LC3 and Beclin-1 showing the location of autophagosomes and lysosomes by using immunofluorescence confirm the autophagy status in lung tissues (Fig. 6). 15
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 1. Dapk1 knockout aggravates LPS-induced lung injury in mice. Notes: A, Lung wet/dry (W/D) weight ratio of mice in each group; B, Pathological changes of lung tissues of mice detected by HE staining; C, the comparison of lung injury scoring among the groups; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
3.7. Effect of Dapk1 inhibitor (TC-DAPK 6) on LPS-induced ALI through p38MAPK/NF-κB pathway
found between TC-DAPK 6 + LPS group and TC-DAPK 6 + PDTC + LPS group (P > 0.05).
To directly explore the impact of Dapk1 for regulating ALI through p38MAPK/NF-κB pathway, mice were injected with TC-DAPK 6 with or without SB203580/PDTC before intranasal administration of LPS. As illustrated in Fig. 7, the result showed the TC-DAPK 6 aggravated the pathologic injury in LPS-induced ALI with higher total cells and neutrophils in BALF (both P < 0.05). In addition, the more serious inflammatory response, oxidative stress and autophagy were found in mice from the TC-DAPK 6 + LPS group as compared those from the LPS group accompanying with the increased levels of MPO, LPO, MDA, TNF-α and IL-6 and the enhanced protein expressions of beclin-1, Atg5 and LC3II in lung tissues, as well as the decreased activity of GSH-Px and expression of p62 (all P < 0.05). However, the above indexes were reversed by SB203580 or PDTC (all P < 0.05). Moreover, Western blotting revealed that TC-DAPK 6 further activated the p38MAPK pathway and NF-κB pathway in LPS-induced ALI showing higher upregulation of p-p38 and p65 NF-κB nuclear translocation in lung tissues (all P < 0.05). Besides, compared the TC-DAPK 6 + LPS group, the pp38 and p65 NF-κB nuclear translocation in lung tissues were significantly decreased in TC-DAPK 6 + SB203580 + LPS group (both P < 0.05). While no significant difference in p-p38 in lung tissue was
4. Discussion Gene knockout mice models are conducive to studying key genetic mechanisms, discovering gene function, understanding disease pathogenesis, and advancing drug development (Gozuacik et al., 2008). In this study, the Dapk1+/+ and Dapk1−/− mice were performed for LPS induction and established the lung injury models with increased lung W/D weight ratio, especially in Dapk1−/− mice, which suggested that Dapk1 gene may play a protective role in LPS-induced lung injury. As a positive apoptotic regulator, Dapk1 is involved in the apoptosis induced by multiple pathways and plays a vital role in many inflammatory responses (Singh et al., 2016). For example, Song and his group revealed mice received a single intracerebroventricularly injection of DAPK1 inhibitor 1 h before Aβ25–35 administration ameliorated the memory impairment via regulating IL-1β production and caspase-1 activation in microglial cells (Song et al., 2018). A study demonstrated that inhibition of Dapk1 using siRNA in human monocytic THP-1 cells for 96 h significantly reduced suppressed IL-17-induced IL-8 production upon stimulation with proinflammatory cytokines TNF-α and IL-1β (Turner-Brannen et al., 2011). However, in this study, Dapk1−/− mice 16
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 2. Expressions of Dapk1 and p38MAPK/NF-κB signaling pathway in lung tissues of mice. Notes: A–B, Dapk1 mRNA and protein expression in lung tissues of mice in each group detected by qRT-PCR (A) and Western blotting (B), respectively; *, P < 0.05 compared with Control group; C–E, Expressions of p-p38/p38 and p65 NF-κB in nuclear of lung tissues from mice determined by Western blotting; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
concentrations of IL-6 and NF-κB translocation to the nucleus were found in the lung of Dapk1 knockout mice in response to LPS and Tobacco Smoke (Nakav et al., 2012). In our study, the p-p38 expression and p65 NF-κB in nuclear was significantly inhibited in ALI mice after the injection of SB203580 and PDTC. These results suggested that Dapk can attenuate LPS-induced pulmonary inflammation possibly through p38MAPK/NF-κB signaling pathway. Besides, we also found 14d before intranasal administration of LPS, mice receiving TC-DAPK 6 (1 mg/kg/ day) could further activated the p38MAPK/NF-κB signaling pathway in LPS-induced lung tissues with with higher total cells and neutrophils in BALF, suggesting the effect of Dapk1 on LPS-induced ALI was directly mediating p38MAPK/NF-κB pathway. Generally, autophagy, a fundamental catabolic process that maintains cellular homeostasis, plays a key role in regulating the proteins, organelles, and metabolism balance, which is shown to have a close relation with certain lung-related diseases, including ALI (L. Meng et al., 2019a; Qu et al., 2019). Consistent with previous research results, LPS in our research could also reduce the level of autophagy in lung tissue, with the increased beclin-1, Atg5 and LC3II, as well as the decreased p62 (Liu et al., 2018; Xu et al., 2018). As we know, the entire process of autophagy is regulated by many genes, including Atg5 and Beclin1, which are key proteins that initiate autophagy (Booth et al., 2018). In addition, LC3-II is located in pre-autophagosomes and autophagosomes, making itself a marker of autophagosomes, and its content is positively correlated with the number of autophagic vacuoles (Schlafli et al., 2016). P62/SQSTM1 is an ubiquitin-binding protein, whose increased expression indicates the decreased autophagy activity (Shvets and Elazar, 2008). According to the previous study, the enhanced autophagosome formation could almost be abolished by Dapk1 gene silencing through beclin-1 phosphorylation (Tilija Pun and Park, 2018). After determination, the higher expression of beclin-1, Atg5 and LC3II but lower expression of p62 were found in our Dapk1−/− mice than those in Dapk1+/+ mice, indicating that Dapk1 knockout may aggravate LPS-induced autophagy of the lung tissues, and immunofluorescence analysis also verified this result. Moreover, SB203580 was
induced with LPS had the apparently higher total cells and neutrophils in BALF than the Dapk1+/+ mice, as well as the substantially up-regulation of TNF-α and IL-6 levels in the BALF and lung tissues, which was confirmed by the injection (i.p.) of TC-DAPK 6 (1 mg/kg/day, a DAPK1 inhibitor) for 14 days before LPS administration. All mentioned above indicated Dapk1 inhibition could aggravate lung inflammation to some extent in LPS-induced ALI. Consistently, a previous study also found DAPK1 genetic deficiency increased inflammation of patients with hematopoietic stem cell transplantation to aspergillosis in response to IFN-γ (Oikonomou et al., 2016). Worth mentioning, Cui SN and his group also revealed administration of the 5-Aza-2′-deoxycytidine (Aza) to activate Dapk1 in mice accelerated inflammatory resolution in LPS-induced ARDS by promoting neutrophil apoptosis, and the protective effect was attenuated by DAPK1 inhibitor, which was intraperitoneally injected for 14 days before LPS (Cui et al., 2019). The controversy effect of DAPK1 in the regulation of inflammation was possibly dependent on cell types and environment (Oikonomou et al., 2016). In addition, there was previous evidence demonstrating that Dapk1 could protect against ulcerative colitis by binding to phosphorylated p38MAPK, and thereby alleviating chronic inflammatory response (Bajbouj et al., 2009; Steinmann et al., 2015), which could also inhibit NF-κB activation induced by the pro-inflammatory factor TNF-α, and on the contrary, down-regulation of Dapk1 may restore the triggered NF-κB activation (Yoo et al., 2012). In addition, in the study of Usui et al., Dapk1 was identified to exert anti-inflammatory effects by inhibiting the activity of NF-κB in inflammation-induced vasculitis (Usui et al., 2012). Under the pathological conditions of various tissues and organs, the nuclear transcription factor NF-κB may regulate numerous downstream genes related to the immune responses and inflammation (Yeh et al., 2014). Specifically, when cells stimulated by LPS, IκB kinase (IKK) would be activated, leading to the phosphorylation and rapid degradation of downstream IκB protein in the cytoplasm, and thus the dissociated NF-κB could enter the nucleus to regulate the expression of genes involved in inflammation (Han et al., 2018; Huang et al., 2013). There was a recent study confirmed that the higher 17
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 3. Impact of Dapk1 knockout on cell counts and inflammatory responses of LPS-induced mice. Notes: A, Total cells; B, Neutrophils counts; C–D, Expression of TNF-α (C) and IL-6 (D) in BALF determined by ELISA; E–F, Expression of mRNA of TNF-α (E) and IL-6 (F) in lung tissues measured by qRT-PCR; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
shown to inhibit cell death and autophagy of human gingival fibroblasts (D. S. Kim et al., 2010), while PDTC treatment could restore gastric damage and reduce autophagy caused by H2O (Duan et al., 2015),
suggesting that inhibition of p38MAPK/NF-κB signaling pathway can improve LPS-induced autophagy in lung tissues. Notably, a previous study also reported that Dapk1 could mediate the induction of 18
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 4. Impact of Dapk1 knockout on oxidative stress of lung tissues in LPS-induced mice. Notes: A, LPO level; B, MPO activity; C, SOD activity; D, GSH-Px activity; E, MDA content; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
alleviate the oxidative stress increased by LPS in lung tissues and mitigate mitochondrial dysfunction (Yang et al., 2018). Not surprisingly, Dapk1 knockout in our investigation aggravated the oxidative stress in lung tissue of LPS-induced ALI mice, accompanied with the decrease in SOD and GSH-Px activity, as well as the increase in MPO activity, LPO level and MDA content. After injection of p38MAPK/NF-κB signaling pathway inhibitor, LPS-induced mice were improved autophagy and
autophagy in response to oxidative damage (Eisenberg-Lerner and Kimchi, 2012), and at the meantime, oxidative stress damage has been found to play an important role in LPS-induced ALI (X. Meng et al., 2019b; Zhang et al., 2019). Also, inhibition of p38MAPK/NF-κB signaling pathway can significantly reduce the oxidative stress (Dong et al., 2018; Y. Li et al., 2016; Nathens et al., 1997). For example, Yang H et al. demonstrated that pre-treatment with PDTC could obviously
Fig. 5. Expression of autophagy-related proteins (beclin-1, Atg5, LC3II and p62) detected by Western Blotting. Notes: The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05. 19
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 6. The colocalization of autophagosome and lysosome in lung tissues. Notes: The representative image of double immunolabeling against LC3 (red) and Beclin-1 (green) confocal microscopy suggested the fusion of autophagosomes with lysosomes
Fig. 7. Effect of Dapk1 inhibitor (TC-DAPK 6) on LPS-induced ALI through p38MAPK/NF-κB pathway. Notes: A–B, Pathological changes of lung tissues from mice detected by HE staining (A), and the comparison of lung injury scoring among the groups (B); C: Comparison of total cells and Neutrophils in Bal fluid (BLAF); D: Expression of mRNA of TNF-α and IL-6 in lung tissues measured by qRT-PCR; E: Comparison of oxidative stress indices (MPO, LPO, GSH-Px and MDA) of lung tissues among the groups; F-G: Expression of autophagy-related proteins (beclin-1, Atg5, LC3II and p62) and p38MAPK/NF-κB signaling pathway -related proteins (p-p38/p38 and p65 NF-κB in nuclear) detected by Western Blotting. *, P < 0.05 compared with LPS group; #, P < 0.05 compared with TC-DAPK 6 + LPS group. 20
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
oxidative stress of lung. Possibly, Dapk1 knockdown reversed the role of its pathway inhibitors by activating the p38MAPK/NF-κB signaling pathway. To conclude, the expression of Dapk1 was decreased and the p38MAPK/NF-κB signaling pathway was activated in lung tissue of LPSinduced ALI mice. Further, Dapk1 improved lung injury, alleviated inflammatory response, and improved oxidative stress and autophagy in ALI mice via the inhibition of p38MAPK/NF-κB pathway.
Kim, D.S., Kim, J.H., Lee, G.H., Kim, H.T., Lim, J.M., Chae, S.W., Chae, H.J., Kim, H.R., 2010. p38 Mitogen-activated protein kinase is involved in endoplasmic reticulum stress-induced cell death and autophagy in human gingival fibroblasts. Biol. Pharm. Bull. 33, 545–549. Kim, Y.S., Hwang, J.W., Jang, J.H., Son, S., Seo, I.B., Jeong, J.H., Kim, E.H., Moon, S.H., Jeon, B.T., Park, P.J., 2016. Trapa japonica pericarp extract reduces LPS-Induced inflammation in macrophages and acute lung injury in mice. Molecules 21, 392. Li, Y., Chi, G., Shen, B., Tian, Y., Feng, H., 2016. Isorhamnetin ameliorates LPS-induced inflammatory response through downregulation of NF-kappaB signaling. Inflammation 39, 1291–1301. Li, H., Hou, H., Liu, S., Feng, Y., Zhong, W., Hu, X., Yan, N., 2019. miR-33 and RIP140 participate in LPS-induced acute lung injury. Turk. J. Med. Sci. 49, 422–428. Liu, H., Zhou, K., Liao, L., Zhang, T., Yang, M., Sun, C., 2018. Lipoxin A4 receptor agonist BML-111 induces autophagy in alveolar macrophages and protects from acute lung injury by activating MAPK signaling. Respir. Res. 19, 243. Meng, L., Zhao, X., Zhang, H., 2019a. HIPK1 interference attenuates inflammation and oxidative stress of acute lung injury via autophagy. Med. Sci. Monit. 25, 827–835. Meng, X., Hu, L., Li, W., 2019b. Baicalin ameliorates lipopolysaccharide-induced acute lung injury in mice by suppressing oxidative stress and inflammation via the activation of the Nrf2-mediated HO-1 signaling pathway. Naunyn Schmiedebergs Arch. Pharmacol. 392, 1421–1433. Nakav, S., Cohen, S., Feigelson, S.W., Bialik, S., Shoseyov, D., Kimchi, A., Alon, R., 2012. Tumor suppressor death-associated protein kinase attenuates inflammatory responses in the lung. Am. J. Respir. Cell Mol. Biol. 46, 313–322. Nathens, A.B., Bitar, R., Davreux, C., Bujard, M., Marshall, J.C., Dackiw, A.P., Watson, R.W., Rotstein, O.D., 1997. Pyrrolidine dithiocarbamate attenuates endotoxin-induced acute lung injury. Am. J. Respir. Cell Mol. Biol. 17, 608–616. Oikonomou, V., Moretti, S., Renga, G., Galosi, C., Borghi, M., Pariano, M., Puccetti, M., Palmerini, C.A., Amico, L., Carotti, A., Prezioso, L., Spolzino, A., Finocchi, A., Rossi, P., Velardi, A., Aversa, F., Napolioni, V., Romani, L., 2016. Noncanonical fungal autophagy inhibits inflammation in response to IFN-gamma via DAPK1. Cell Host Microbe 20, 744–757. Orlans, F.B., 1997. Ethical decision making about animal experiments. Ethics Behav. 7, 163–171. Park, J., Chen, Y., Zheng, M., Ryu, J., Cho, G.J., Surh, Y.J., Sato, D., Hamada, H., Ryter, S.W., Kim, U.H., Joe, Y., Chung, H.T., 2018. Pterostilbene 4’-beta-Glucoside attenuates LPS-Induced acute lung injury via induction of heme Oxygenase-1. Oxid. Med. Cell. Longev. 2018, 2747018. Qian, J., Chen, X., Shu, S., Zhang, W., Fang, B., Chen, X., Zhao, Y., Liu, Z., Liang, G., 2019. Design and synthesis novel di-carbonyl analogs of curcumin (DACs) act as potent anti-inflammatory agents against LPS-induced acute lung injury (ALI). Eur. J. Med. Chem. 167, 414–425. Qu, L., Chen, C., Chen, Y., Li, Y., Tang, F., Huang, H., He, W., Zhang, R., Shen, L., 2019. High-mobility group Box 1 (HMGB1) and autophagy in acute lung injury (ALI): a review. Med. Sci. Monit. 25, 1828–1837. Schlafli, A.M., Adams, O., Galvan, J.A., Gugger, M., Savic, S., Bubendorf, L., Schmid, R.A., Becker, K.F., Tschan, M.P., Langer, R., Berezowska, S., 2016. Prognostic value of the autophagy markers LC3 and p62/SQSTM1 in early-stage non-small cell lung cancer. Oncotarget 7, 39544–39555. Shah, N.G., Tulapurkar, M.E., Ramarathnam, A., Brophy, A., Martinez 3rd, R., Hom, K., Hodges, T., Samadani, R., Singh, I.S., MacKerell Jr., A.D., Shapiro, P., Hasday, J.D., 2017. Novel noncatalytic substrate-selective p38alpha-Specific MAPK inhibitors with endothelial-stabilizing and anti-inflammatory activity. J. Immunol. 198, 3296–3306. Shvets, E., Elazar, Z., 2008. Autophagy-independent incorporation of GFP-LC3 into protein aggregates is dependent on its interaction with p62/SQSTM1. Autophagy 4, 1054–1056. Sibilla, S., Tredici, S., Porro, A., Irace, M., Guglielmi, M., Nicolini, G., Tredici, G., Valenza, F., Gattinoni, L., 2002. Equal increases in respiratory system elastance reflect similar lung damage in experimental ventilator-induced lung injury. Intensive Care Med. 28, 196–203. Singh, P., Ravanan, P., Talwar, P., 2016. Death associated protein kinase 1 (DAPK1): a regulator of apoptosis and autophagy. Front. Mol. Neurosci. 9, 46. Song, L., Pei, L., Hu, L., Pan, S., Xiong, W., Liu, M., Wu, Y., Shang, Y., Yao, S., 2018. Death-associated protein kinase 1 mediates interleukin-1beta production through regulating inlfammasome activation in Bv2 microglial cells and mice. Sci. Rep. 8, 9930. Steinmann, S., Scheibe, K., Erlenbach-Wuensch, K., Neufert, C., Schneider-Stock, R., 2015. Death-associated protein kinase: a molecule with functional antagonistic duality and a potential role in inflammatory bowel disease (Review). Int. J. Oncol. 47, 5–15. Tilija Pun, N., Park, P.H., 2018. Adiponectin inhibits inflammatory cytokines production by Beclin-1 phosphorylation and B-cell lymphoma 2 mRNA destabilization: role for autophagy induction. Br. J. Pharmacol. 175, 1066–1084. Tong, A., Lynn, G., Ngo, V., Wong, D., Moseley, S.L., Ewbank, J.J., Goncharov, A., Wu, Y.C., Pujol, N., Chisholm, A.D., 2009. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A 106, 1457–1461. Tu, G.W., Ju, M.J., Zheng, Y.J., Hao, G.W., Ma, G.G., Hou, J.Y., Zhang, X.P., Luo, Z., Lu, L.M., 2019. CXCL16/CXCR6 is involved in LPS-induced acute lung injury via P38 signalling. J. Cell. Mol. Med. 23, 5380–5389. Turner-Brannen, E., Choi, K.Y., Arsenault, R., El-Gabalawy, H., Napper, S., Mookherjee, N., 2011. Inflammatory cytokines IL-32 and IL-17 have common signaling intermediates despite differential dependence on TNF-receptor 1. J. Immunol. 186, 7127–7135. Usui, T., Okada, M., Hara, Y., Yamawaki, H., 2012. Death-associated protein kinase 3 mediates vascular inflammation and development of hypertension in spontaneously
CRediT authorship contribution statement Tao Li: Conceptualization, Data curation. Yi-Na Wu: Formal analysis. Hui Wang: Methodology, Project administration, Software. JunYu Ma: Supervision, Validation. Shan-Shan Zhai: Writing - original draft, Writing - review & editing. Jun Duan: Writing - original draft, Writing - review & editing. Declaration of Competing Interest None. Acknowledgement The study was supported by China-Japan Friendship Hospital Foundation for Youth (2017-1-QN-7), National Science Foundation of China (81774265), and National Science Foundation of China (81700260). References Ali, S., Ferguson, N.D., 2011. High-frequency oscillatory ventilation in ALI/ARDS. Crit. Care Clin. 27, 487–499. Bajbouj, K., Poehlmann, A., Kuester, D., Drewes, T., Haase, K., Hartig, R., Teller, A., Kliche, S., Walluscheck, D., Ivanovska, J., Chakilam, S., Ulitzsch, A., Bommhardt, U., Leverkus, M., Roessner, A., Schneider-Stock, R., 2009. RETRACTED: identification of phosphorylated p38 as a novel DAPK-interacting partner during TNFalpha-induced apoptosis in colorectal tumor cells. Am. J. Pathol. 175, 557–570. Bialik, S., Bresnick, A.R., Kimchi, A., 2004. DAP-kinase-mediated morphological changes are localization dependent and involve myosin-II phosphorylation. Cell Death Differ. 11, 631–644. Booth, L., Roberts, J.L., Poklepovic, A., Kirkwood, J., Sander, C., Avogadri-Connors, F., Cutler Jr., R.E., Lalani, A.S., Dent, P., 2018. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib. Cancer Biol. Ther. 19, 132–137. Cui, S.N., Chen, L., Yang, Y.Y., Wang, Y.X., Li, S.N., Zhou, T., Xiao, H.R., Qin, L., Yang, W., Yuan, S.Y., Yao, S.L., Shang, Y., 2019. Activation of death-associated protein kinase 1 promotes neutrophil apoptosis to accelerate inflammatory resolution in acute respiratory distress syndrome. Lab. Invest. 99, 1143–1156. Deiss, L.P., Feinstein, E., Berissi, H., Cohen, O., Kimchi, A., 1995. Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death. Genes Dev. 9, 15–30. Dong, S.A., Zhang, Y., Yu, J.B., Li, X.Y., Gong, L.R., Shi, J., Kang, Y.Y., 2018. Carbon monoxide attenuates lipopolysaccharide-induced lung injury by mitofusin proteins via p38 MAPK pathway. J. Surg. Res. 228, 201–210. Duan, J.L., Yin, J., Ren, W.K., Wu, M.M., Chen, S., Cui, Z.J., Wu, X., Huang, R.L., Li, T.J., Yin, Y.L., 2015. Pyrrolidine dithiocarbamate restores gastric damages and suppressive autophagy induced by hydrogen peroxide. Free Radic. Res. 49, 210–218. Eisenberg-Lerner, A., Kimchi, A., 2012. PKD is a kinase of Vps34 that mediates ROSinduced autophagy downstream of DAPk. Cell Death Differ. 19, 788–797. Geering, B., 2015. Death-associated protein kinase 2: regulator of apoptosis, autophagy and inflammation. Int. J. Biochem. Cell Biol. 65, 151–154. Gozuacik, D., Bialik, S., Raveh, T., Mitou, G., Shohat, G., Sabanay, H., Mizushima, N., Yoshimori, T., Kimchi, A., 2008. DAP-kinase is a mediator of endoplasmic reticulum stress-induced caspase activation and autophagic cell death. Cell Death Differ. 15, 1875–1886. Guo, J., Tao, W., Tang, D., Zhang, J., 2017. Th17/regulatory T cell imbalance in sepsis patients with multiple organ dysfunction syndrome: attenuated by high-volume hemofiltration. Int. J. Artif. Organs 40, 607–614. Han, X., Wu, Y.C., Meng, M., Sun, Q.S., Gao, S.M., Sun, H., 2018. Linarin prevents LPSinduced acute lung injury by suppressing oxidative stress and inflammation via inhibition of TXNIP/NLRP3 and NFkappaB pathways. Int. J. Mol. Med. 42, 1460–1472. Huang, C.H., Yang, M.L., Tsai, C.H., Li, Y.C., Lin, Y.J., Kuan, Y.H., 2013. Ginkgo biloba leaves extract (EGb 761) attenuates lipopolysaccharide-induced acute lung injury via inhibition of oxidative stress and NF-kappaB-dependent matrix metalloproteinase-9 pathway. Phytomedicine 20, 303–309.
21
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Yeh, C.H., Yang, J.J., Yang, M.L., Li, Y.C., Kuan, Y.H., 2014. Rutin decreases lipopolysaccharide-induced acute lung injury via inhibition of oxidative stress and the MAPKNF-kappaB pathway. Free Radic. Biol. Med. 69, 249–257. Yoo, H.J., Byun, H.J., Kim, B.R., Lee, K.H., Park, S.Y., Rho, S.B., 2012. DAPk1 inhibits NFkappaB activation through TNF-alpha and INF-gamma-induced apoptosis. Cell. Signal. 24, 1471–1477. Yu, X., Wang, Y., Lin, J., Hu, Y., Kawai, T., Taubman, M.A., Han, X., 2016. Lipopolysaccharides-induced suppression of innate-like B cell apoptosis is enhanced by CpG oligodeoxynucleotide and requires toll-like receptors 2 and 4. PLoS One 11, e0165862. Yuan, W., Chen, J., Shu, Y., Liu, S., Wu, L., Ji, J., Liu, Z., Tang, Q., Zhou, Z., Cheng, Y., Jiang, B., Shu, X., 2017. Correlation of DAPK1 methylation and the risk of gastrointestinal cancer: a systematic review and meta-analysis. PLoS One 12, e0184959. Zhang, Z.M., Wang, Y.C., Chen, L., Li, Z., 2019. Protective effects of the suppressed NFkappaB/TLR4 signaling pathway on oxidative stress of lung tissue in rat with acute lung injury. Kaohsiung J. Med. Sci. 35, 265–276.
hypertensive rats. Hypertension 60, 1031–1039. Vazquez-Medina, J.P., Tao, J.Q., Patel, P., Bannitz-Fernandes, R., Dodia, C., Sorokina, E.M., Feinstein, S.I., Chatterjee, S., Fisher, A.B., 2019. Genetic inactivation of the phospholipase A2 activity of peroxiredoxin 6 in mice protects against LPS-induced acute lung injury. American journal of physiology. Lung cell. Mol. Physiol. 316, L656–L668. Wang, S., Shi, X., Li, H., Pang, P., Pei, L., Shen, H., Lu, Y., 2017. DAPK1 signaling pathways in stroke: from mechanisms to therapies. Mol. Neurobiol. 54, 4716–4722. Xiaoli, L., Wujun, Z., Jing, L., 2019. Blocking of tripartite motif 8 protects against lipopolysaccharide (LPS)-induced acute lung injury by regulating AMPKalpha activity. Biochem. Biophys. Res. Commun. 508, 701–708. Xu, X., Li, H., Gong, Y., Zheng, H., Zhao, D., 2018. Hydrogen sulfide ameliorated lipopolysaccharide-induced acute lung injury by inhibiting autophagy through PI3K/ Akt/mTOR pathway in mice. Biochem. Biophys. Res. Commun. 507, 514–518. Yang, H., Chao, K., Liang, M., Sun, R., 2018. [Effect of pyrrolidine dithiocarbamate on oxidative stress and mitochondrial function of lung tissue in mice with acute lung injury]. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue 30, 428–433.
22
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Dapk1 improves inflammation, oxidative stress and autophagy in LPSinduced acute lung injury via p38MAPK/NF-κB signaling pathway
T
Tao Li, Yi-Na Wu, Hui Wang, Jun-Yu Ma, Shan-Shan Zhai, Jun Duan* Surgical Intensive Care Unit, China-Japan Friendship Hospital, Beijing 100029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Dapk1 ALI p38MAPK/NF-κB pathway Autophagy Inflammation Oxidative stress
Objective: To investigate the impact of death-associated protein kinase 1 (Dapk1) on lipopolysaccharide (LPS)induced acute lung injury (ALI) via p38MAPK/NF-κB pathway. Methods: Dapk1+/+ and Dapk1−/− mice were randomized into Control, LPS, SB203580 (a p38MAPK pathway inhibitor) + LPS, and PDTC (a NF-κB pathway inhibitor) + LPS groups. Cell counts, lung wet to dry weight ratio (W/D weight ratio), as well as indicators of oxidative stress were determined followed by the detection with HE staining, ELISA, qRT-PCR, Western blotting and Immunofluorescence. Besides, to explore whether the effect of Dapk1 on ALI directly mediated via p38MAPK/NF-κB pathway, mice were injected with TC-DAPK 6 (a Dapk1 inhibitor) with or without SB203580/PDTC before LPS administration. Results: LPS induced lung injury with increased lung W/D weight ratio, which could be partly reversed by SB203580 and PDTC in LPS-induced mice with activated p38MAPK/NF-κB pathway in lung tissues, especially in Dapk1−/− mice. SB203580 and PDTC reduced total cells and neutrophils in BALF in LPS-induced mice, accompanying with decreased levels of TNF-α, IL-6, MPO, LPO and MDA and the expressions of beclin-1, Atg5 and LC3II, but with the up-regulated activities of SOD and GSH-Px, as well as p62 protein expression. Besides, TCDAPK 6 aggravated the pathologic injury in LPS-induced ALI with more serious inflammatory response, oxidative stress and autophagy as well as the activated p38MAPK/NF-κB pathway, which were reversed by SB203580 or PDTC. Conclusion: Dapk1 improved oxidative stress, inhibited autophagy, and reduce inflammatory response of LPSinduced ALI mice by inhibiting p38MAPK/NF-κB pathway.
1. Introduction Sepsis is a systemic dysregulated host response to infection directly leading to multiple-organ dysfunction which is also a common critical disease frequent in intensive care unit (ICU) (Guo et al., 2017). One of the primary target organ affected by sepsis is lung, with development of acute lung injury (ALI), which may further result in acute respiratory dysfunction syndrome (ARDS) in critical conditions, becoming one of the major causes of critical patients’ death (Xiaoli et al., 2019). Also, the mortality rate of sepsis-induced lung injury is still high, to be the primary death cause of sepsis patients (Ali and Ferguson, 2011). The pathogenesis of sepsis-induced lung injury has not been clearly elucidated even today and effective therapy is still in deficiency. Thus, it is of great implication to study in-depth the pathogenic and physiologic mechanisms of sepsis and to develop effective drugs to treat sepsis ALI. Death-associated protein kinase (Dapk) family contains five kinases, namely, Dapk1, Dapk2, ZIPK, Drak1 and Drak2, among which Dapk1 is
⁎
a Ca2/CaM-dependent Ser/Thr protein kinase (Geering, 2015). In 1995, Deiss et al. discovered Dapk1 gene through functional gene cloning technology when they were inducing the death of Hela cells with interferon-γ (Deiss et al., 1995). This gene, located at chromosome 9q34.1 with the protein molecule weight of 160 kD, has a wide range of functions to participate in many pathologic and physiologic processes, including cell necrosis, apoptosis, and autophagy, and has relations to the biological activity of tumors (Bialik et al., 2004; Wang et al., 2017; Yuan et al., 2017). Lipopolysaccharide (LPS), also known as endotoxin, is the major pathogenic factor of sepsis to be widely used in inducing ALI in many in vitro studies (Qian et al., 2019; Vazquez-Medina et al., 2019). It has been reported that LPS-induced mice had appreciably down-regulated expression of pro-apoptosis dapk1 in B-cells (Yu et al., 2016). Tilija Pun, N et al. discovered Dapk1 inhibited LPS-induced inflammatory cytokine expression (TNF-α and IL-1β) in RAW 264.7 macrophage cell in vitro (Tilija Pun and Park, 2018). Importantly, LPSinduced inflammatory responses in lung leukocytes and in lung
Correspondinf author at: Surgical Intensive Care Unit, China-Japan Friendship Hospital, No.2 Yinghua East Street, Chaoyang District, Beijing 100029, China. E-mail address: [email protected] (J. Duan).
https://doi.org/10.1016/j.molimm.2020.01.014 Received 6 November 2019; Received in revised form 25 December 2019; Accepted 22 January 2020 0161-5890/ © 2020 Elsevier Ltd. All rights reserved.
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
levels of inflammatory factors TNF-α and IL-6 by enzyme-linked immunosorbent assay (ELISA). After blood collecting, the left lower lobe of the lung was obtained for calculating the lung wet to dry weight weight ratio (W/D weight ratio) (Sibilla et al., 2002). A part of right lung tissues was perfused with 4 % polyformaldehyde to observe the morphological changes of lung tissues. The remaining part of right lung tissues was preserved in liquid nitrogen for subsequent molecular detection. Based on the instructions of Nanjing Jiancheng Biotechnology Co., Ltd, we detected the levels of myeloperoxidase (MPO), Superoxide dismutase (SOD), Glutathione peroxidase (GSH-Px), lipid peroxides (LPO) and malondialdehyde (MDA).
epithelial cells were also prevented by Dapk1 activation (Cui et al., 2019; Nakav et al., 2012). In addition, Dapk1 can mediate p38MAPK/ NF-κB signaling pathway to participate in development of many diseases. For example, Dapk1 inhibited the innate immune process of skin injury caused by p38MAPK cascade reaction-mediated Caenorhabditis elegans (Tong et al., 2009). Besides, TNF-α-induced NF-κB activation was suppressed by Dapk1 to inhibit the generation of COX-2 and ICAM1 in ovarian cancer cell line (Yoo et al., 2012). It has been well documented that p38MAPK/NF-κB signaling pathway activation was closely related to the progression of sepsis-induced ALI (Dong et al., 2018; Tu et al., 2019). However, it has not been clarified whether Dapk1 can regulate sepsis-induced ALI through the modulation of p38MAPK/NFκB signaling pathway. In this regard, Dapk1+/+ mice and Dapk1−/− mice were conducted in this study to inject with LPS to establish sepsis-induced ALI model, and SB203580 (p38MAPK pathway inhibitor) and PDTC (NF-κB pathway inhibitor) were used to explore the impact of Dapk1 on LPSinduced ALI via mediating p38MAPK/NF-κB pathway.
2.5. The collection of bronchoalveolar lavage fluid (BALF) BALF was collected through cannulating the trachea and lavaging the lung, followed by the wash slowly with sterilized phosphate buffered saline (PBS), which was then placed directly on ice for centrifugation at 2000 rpm for 3 min at 4 °C. The cell-free supernatant was collected for the determination. In addition, the sediment cells were resuspended in PBS. And the total cell count was obtained using a hemocytometer. Meanwhile, the percentage of neutrophils was determined by Gr-1 staining using flow cytometry followed by the formula: total cell count × percentage of neutrophils.
2. Materials and methods 2.1. Ethics statement Animal experiments were approved by Ethics Committee of Laboratory Animals in our hospital and performed in strict accordance with the requirements on the care and use of laboratory animals by International Association for the Study Pain (IASP) (Orlans, 1997).
2.6. HE staining Lung tissues were dehydrated with gradient alcohol, hyalinized with xylene, embedded with paraffin, and sliced into sections of 4 μm thick. Sections were routinely dehydrated, stained with Hematoxylin (C0007, Baomanbio Co., Ltd, Shanghai, China) for 10 min, quickly rinsed with tap water for 30−60 s, differentiated with 1 % alcohol hydrochloride for 1 min, rinsed with tap water for 1 min. After that, the tissues were stained with Eosin, and dehydrated with gradient alcohol (1 min/time), hyalinized with xylene, mounted with neutral resin, and finally observed under an optical microscope (XSP-36, Boshida Optical Instrument Co., Ltd, Shenzhen, China) for morphological changes. The lung injury score range was 0–5 (Y. S. Kim et al., 2016).
2.2. Experimental animals Wild-type (WT, Dapk1+/+) or Dapk1 knockout (Dapk1−/−) male C57BL/6 J background mice (6∼8 weeks old, weighing 20∼25 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China) and kept at animal room at 21−23 °C, with humidity 60 % ± 5 %, regular ventilation, as well as enough drinking water and food. The adaptive feeding lasted one week. 2.3. Establishment of sepsis-induced ALI model Dapk1−/− mice were generated previously (Gozuacik et al., 2008). Dapk1+/+ mice (n = 24) and Dapk1-/- mice (n = 24) were randomized into control group (mice received equal volume of normal saline). LPS group (mice received intranasal administration of 2.5 mg/kg LPS (Park et al., 2018)), SB203580 + LPS group (14 d before intranasal administration of LPS, mice receiving the intravenous (i.v.) injection of 40 mg/kg/day SB203580 (Shah et al., 2017), a p38MAPK pathway inhibitor), PDTC + LPS group (14 d before intranasal administration of LPS, mice received (i.v.) 30 mg/kg/day PDTC, a NF-κB pathway inhibitor (H. Li et al., 2019). To directly explore the impact of Dapk1 for regulating ALI through p38MAPK/NF-κB pathway, C57BL/6 J mice (n = 24) were randomly divided in the following group: LPS group (mice received intranasal administration of 2.5 mg/kg LPS), TC-DAPK 6 + LPS group (before LPS administration, mice intraperitoneally (i.p.) injected with TC-DAPK 6 (1 mg/kg/day, a DAPK1 inhibitor) for 14 days (Cui et al., 2019)), TC-DAPK 6 + SB203580 + LPS group (14 d before intranasal administration of LPS, mice received 1 mg/kg/day TC-DAPK 6 and 40 mg/kg/day SB203580), and TC-DAPK 6 + PDTC + LPS group (14 d before intranasal administration of LPS, mice received 1 mg/kg/ day TC-DAPK 6 and 30 mg/kg/day PDTC). Mice were separately kept in cages for 24 h before sample collection and testing.
2.7. qRT-PCR RNeasy midi kit (Qiagen GmbH, Hilden, Germany) was used to extract total RNA. On-column DNase digestion during the RNA purification was performed using an RNase-free DNase set (Qiagen, Valencia, CA, USA), followed by a second DNase treatment using DNAfree kit (Ambion, Austin, TX) to ensure elimination of all DNA contamination. And the concentrations of RNA and DNA were determined using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE). PrimeScript RT kit (RR014A, Takara Biomedical Technology Co., Ltd, Beijing, China) was used to reverse transcribe into RNA into cDNA. Primer sequences were designed with software Primer 5.0 and synthesized by Nanjing Genscript Co., Ltd (Table 1). According to the procedures on PCR kit (KR011A1, Tiangen Biotech Co., Ltd, Beijing, China), qRT-PCR was performed with the reaction conditions as follows: pre-denaturalization at 95 °C for 5 m in. 30 cycles of 95 °C 40 s, 57 °C 40 s and 72 °C 40 s, and extending 72 °C 10 min and 4 °C 5 min. With GAPDH as internal reference, 2−△△Ct method was used to Table 1 PCR primer sequences used in the experiment. Gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
Dapk1 TNF-α IL-6 GAPDH
CCTGGGTCTTGAGGCAGATA CCTGTAGCCCACGTCGTAG TTCTCTGGGAAATCGTGGAAA GGACGCATTGGTCGTCTGG
TCGCTAATGTTTCTTGCTTGG GGGAGTAGACAAGGTACAACCC TCAGAATTGCCATTGCACAAC TTTGCACTGGTACGTGTTGAT
2.4. Sample collection After 24 h of LPS administration, mice were anesthetized with intraperitoneal ketamine-xylazine (100 mg/kg: 20 mg/kg). The sample blood from abdominal aorta was collected to determine the serum 14
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
treatment groups (namely SB203580 + LPS group and PDTC + LPS group, P > 0.05, Fig. 1C).
calculate the expression of target genes. 2.8. Western blotting
3.2. Expressions of Dapk1 and p38MAPK/NF-κB signaling pathway in lung tissues of mice
Nuclear proteins and total proteins were extracted with reagent kit (Pierce Biotechnology, Rockford, IL, USA), and the concentrations was determined by BCA kit (Pierce Biotechnology, Rockford, IL, USA). After adding loading buffer, protein samples were heated for 10 min at 100 °C. Electrophoresis with 10 % polyacrylamide gel was used to transfer proteins to PVDF membrane. Then the proteins were blocked for 1 h in 5 % BSA at room temperature, followed by the addition of primary antibodies Dapk1 (Product # 702862, 1:1000), p-p38 (Product # PA5-37536, 1:500), p38 (Product # 702273, 2 μg/mL), p65 NF-κB (Product # 436700, 2 μg/mL), LC3 II Product # PA5-35195, 2 μg/mL, Beclin-1 Product # PA5-96649, 1:3000, Atg5 Product # PA5-86100, 1:1000, p62 Product # PA5-78268, 1:1000, β-actin Product # PA585490, 1:10,000, Lamin B Product # PA5-19468, 0.5 μg/mL, for overnight reaction at 4 °C. Next, the protein was washed with TBST, and secondary antibodies were added for 1 h of incubation at room temperature. Roche’s ECL chemiluminescence reagent was used for visualization. The gray value of target bands was analyzed with the software Image J.
The mRNA and protein expression of Dapk1 was not detected in Dapk1−/− mice. In Dapk1+/+ mice, LPS significantly reduced the Dapk1 expression in lung tissues (all P < 0.05), but SB203580 and PDTC didn’t affect the expression of Dapk1 (P > 0.05, Fig. 2A, B, E). To further investigate the impact of Dapk1 on p38MAPK pathway and NFκB pathway in lung tissues of LPS-induced mice (Fig. 2C-E), we found that LPS could effectively up-regulate p-p38 and p65 NF-κB in nuclear in lung tissues of Dapk1+/+ and Dapk1−/−mice by performing western blotting, especially in Dapk1-/- mice, indicating Dapk1 knockout can activate the p38MAPK pathway and NF-κB pathway. In addition, SB203580 reversed the p-p38 up-regulation and p65 NF-κB nuclear translocation in lung tissues of LPS-induced mice (all P < 0.05); meanwhile, PDTC also reduced p65 NF-κB in nuclear without affecting p-p38 in lung tissues of LPS-induced Dapk1+/+ mice and Dapk1-/- mice (all P < 0.05). 3.3. Impact of Dapk1 knockout on cell counts in BALF of LPS-induced mice
2.9. Immunofluorescence
As shown in Fig. 3A-B, LPS significantly increased the total cells and neutrophils in BALF from Dapk1+/+ mice and Dapk1−/− mice, and it was more obvious in Dapk1−/− mice (all P < 0.05). SB203580 reduced the total cells and neutrophils in BALF from Dapk1+/+ mice and Dapk1−/− mice, and PDTC could achieve the similar effect (all P < 0.05).
Paraffin embedded lung tissues were baked in a 60 °C constanttemperature oven for 20 min. After deparaffinization in xylene and dehydration with graded ethanols, heat-mediated antigen retrieval was performed in Tris-EDTA buffer (pH 9.0). And lung sections were then sliced and incubated with antibody against Beclin-1 (1: 200) and LC3 (1: 300) at 4 °C overnight, which were incubated with the second antibodies at room temperature for 1 h in a lucifugal environmental after washing with PBS buffer. Subsequently, the tissue sections were counterstained and rinsed, then observed with the OLYMPUS Fluoview flv1000 confocal laser scanning microscope (Olympus, Tokyo, Japan).
3.4. Dapk1 knockout aggravates inflammatory responses of LPS-induced mice To further understand the impact of Dapk1 on LPS-induced lung inflammatory factors, we used ELISA and qRT-PCR separately to detect TNF-α and IL-6 expressions in BALF and lung tissues (Fig. 3C-F). As a result, LPS remarkably increased the levels of TNF-α and IL-6 in Dapk1+/+ mice, which was much higher in Dapk1−/− mice (all P < 0.05). SB203580 and PDTC apparently inhibited the up-regulation of TNF-α and IL-6 in BALF and lung tissues from Dapk1+/+ mice and Dapk1-/- mice (all P < 0.05).
2.10. Statistical methods SPSS18.0 was used for statistical data analysis. Measurement data were presented by mean ± standard deviation ( x¯ ± s ). Comparison between two groups was tested by Student’s t-test and among multiple groups was performed with One-Way ANOVA. Inter-group difference was analyzed by using Turkey’s test. P < 0.05 indicated the statistical significance of differences.
3.5. Dapk1 knockout aggravates oxidative stress of LPS-induced mice 3. Results
Dapk1+/+ mice and Dapk1−/− mice in the Control groups didn’t differ from each other in the levels of MPO, SOD, GSH-Px, LPO and MDA from lung tissues, as illustrated in Fig. 4 (all P > 0.05). However, after injection of LPS, the SOD and GSH-Px activities were appreciably reduced, while MPO, LPO and MDA levels were dramatically increased, and LPS-induced Dapk1+/+ mice had more obvious oxidative stress than Dapk1−/− mice (all P < 0.05). SB203580 and PDTC improved the oxidative stress of lung tissues from LPS-induced mice (all P < 0.05).
3.1. Dapk1 knockout aggravates LPS-induced lung injury in mice As demonstrated in Fig. 1A, LPS could lead to the significant increase of lung W/D weight ratio in LPS-induced mice, especially in Dapk1−/− mice, while the injection of SB203580 and PDTC appreciably reduced the lung W/D weight ratio (all P < 0.05). Besides, Dapk1+/+ mice and Dapk1−/− mice in the Control group had normal pulmonary histology After 24 h of LPS injection, Dapk1+/+ mice showed interstitium infiltration of inflammatory cells in lung with alveolar wall-thickening and interstitial spaces, which were all improved by the pretreatment of SB203580 and PDTC. However, LPS-induced Dapk1−/− mice had much more severe pathologic injury than LPS-induced Dapk1+/+ mice, which also could be improved by injection of SB203580 and PDTC (all P < 0.05, Fig. 1B). The lung injury score of mice was much higher in the LPS-induced groups than Control groups, which was more obvious in Dapk1−/− mice. However, mice in the SB203580 + LPS group and PDTC + LPS group showed significantly lower lung injury score than the LPS group (all P < 0.05). Besides, mice showed no statistical difference in lung injury score between the
3.6. Dapk1 knockout aggravates cell autophagy of LPS-induced mice LPS significantly up-regulated the protein expressions of beclin-1, Atg5 and LC3II, with the down-regulated p62 in lung tissues of Dapk1+/ + mice and Dapk1−/− mice, especially in Dapk1−/− mice (all P < 0.05). SB203580 and PDTC reduced the protein expressions of beclin-1, Atg5 and LC3II, but increased the p62 expression in lung tissues from LPS-induced Dapk1+/+ mice and Dapk1−/− mice (all P < 0.05, Fig. 5). Additionally, the co-expression of LC3 and Beclin-1 showing the location of autophagosomes and lysosomes by using immunofluorescence confirm the autophagy status in lung tissues (Fig. 6). 15
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 1. Dapk1 knockout aggravates LPS-induced lung injury in mice. Notes: A, Lung wet/dry (W/D) weight ratio of mice in each group; B, Pathological changes of lung tissues of mice detected by HE staining; C, the comparison of lung injury scoring among the groups; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
3.7. Effect of Dapk1 inhibitor (TC-DAPK 6) on LPS-induced ALI through p38MAPK/NF-κB pathway
found between TC-DAPK 6 + LPS group and TC-DAPK 6 + PDTC + LPS group (P > 0.05).
To directly explore the impact of Dapk1 for regulating ALI through p38MAPK/NF-κB pathway, mice were injected with TC-DAPK 6 with or without SB203580/PDTC before intranasal administration of LPS. As illustrated in Fig. 7, the result showed the TC-DAPK 6 aggravated the pathologic injury in LPS-induced ALI with higher total cells and neutrophils in BALF (both P < 0.05). In addition, the more serious inflammatory response, oxidative stress and autophagy were found in mice from the TC-DAPK 6 + LPS group as compared those from the LPS group accompanying with the increased levels of MPO, LPO, MDA, TNF-α and IL-6 and the enhanced protein expressions of beclin-1, Atg5 and LC3II in lung tissues, as well as the decreased activity of GSH-Px and expression of p62 (all P < 0.05). However, the above indexes were reversed by SB203580 or PDTC (all P < 0.05). Moreover, Western blotting revealed that TC-DAPK 6 further activated the p38MAPK pathway and NF-κB pathway in LPS-induced ALI showing higher upregulation of p-p38 and p65 NF-κB nuclear translocation in lung tissues (all P < 0.05). Besides, compared the TC-DAPK 6 + LPS group, the pp38 and p65 NF-κB nuclear translocation in lung tissues were significantly decreased in TC-DAPK 6 + SB203580 + LPS group (both P < 0.05). While no significant difference in p-p38 in lung tissue was
4. Discussion Gene knockout mice models are conducive to studying key genetic mechanisms, discovering gene function, understanding disease pathogenesis, and advancing drug development (Gozuacik et al., 2008). In this study, the Dapk1+/+ and Dapk1−/− mice were performed for LPS induction and established the lung injury models with increased lung W/D weight ratio, especially in Dapk1−/− mice, which suggested that Dapk1 gene may play a protective role in LPS-induced lung injury. As a positive apoptotic regulator, Dapk1 is involved in the apoptosis induced by multiple pathways and plays a vital role in many inflammatory responses (Singh et al., 2016). For example, Song and his group revealed mice received a single intracerebroventricularly injection of DAPK1 inhibitor 1 h before Aβ25–35 administration ameliorated the memory impairment via regulating IL-1β production and caspase-1 activation in microglial cells (Song et al., 2018). A study demonstrated that inhibition of Dapk1 using siRNA in human monocytic THP-1 cells for 96 h significantly reduced suppressed IL-17-induced IL-8 production upon stimulation with proinflammatory cytokines TNF-α and IL-1β (Turner-Brannen et al., 2011). However, in this study, Dapk1−/− mice 16
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 2. Expressions of Dapk1 and p38MAPK/NF-κB signaling pathway in lung tissues of mice. Notes: A–B, Dapk1 mRNA and protein expression in lung tissues of mice in each group detected by qRT-PCR (A) and Western blotting (B), respectively; *, P < 0.05 compared with Control group; C–E, Expressions of p-p38/p38 and p65 NF-κB in nuclear of lung tissues from mice determined by Western blotting; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
concentrations of IL-6 and NF-κB translocation to the nucleus were found in the lung of Dapk1 knockout mice in response to LPS and Tobacco Smoke (Nakav et al., 2012). In our study, the p-p38 expression and p65 NF-κB in nuclear was significantly inhibited in ALI mice after the injection of SB203580 and PDTC. These results suggested that Dapk can attenuate LPS-induced pulmonary inflammation possibly through p38MAPK/NF-κB signaling pathway. Besides, we also found 14d before intranasal administration of LPS, mice receiving TC-DAPK 6 (1 mg/kg/ day) could further activated the p38MAPK/NF-κB signaling pathway in LPS-induced lung tissues with with higher total cells and neutrophils in BALF, suggesting the effect of Dapk1 on LPS-induced ALI was directly mediating p38MAPK/NF-κB pathway. Generally, autophagy, a fundamental catabolic process that maintains cellular homeostasis, plays a key role in regulating the proteins, organelles, and metabolism balance, which is shown to have a close relation with certain lung-related diseases, including ALI (L. Meng et al., 2019a; Qu et al., 2019). Consistent with previous research results, LPS in our research could also reduce the level of autophagy in lung tissue, with the increased beclin-1, Atg5 and LC3II, as well as the decreased p62 (Liu et al., 2018; Xu et al., 2018). As we know, the entire process of autophagy is regulated by many genes, including Atg5 and Beclin1, which are key proteins that initiate autophagy (Booth et al., 2018). In addition, LC3-II is located in pre-autophagosomes and autophagosomes, making itself a marker of autophagosomes, and its content is positively correlated with the number of autophagic vacuoles (Schlafli et al., 2016). P62/SQSTM1 is an ubiquitin-binding protein, whose increased expression indicates the decreased autophagy activity (Shvets and Elazar, 2008). According to the previous study, the enhanced autophagosome formation could almost be abolished by Dapk1 gene silencing through beclin-1 phosphorylation (Tilija Pun and Park, 2018). After determination, the higher expression of beclin-1, Atg5 and LC3II but lower expression of p62 were found in our Dapk1−/− mice than those in Dapk1+/+ mice, indicating that Dapk1 knockout may aggravate LPS-induced autophagy of the lung tissues, and immunofluorescence analysis also verified this result. Moreover, SB203580 was
induced with LPS had the apparently higher total cells and neutrophils in BALF than the Dapk1+/+ mice, as well as the substantially up-regulation of TNF-α and IL-6 levels in the BALF and lung tissues, which was confirmed by the injection (i.p.) of TC-DAPK 6 (1 mg/kg/day, a DAPK1 inhibitor) for 14 days before LPS administration. All mentioned above indicated Dapk1 inhibition could aggravate lung inflammation to some extent in LPS-induced ALI. Consistently, a previous study also found DAPK1 genetic deficiency increased inflammation of patients with hematopoietic stem cell transplantation to aspergillosis in response to IFN-γ (Oikonomou et al., 2016). Worth mentioning, Cui SN and his group also revealed administration of the 5-Aza-2′-deoxycytidine (Aza) to activate Dapk1 in mice accelerated inflammatory resolution in LPS-induced ARDS by promoting neutrophil apoptosis, and the protective effect was attenuated by DAPK1 inhibitor, which was intraperitoneally injected for 14 days before LPS (Cui et al., 2019). The controversy effect of DAPK1 in the regulation of inflammation was possibly dependent on cell types and environment (Oikonomou et al., 2016). In addition, there was previous evidence demonstrating that Dapk1 could protect against ulcerative colitis by binding to phosphorylated p38MAPK, and thereby alleviating chronic inflammatory response (Bajbouj et al., 2009; Steinmann et al., 2015), which could also inhibit NF-κB activation induced by the pro-inflammatory factor TNF-α, and on the contrary, down-regulation of Dapk1 may restore the triggered NF-κB activation (Yoo et al., 2012). In addition, in the study of Usui et al., Dapk1 was identified to exert anti-inflammatory effects by inhibiting the activity of NF-κB in inflammation-induced vasculitis (Usui et al., 2012). Under the pathological conditions of various tissues and organs, the nuclear transcription factor NF-κB may regulate numerous downstream genes related to the immune responses and inflammation (Yeh et al., 2014). Specifically, when cells stimulated by LPS, IκB kinase (IKK) would be activated, leading to the phosphorylation and rapid degradation of downstream IκB protein in the cytoplasm, and thus the dissociated NF-κB could enter the nucleus to regulate the expression of genes involved in inflammation (Han et al., 2018; Huang et al., 2013). There was a recent study confirmed that the higher 17
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 3. Impact of Dapk1 knockout on cell counts and inflammatory responses of LPS-induced mice. Notes: A, Total cells; B, Neutrophils counts; C–D, Expression of TNF-α (C) and IL-6 (D) in BALF determined by ELISA; E–F, Expression of mRNA of TNF-α (E) and IL-6 (F) in lung tissues measured by qRT-PCR; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
shown to inhibit cell death and autophagy of human gingival fibroblasts (D. S. Kim et al., 2010), while PDTC treatment could restore gastric damage and reduce autophagy caused by H2O (Duan et al., 2015),
suggesting that inhibition of p38MAPK/NF-κB signaling pathway can improve LPS-induced autophagy in lung tissues. Notably, a previous study also reported that Dapk1 could mediate the induction of 18
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 4. Impact of Dapk1 knockout on oxidative stress of lung tissues in LPS-induced mice. Notes: A, LPO level; B, MPO activity; C, SOD activity; D, GSH-Px activity; E, MDA content; The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05.
alleviate the oxidative stress increased by LPS in lung tissues and mitigate mitochondrial dysfunction (Yang et al., 2018). Not surprisingly, Dapk1 knockout in our investigation aggravated the oxidative stress in lung tissue of LPS-induced ALI mice, accompanied with the decrease in SOD and GSH-Px activity, as well as the increase in MPO activity, LPO level and MDA content. After injection of p38MAPK/NF-κB signaling pathway inhibitor, LPS-induced mice were improved autophagy and
autophagy in response to oxidative damage (Eisenberg-Lerner and Kimchi, 2012), and at the meantime, oxidative stress damage has been found to play an important role in LPS-induced ALI (X. Meng et al., 2019b; Zhang et al., 2019). Also, inhibition of p38MAPK/NF-κB signaling pathway can significantly reduce the oxidative stress (Dong et al., 2018; Y. Li et al., 2016; Nathens et al., 1997). For example, Yang H et al. demonstrated that pre-treatment with PDTC could obviously
Fig. 5. Expression of autophagy-related proteins (beclin-1, Atg5, LC3II and p62) detected by Western Blotting. Notes: The same letters suggested no statistical significance, P > 0.05; while different letters indicated the statistical significance, P < 0.05. 19
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Fig. 6. The colocalization of autophagosome and lysosome in lung tissues. Notes: The representative image of double immunolabeling against LC3 (red) and Beclin-1 (green) confocal microscopy suggested the fusion of autophagosomes with lysosomes
Fig. 7. Effect of Dapk1 inhibitor (TC-DAPK 6) on LPS-induced ALI through p38MAPK/NF-κB pathway. Notes: A–B, Pathological changes of lung tissues from mice detected by HE staining (A), and the comparison of lung injury scoring among the groups (B); C: Comparison of total cells and Neutrophils in Bal fluid (BLAF); D: Expression of mRNA of TNF-α and IL-6 in lung tissues measured by qRT-PCR; E: Comparison of oxidative stress indices (MPO, LPO, GSH-Px and MDA) of lung tissues among the groups; F-G: Expression of autophagy-related proteins (beclin-1, Atg5, LC3II and p62) and p38MAPK/NF-κB signaling pathway -related proteins (p-p38/p38 and p65 NF-κB in nuclear) detected by Western Blotting. *, P < 0.05 compared with LPS group; #, P < 0.05 compared with TC-DAPK 6 + LPS group. 20
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
oxidative stress of lung. Possibly, Dapk1 knockdown reversed the role of its pathway inhibitors by activating the p38MAPK/NF-κB signaling pathway. To conclude, the expression of Dapk1 was decreased and the p38MAPK/NF-κB signaling pathway was activated in lung tissue of LPSinduced ALI mice. Further, Dapk1 improved lung injury, alleviated inflammatory response, and improved oxidative stress and autophagy in ALI mice via the inhibition of p38MAPK/NF-κB pathway.
Kim, D.S., Kim, J.H., Lee, G.H., Kim, H.T., Lim, J.M., Chae, S.W., Chae, H.J., Kim, H.R., 2010. p38 Mitogen-activated protein kinase is involved in endoplasmic reticulum stress-induced cell death and autophagy in human gingival fibroblasts. Biol. Pharm. Bull. 33, 545–549. Kim, Y.S., Hwang, J.W., Jang, J.H., Son, S., Seo, I.B., Jeong, J.H., Kim, E.H., Moon, S.H., Jeon, B.T., Park, P.J., 2016. Trapa japonica pericarp extract reduces LPS-Induced inflammation in macrophages and acute lung injury in mice. Molecules 21, 392. Li, Y., Chi, G., Shen, B., Tian, Y., Feng, H., 2016. Isorhamnetin ameliorates LPS-induced inflammatory response through downregulation of NF-kappaB signaling. Inflammation 39, 1291–1301. Li, H., Hou, H., Liu, S., Feng, Y., Zhong, W., Hu, X., Yan, N., 2019. miR-33 and RIP140 participate in LPS-induced acute lung injury. Turk. J. Med. Sci. 49, 422–428. Liu, H., Zhou, K., Liao, L., Zhang, T., Yang, M., Sun, C., 2018. Lipoxin A4 receptor agonist BML-111 induces autophagy in alveolar macrophages and protects from acute lung injury by activating MAPK signaling. Respir. Res. 19, 243. Meng, L., Zhao, X., Zhang, H., 2019a. HIPK1 interference attenuates inflammation and oxidative stress of acute lung injury via autophagy. Med. Sci. Monit. 25, 827–835. Meng, X., Hu, L., Li, W., 2019b. Baicalin ameliorates lipopolysaccharide-induced acute lung injury in mice by suppressing oxidative stress and inflammation via the activation of the Nrf2-mediated HO-1 signaling pathway. Naunyn Schmiedebergs Arch. Pharmacol. 392, 1421–1433. Nakav, S., Cohen, S., Feigelson, S.W., Bialik, S., Shoseyov, D., Kimchi, A., Alon, R., 2012. Tumor suppressor death-associated protein kinase attenuates inflammatory responses in the lung. Am. J. Respir. Cell Mol. Biol. 46, 313–322. Nathens, A.B., Bitar, R., Davreux, C., Bujard, M., Marshall, J.C., Dackiw, A.P., Watson, R.W., Rotstein, O.D., 1997. Pyrrolidine dithiocarbamate attenuates endotoxin-induced acute lung injury. Am. J. Respir. Cell Mol. Biol. 17, 608–616. Oikonomou, V., Moretti, S., Renga, G., Galosi, C., Borghi, M., Pariano, M., Puccetti, M., Palmerini, C.A., Amico, L., Carotti, A., Prezioso, L., Spolzino, A., Finocchi, A., Rossi, P., Velardi, A., Aversa, F., Napolioni, V., Romani, L., 2016. Noncanonical fungal autophagy inhibits inflammation in response to IFN-gamma via DAPK1. Cell Host Microbe 20, 744–757. Orlans, F.B., 1997. Ethical decision making about animal experiments. Ethics Behav. 7, 163–171. Park, J., Chen, Y., Zheng, M., Ryu, J., Cho, G.J., Surh, Y.J., Sato, D., Hamada, H., Ryter, S.W., Kim, U.H., Joe, Y., Chung, H.T., 2018. Pterostilbene 4’-beta-Glucoside attenuates LPS-Induced acute lung injury via induction of heme Oxygenase-1. Oxid. Med. Cell. Longev. 2018, 2747018. Qian, J., Chen, X., Shu, S., Zhang, W., Fang, B., Chen, X., Zhao, Y., Liu, Z., Liang, G., 2019. Design and synthesis novel di-carbonyl analogs of curcumin (DACs) act as potent anti-inflammatory agents against LPS-induced acute lung injury (ALI). Eur. J. Med. Chem. 167, 414–425. Qu, L., Chen, C., Chen, Y., Li, Y., Tang, F., Huang, H., He, W., Zhang, R., Shen, L., 2019. High-mobility group Box 1 (HMGB1) and autophagy in acute lung injury (ALI): a review. Med. Sci. Monit. 25, 1828–1837. Schlafli, A.M., Adams, O., Galvan, J.A., Gugger, M., Savic, S., Bubendorf, L., Schmid, R.A., Becker, K.F., Tschan, M.P., Langer, R., Berezowska, S., 2016. Prognostic value of the autophagy markers LC3 and p62/SQSTM1 in early-stage non-small cell lung cancer. Oncotarget 7, 39544–39555. Shah, N.G., Tulapurkar, M.E., Ramarathnam, A., Brophy, A., Martinez 3rd, R., Hom, K., Hodges, T., Samadani, R., Singh, I.S., MacKerell Jr., A.D., Shapiro, P., Hasday, J.D., 2017. Novel noncatalytic substrate-selective p38alpha-Specific MAPK inhibitors with endothelial-stabilizing and anti-inflammatory activity. J. Immunol. 198, 3296–3306. Shvets, E., Elazar, Z., 2008. Autophagy-independent incorporation of GFP-LC3 into protein aggregates is dependent on its interaction with p62/SQSTM1. Autophagy 4, 1054–1056. Sibilla, S., Tredici, S., Porro, A., Irace, M., Guglielmi, M., Nicolini, G., Tredici, G., Valenza, F., Gattinoni, L., 2002. Equal increases in respiratory system elastance reflect similar lung damage in experimental ventilator-induced lung injury. Intensive Care Med. 28, 196–203. Singh, P., Ravanan, P., Talwar, P., 2016. Death associated protein kinase 1 (DAPK1): a regulator of apoptosis and autophagy. Front. Mol. Neurosci. 9, 46. Song, L., Pei, L., Hu, L., Pan, S., Xiong, W., Liu, M., Wu, Y., Shang, Y., Yao, S., 2018. Death-associated protein kinase 1 mediates interleukin-1beta production through regulating inlfammasome activation in Bv2 microglial cells and mice. Sci. Rep. 8, 9930. Steinmann, S., Scheibe, K., Erlenbach-Wuensch, K., Neufert, C., Schneider-Stock, R., 2015. Death-associated protein kinase: a molecule with functional antagonistic duality and a potential role in inflammatory bowel disease (Review). Int. J. Oncol. 47, 5–15. Tilija Pun, N., Park, P.H., 2018. Adiponectin inhibits inflammatory cytokines production by Beclin-1 phosphorylation and B-cell lymphoma 2 mRNA destabilization: role for autophagy induction. Br. J. Pharmacol. 175, 1066–1084. Tong, A., Lynn, G., Ngo, V., Wong, D., Moseley, S.L., Ewbank, J.J., Goncharov, A., Wu, Y.C., Pujol, N., Chisholm, A.D., 2009. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A 106, 1457–1461. Tu, G.W., Ju, M.J., Zheng, Y.J., Hao, G.W., Ma, G.G., Hou, J.Y., Zhang, X.P., Luo, Z., Lu, L.M., 2019. CXCL16/CXCR6 is involved in LPS-induced acute lung injury via P38 signalling. J. Cell. Mol. Med. 23, 5380–5389. Turner-Brannen, E., Choi, K.Y., Arsenault, R., El-Gabalawy, H., Napper, S., Mookherjee, N., 2011. Inflammatory cytokines IL-32 and IL-17 have common signaling intermediates despite differential dependence on TNF-receptor 1. J. Immunol. 186, 7127–7135. Usui, T., Okada, M., Hara, Y., Yamawaki, H., 2012. Death-associated protein kinase 3 mediates vascular inflammation and development of hypertension in spontaneously
CRediT authorship contribution statement Tao Li: Conceptualization, Data curation. Yi-Na Wu: Formal analysis. Hui Wang: Methodology, Project administration, Software. JunYu Ma: Supervision, Validation. Shan-Shan Zhai: Writing - original draft, Writing - review & editing. Jun Duan: Writing - original draft, Writing - review & editing. Declaration of Competing Interest None. Acknowledgement The study was supported by China-Japan Friendship Hospital Foundation for Youth (2017-1-QN-7), National Science Foundation of China (81774265), and National Science Foundation of China (81700260). References Ali, S., Ferguson, N.D., 2011. High-frequency oscillatory ventilation in ALI/ARDS. Crit. Care Clin. 27, 487–499. Bajbouj, K., Poehlmann, A., Kuester, D., Drewes, T., Haase, K., Hartig, R., Teller, A., Kliche, S., Walluscheck, D., Ivanovska, J., Chakilam, S., Ulitzsch, A., Bommhardt, U., Leverkus, M., Roessner, A., Schneider-Stock, R., 2009. RETRACTED: identification of phosphorylated p38 as a novel DAPK-interacting partner during TNFalpha-induced apoptosis in colorectal tumor cells. Am. J. Pathol. 175, 557–570. Bialik, S., Bresnick, A.R., Kimchi, A., 2004. DAP-kinase-mediated morphological changes are localization dependent and involve myosin-II phosphorylation. Cell Death Differ. 11, 631–644. Booth, L., Roberts, J.L., Poklepovic, A., Kirkwood, J., Sander, C., Avogadri-Connors, F., Cutler Jr., R.E., Lalani, A.S., Dent, P., 2018. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib. Cancer Biol. Ther. 19, 132–137. Cui, S.N., Chen, L., Yang, Y.Y., Wang, Y.X., Li, S.N., Zhou, T., Xiao, H.R., Qin, L., Yang, W., Yuan, S.Y., Yao, S.L., Shang, Y., 2019. Activation of death-associated protein kinase 1 promotes neutrophil apoptosis to accelerate inflammatory resolution in acute respiratory distress syndrome. Lab. Invest. 99, 1143–1156. Deiss, L.P., Feinstein, E., Berissi, H., Cohen, O., Kimchi, A., 1995. Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death. Genes Dev. 9, 15–30. Dong, S.A., Zhang, Y., Yu, J.B., Li, X.Y., Gong, L.R., Shi, J., Kang, Y.Y., 2018. Carbon monoxide attenuates lipopolysaccharide-induced lung injury by mitofusin proteins via p38 MAPK pathway. J. Surg. Res. 228, 201–210. Duan, J.L., Yin, J., Ren, W.K., Wu, M.M., Chen, S., Cui, Z.J., Wu, X., Huang, R.L., Li, T.J., Yin, Y.L., 2015. Pyrrolidine dithiocarbamate restores gastric damages and suppressive autophagy induced by hydrogen peroxide. Free Radic. Res. 49, 210–218. Eisenberg-Lerner, A., Kimchi, A., 2012. PKD is a kinase of Vps34 that mediates ROSinduced autophagy downstream of DAPk. Cell Death Differ. 19, 788–797. Geering, B., 2015. Death-associated protein kinase 2: regulator of apoptosis, autophagy and inflammation. Int. J. Biochem. Cell Biol. 65, 151–154. Gozuacik, D., Bialik, S., Raveh, T., Mitou, G., Shohat, G., Sabanay, H., Mizushima, N., Yoshimori, T., Kimchi, A., 2008. DAP-kinase is a mediator of endoplasmic reticulum stress-induced caspase activation and autophagic cell death. Cell Death Differ. 15, 1875–1886. Guo, J., Tao, W., Tang, D., Zhang, J., 2017. Th17/regulatory T cell imbalance in sepsis patients with multiple organ dysfunction syndrome: attenuated by high-volume hemofiltration. Int. J. Artif. Organs 40, 607–614. Han, X., Wu, Y.C., Meng, M., Sun, Q.S., Gao, S.M., Sun, H., 2018. Linarin prevents LPSinduced acute lung injury by suppressing oxidative stress and inflammation via inhibition of TXNIP/NLRP3 and NFkappaB pathways. Int. J. Mol. Med. 42, 1460–1472. Huang, C.H., Yang, M.L., Tsai, C.H., Li, Y.C., Lin, Y.J., Kuan, Y.H., 2013. Ginkgo biloba leaves extract (EGb 761) attenuates lipopolysaccharide-induced acute lung injury via inhibition of oxidative stress and NF-kappaB-dependent matrix metalloproteinase-9 pathway. Phytomedicine 20, 303–309.
21
Molecular Immunology 120 (2020) 13–22
T. Li, et al.
Yeh, C.H., Yang, J.J., Yang, M.L., Li, Y.C., Kuan, Y.H., 2014. Rutin decreases lipopolysaccharide-induced acute lung injury via inhibition of oxidative stress and the MAPKNF-kappaB pathway. Free Radic. Biol. Med. 69, 249–257. Yoo, H.J., Byun, H.J., Kim, B.R., Lee, K.H., Park, S.Y., Rho, S.B., 2012. DAPk1 inhibits NFkappaB activation through TNF-alpha and INF-gamma-induced apoptosis. Cell. Signal. 24, 1471–1477. Yu, X., Wang, Y., Lin, J., Hu, Y., Kawai, T., Taubman, M.A., Han, X., 2016. Lipopolysaccharides-induced suppression of innate-like B cell apoptosis is enhanced by CpG oligodeoxynucleotide and requires toll-like receptors 2 and 4. PLoS One 11, e0165862. Yuan, W., Chen, J., Shu, Y., Liu, S., Wu, L., Ji, J., Liu, Z., Tang, Q., Zhou, Z., Cheng, Y., Jiang, B., Shu, X., 2017. Correlation of DAPK1 methylation and the risk of gastrointestinal cancer: a systematic review and meta-analysis. PLoS One 12, e0184959. Zhang, Z.M., Wang, Y.C., Chen, L., Li, Z., 2019. Protective effects of the suppressed NFkappaB/TLR4 signaling pathway on oxidative stress of lung tissue in rat with acute lung injury. Kaohsiung J. Med. Sci. 35, 265–276.
hypertensive rats. Hypertension 60, 1031–1039. Vazquez-Medina, J.P., Tao, J.Q., Patel, P., Bannitz-Fernandes, R., Dodia, C., Sorokina, E.M., Feinstein, S.I., Chatterjee, S., Fisher, A.B., 2019. Genetic inactivation of the phospholipase A2 activity of peroxiredoxin 6 in mice protects against LPS-induced acute lung injury. American journal of physiology. Lung cell. Mol. Physiol. 316, L656–L668. Wang, S., Shi, X., Li, H., Pang, P., Pei, L., Shen, H., Lu, Y., 2017. DAPK1 signaling pathways in stroke: from mechanisms to therapies. Mol. Neurobiol. 54, 4716–4722. Xiaoli, L., Wujun, Z., Jing, L., 2019. Blocking of tripartite motif 8 protects against lipopolysaccharide (LPS)-induced acute lung injury by regulating AMPKalpha activity. Biochem. Biophys. Res. Commun. 508, 701–708. Xu, X., Li, H., Gong, Y., Zheng, H., Zhao, D., 2018. Hydrogen sulfide ameliorated lipopolysaccharide-induced acute lung injury by inhibiting autophagy through PI3K/ Akt/mTOR pathway in mice. Biochem. Biophys. Res. Commun. 507, 514–518. Yang, H., Chao, K., Liang, M., Sun, R., 2018. [Effect of pyrrolidine dithiocarbamate on oxidative stress and mitochondrial function of lung tissue in mice with acute lung injury]. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue 30, 428–433.
22