- Email: [email protected]
De Novo ABCD1 Gene Mutation in an Indian Patient With Adrenoleukodystrophy
De Novo ABCD1 Gene Mutation in an Indian Patient With Adrenoleukodystrophy Neeraj Kumar, MSc*, Pallavi Shukla, MSc†, Krishna K. Taneja, PhD‡, Veena Kalra, MD†, and Surendra K. Bansal, PhD* A large number of ABCD1 gene mutations have been reported all over the world, but not previously in India. We report on the first known patient with childhood cerebral adrenoleukodystrophy and a de novo 3= splicesite mutation in this gene. Magnetic resonance imaging of the brain revealed large, confluent, hyperintense areas in the bilateral cerebral white matter, predominantly parieto-occipital, with extensions into posterior regions that led to breakdown of the blood-brain barrier. An increased level of very long chain fatty acids was also consistent with the biochemical defect for adrenoleukodystrophy. Sequencing of the ABCD1 gene of this patient identified a 3= splice-site mutation in the intervening sequence 4 (ⴚ2a > g). We did not find any mutation in the gene of the proband’s mother, which confirms its de novo occurrence. © 2008 Published by Elsevier Inc. Kumar N, Shukla P, Taneja KK, Kalra V, Bansal SK. De novo ABCD1 gene mutation in an Indian patient with adrenoleukodystrophy. Pediatr Neurol 2008;39:289-292.
Introduction The X-linked adrenoleukodystrophy (Online Mendelian Inheritance in Man 300100) is the most frequent peroxisomal, severe, neurodegenerative recessive disorder, characterized by progressive demyelination of the central nervous system and adrenocortical insufficiency. It is also
From the *Department of Biochemistry, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India; †Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, India; and ‡ Institute of Genomics and Integrative Biology, Delhi, India.
© 2008 Published by Elsevier Inc. doi:10.1016/j.pediatrneurol.2008.07.006 ● 0887-8994/08/$—see front matter
characterized by great clinical variability, with an incidence of 1:21,000 in males. The major phenotypes include childhood cerebral adrenoleukodystrophy, adrenomyeloneuropathy, adolescent cerebral adrenoleukodystrophy, Addison only, olivo-ponto-cerebellar, and asymptomatic [1,2]. Childhood cerebral adrenoleukodystrophy is the most severe phenotype, with an onset at age 3-10 years, and along with adrenomyeloneuropathy, constitutes 7080% of patients. The ABCD1 gene, localized to Xq28, comprises 10 exons spanning 21 kb of the genome, and encodes an mRNA of 3.7 kb that translates into a 75-kDa peroxisomal membrane protein termed the adrenoleukodystrophy protein [3]. So far, 934 mutations have been identified in the ABCD1 gene worldwide, of which 469 (50.2%) mutations are nonrecurrent, as listed in the XAdrenoleukodystrophy Database (http://www.x-ald.nl) [1]. Accurate pre-mRNA splicing is required for exons to be precisely joined to form functional, mature mRNA. This process entails the recognition of invariant GT and AG dinucleotides at the 5= (donor) and 3= (acceptor) splice sites, respectively, and at the branch-point site 15-35 bases upstream from the 3= splice-site in U2-type introns [4]. In the Human Gene Mutation Database (www.hgmd.org), single base-pair (bp) substitutions within splice sites constitute some 9.5% of all mutations causing human inherited disease [5]. Of the 3= splice-site mutations, 87% involve the invariant AG dinucleotide, with an excess of mutations at position ⫺2 in the intervening sequence [6]. Moreover, A is the preferred first nucleotide in the acceptor dinucleotide pair in splicing [7]. The present report describes an Indian patient with a 3= splice-site mutation at the preferred first nucleotide (position ⫺2) in the intervening sequence 4 of the ABCD1 gene. The patient’s clinical manifestations were compatible with childhood cerebral adrenoleukodystrophy.
Case Report The patient was a healthy male, born at term. The parents are unrelated and of Indian origin. The father is 32 years old, and mother is 29 years old. A family history of any neurologic disease was negative. The patient’s early development was normal, and he appeared to be healthy for his first 6 years. He walked independently at age 15-18 months, spoke words at age 20 or 22 months, and used short sentences at age 2 years. During his seventh year, he
Communications should be addressed to: Dr. Bansal; Department of Biochemistry, Vallabhbhai Patel Chest Institute; University of Delhi; Delhi 110007, India. E-mail: [email protected] Received February 3, 2008; accepted July 16, 2008.
Kumar et al: ABCD1 Mutation With Adrenoleukodystrophy 289
gradually became weak, complained of headache and loss of vision, and exhibited difficulty in hearing, feeding, and walking. The handwriting of the patient grew worse within 6 months, and he was unable to write anything at age 7 years. He also experienced difficulty in urination at age 6 years and 10 months. During the neurologic examination, it became evident that the patient had reduced attention, hyperreflexia of the deep tendons, bilateral knee and ankle jerks, increased superficial cremasteric and planter reflexes, and increased tone and hyperpigmentation of the face and trunk. Plain and contrast enhanced computerized tomography scans of the brain revealed bilateral demyelination in the peritrigonal area. Magnetic resonance imaging of brain revealed large, confluent, hyperintense areas (T2/fluid attenuated inversion recovery) in the bilateral cerebral white matter, predominantly parieto-occipital, with extensions into posterior regions. Laboratory data indicated an increased total white blood cell count (12,000/mm3; normal range, 4,000-11,000/ mm3) and neutrophil count (86%; normal range, 56-65%), and a decreased number of lymphocytes (8%; normal range, 30-35%). However, his cortisol, Na⫹, K⫹, urea, and creatinine levels were within normal limits. The plasma levels of very long chain fatty acids were increased, i.e., C26:0 was at 1.080 g/mL (normal, 0.23 ⫾ 0.09 g/mL S.D.), C26:1 was at 0.890 g/mL (normal, 0.18 ⫾ 0.09 g/mL S.D.), and C22:1 (n-9) was at 9.050 g/mL (normal, 1.36 ⫾ 0.79 g/mL S.D.), with an increase in his C24:0/C22:0 ratio of 1.405 (normal, 0.84 ⫾ 0.10 S.D.), and in his C26:0/C22:0 ratio of 0.099 (normal, 0.01 ⫾ 0.004 S.D.). Peripheral blood was drawn from the patient and his mother, and genomic DNA was isolated from the white blood cells, using a reference phenol-chloroform standard protocol. All 10 exons, including the flanking region of each exon (exon-intron boundaries), were amplified by polymerase chain reaction, using the primers designed by us with the help of the software DNASTAR (DNASTAR Inc., Madison, WI), and their specificity was confirmed by the Basic Local Alignment Search Tool in the Human Genome Database at the National Centre for Biotechnology Information (Bethesda, MD). The sequence analysis revealed a mutation in intervening sequence 4 at position ⫺2a ⬎ g. Therefore, we studied the expression of the ABCD1 gene. Total RNA was isolated from the leukocytes of the probands, his mother, and healthy human subjects, followed by the preparation of complementary DNA by reverse transcription. Primers for complementary DNA amplification in the region of the mutation were designed, and included one forward primer within exon 4 (EX4FR5=AGATGTTCAGCGCTGTCACTTCAA3=) and two reverse primers, i.e., one within exon 5 (EX5RV-5=GGCCACCACCACCTCTCCTG3=), and the other within exon 6 (EX6RV-5=GCTGGGGTGGGGGCTTGTAGA3=) for the amplification of the exon region to obtain amplicons of 193 bp and 332 bp, respectively. To assess the effect of the mutation upstream from the splicing site, a primer
290
PEDIATRIC NEUROLOGY
Vol. 39 No. 4
pair within exon 3 (EX3FR-5=TGAGCGAGCGCACAGAAGC3=) and exon 4 (EX4RV-5=GGGGGCCCTCCACACG3=) was designed, which produced an amplicon of 249 bp from the complementary DNA. Similarly, for the downstream region from the mutation site, another pair of primers within exon 5 (EX5FR-5=GAACAGGGGATCATCTGCGAGAAC3=) and exon 6 (EX6RV) was used to amplify complementary DNA (amplicon size, 202 bp). Exons were amplified by using Taq DNA polymerase. A polymerase chain reaction was performed for 35 cycles with the MJ Research Peltier Thermal Cycler (GMI Inc., Ramsey, MN)/Touchgene Gradient 200 (Techne Ltd., Cambridge, United Kingdom). Each cycle consisted of 30 seconds at 94°C for denaturation, 30 seconds at 56-62°C for annealing (depending on the primers sets used), 30 seconds at 72°C for extension, and 10 minutes for final extension at 72°C. Polymerase chain reaction amplicons were further purified using a DNA isolation kit (Biological Industries, Kibbutz Beit Haemek, Israel). Direct sequencing of the ABCD1 gene from 50 control samples was also performed. We performed a mutation analysis of all 10 exons of the ABCD1 gene, using an ABI 3100 DNA automated sequencer (Applied Biosystems Inc., Foster City, CA). Results Molecular genetic analysis via sequencing of the complete ABCD1 gene revealed no mutation anywhere in the proband, except a point mutation at the acceptor splice site (intervening sequence 4, ⫺2a ⬎ g (Fig 1). This splice-site mutation may cause the formation of the aberrant adrenoleukodystrophy protein. This contention is supported by the results of our polymerase chain reaction of the complementary DNA (prepared from RNA of the patient’s blood leukocytes), which did not express the ABCD1 gene transcript in the segment of the mutated gene. To amplify the complementary DNA spanning the region of the
Figure 1. Sequence of ABCD1 gene in the region of intron 4 and exon 5. (Above) Sequence of proband’s mother and wild type (which are identical). (Below) Proband expresses mutation at ⫺2 position (intervening sequence 4, ⫺2a ⬎ g).
Figure 2. The M-100 bp marker, lanes 1, 4, 7, 10, and 13-Control, lane no. 2, 5, 8, 11 and 14-proband’s mother, lane no. 3, 6, 9, 12 and 15-proband. Amplified complementary DNA products of 249 bp (within exons 3 and 4), 193 bp (within exons 4 and 5), and 332 bp (within exons 4 and 6, including exon 5) were present in controls and the proband’s mother, but absent in the proband, indicating aberrant splicing in the patient. The complementary DNA of product length 202 bp between exons 5 and 6 was present in all samples, including the proband, indicating amplification of complementary DNA up to exon 5, and downstream from the splice site. The housekeeping gene -actin (330-bp product) was used as positive control.
splicing mutation site of the ABCD1 gene, the forward primer in exon 4 was paired independently with two reverse primers, one each in exon 5 and exon 6, which gave products of 193-bp and 332-bp length, respectively. The amplification of complementary DNA (prepared similarly from peripheral blood leukocytes of proband, control, and proband’s mother) was performed, which took place in control and proband’s mother but was absent in proband, confirming degradation of mRNA due to aberrant splicing in the patient (Fig 2). To check further for the presence of complementary DNA of the ABCD1 gene in the proband, two sets of primer pairs were used, one upstream (within exons 3 and 4) and another downstream (within exons 5 and 6) from the splicing mutation site. It is evident (Fig 2) that in the proband’s mother and the wild type, there was amplification of these regions. However, there was no amplification in the upstream set in the proband (249 bp), but interestingly, the downstream set revealed amplification (202 bp), suggesting the absence of upstream but a presence of a downstream mRNA region from the mutation site. Furthermore, this mutation appears to be de novo, because it was not present in the gene of the proband’s mother. Our screening of 50 normal control samples by direct sequencing did not indicate any nucleotide change at this position, suggesting that it is a mutation in the patient, and not a polymorphism. The amplification of complementary DNA of the -actin gene was used as a positive control to check the overall expression. The confirmation of the case was supported by the analysis of very long chain fatty acids, magnetic resonance imaging, and clinical data, which indicated that the patient manifested childhood cerebral adrenoleukodystrophy. Discussion The genetic aspects of X-linked adrenoleukodystrophy in Indians are almost unknown, compared with other populations. Moreover, the data listed at http://www.x-
ald.nl indicate that almost 50.2% of the mutations found in the ABCD1 gene are nonrecurrent. Hence, the identification of mutations affecting a new family is a demanding task [8], and it is imperative to perform mutation studies of such a proband by complete scanning of the ABCD1 gene. We sequenced all 10 exons of the available patient samples, but to our knowledge, this patient manifested the mutation in the splice site, a finding that was not reported previously in the literature (recently our group uploaded the data to the adrenoleukodystrophy database, at www. x-ald.nl). Our patient manifested a novel, unique 3= splice-site mutation in the interface of intron 4 and exon 5, within the adenosine triphosphate-binding domain. This point mutation in intervening sequence 4 (⫺2a ⬎ g) was expected to produce a larger band in the polymerase chain reaction amplification of the complementary DNA formed from the RNA obtained from the patient’s blood leukocytes, because of nonsplicing. Interestingly, we found no expression of the gene upstream from the mutation site, although the exon region downstream from the site, i.e., exons 5 and 6, was expressed. This finding may be attributable to aberrant splicing of the transcript of the ABCD1 gene, suggesting the presence of degraded mRNA, which did not contain the region upstream from exon 5, compared with the transcript of the patient’s mother and control samples. Another group also reported the absence of a transcript because of a different splice-site mutation in this disorder in another ethnic group [9]. Because no aberrant splicing was detected in complementary DNA amplicons derived from the proband’s mother, this finding indicates the possibility of a de novo mutation in either the maternal germline or the proband. In conclusion, our mutation-screening methodology was the most reliable assay for the establishment of the genetic status of the proband as well as all relatives at risk in X-linked adrenoleukodystrophy families. More than half of the mutations in families with X-linked adrenoleukodystrophy are unique, so it is imperative to identify all disease-causing mutations in every kindred in different ethnic groups for future genetic screening, to facilitate comparisons of different mutational spectra. Although molecular genetic studies were performed all over the world in X-linked adrenoleukodystrophy families, we are not aware of any such study of this disease in the Indian population. To our knowledge, the present report has initiated the study of adrenoleukodystrophy mutations in the world’s second largest populated country, for which a very large-scale analysis will be obligatory.
The authors are grateful to Madhulika Kabra, MD, All India Institute of Medical Sciences, New Delhi, India, and Hugo W. Moser, MD and Ann Moser, BA (Neurogenetics, Kennedy Krieger Institute, Baltimore, MD) for their support of this work, and to the Council of Scientific and Industrial Research, India, for a senior research fellowship to N.K.
Kumar et al: ABCD1 Mutation With Adrenoleukodystrophy 291
References [1] Kemp S, Pujol A, Waterham HR, et al. ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: Role in diagnosis and clinical correlations. Hum Mutat 2001;18:499-515. [2] Moser HW, Raymond GV, Dubey P. Adrenoleukodystrophy: New approaches to a neurodegenerative disease. JAMA 2005;294: 3131-4. [3] Guimarães CP, Lemos M, Sá-Miranda C, Azevedo JE. Molecular characterization of 21 X-ALD Portuguese families: Identification of eight novel mutations in the ABCD1 gene. Mol Genet Metab 2002;76:62-7. [4] Burset M, Seledtsov IA, Solovyev VV. Analysis of canonical and non-canonical splice-sites in mammalian genomes. Nucleic Acids Res 2000;28:4364-75.
292
PEDIATRIC NEUROLOGY
Vol. 39 No. 4
[5] Stenson PD, Ball EV, Mort M, et al. Human Gene Mutation Database (HGMD): 2003 update. Hum Mutat 2003;21:577-81. [6] Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences. Hum Genet 1992;90:41-54. [7] Chong A, Zhang G, Bajic VB. Information for the Coordinates of Exons (ICE): A human splice sites database. Genomics 2004;84:762-6. [8] Bezman L, Moser AB, Raymond GV. Adrenoleukodystrophy incidence, new mutation rate, and results of extended family screening. Ann Neurol 2001;49:512-7. [9] Chiu HC, Liang JS, Wang JS, Lu JF. Mutational analyses of Taiwanese kindred with X-linked adrenoleukodystrophy. Pediatr Neurol 2006;35:250-6.
Introduction The X-linked adrenoleukodystrophy (Online Mendelian Inheritance in Man 300100) is the most frequent peroxisomal, severe, neurodegenerative recessive disorder, characterized by progressive demyelination of the central nervous system and adrenocortical insufficiency. It is also
From the *Department of Biochemistry, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India; †Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, India; and ‡ Institute of Genomics and Integrative Biology, Delhi, India.
© 2008 Published by Elsevier Inc. doi:10.1016/j.pediatrneurol.2008.07.006 ● 0887-8994/08/$—see front matter
characterized by great clinical variability, with an incidence of 1:21,000 in males. The major phenotypes include childhood cerebral adrenoleukodystrophy, adrenomyeloneuropathy, adolescent cerebral adrenoleukodystrophy, Addison only, olivo-ponto-cerebellar, and asymptomatic [1,2]. Childhood cerebral adrenoleukodystrophy is the most severe phenotype, with an onset at age 3-10 years, and along with adrenomyeloneuropathy, constitutes 7080% of patients. The ABCD1 gene, localized to Xq28, comprises 10 exons spanning 21 kb of the genome, and encodes an mRNA of 3.7 kb that translates into a 75-kDa peroxisomal membrane protein termed the adrenoleukodystrophy protein [3]. So far, 934 mutations have been identified in the ABCD1 gene worldwide, of which 469 (50.2%) mutations are nonrecurrent, as listed in the XAdrenoleukodystrophy Database (http://www.x-ald.nl) [1]. Accurate pre-mRNA splicing is required for exons to be precisely joined to form functional, mature mRNA. This process entails the recognition of invariant GT and AG dinucleotides at the 5= (donor) and 3= (acceptor) splice sites, respectively, and at the branch-point site 15-35 bases upstream from the 3= splice-site in U2-type introns [4]. In the Human Gene Mutation Database (www.hgmd.org), single base-pair (bp) substitutions within splice sites constitute some 9.5% of all mutations causing human inherited disease [5]. Of the 3= splice-site mutations, 87% involve the invariant AG dinucleotide, with an excess of mutations at position ⫺2 in the intervening sequence [6]. Moreover, A is the preferred first nucleotide in the acceptor dinucleotide pair in splicing [7]. The present report describes an Indian patient with a 3= splice-site mutation at the preferred first nucleotide (position ⫺2) in the intervening sequence 4 of the ABCD1 gene. The patient’s clinical manifestations were compatible with childhood cerebral adrenoleukodystrophy.
Case Report The patient was a healthy male, born at term. The parents are unrelated and of Indian origin. The father is 32 years old, and mother is 29 years old. A family history of any neurologic disease was negative. The patient’s early development was normal, and he appeared to be healthy for his first 6 years. He walked independently at age 15-18 months, spoke words at age 20 or 22 months, and used short sentences at age 2 years. During his seventh year, he
Communications should be addressed to: Dr. Bansal; Department of Biochemistry, Vallabhbhai Patel Chest Institute; University of Delhi; Delhi 110007, India. E-mail: [email protected] Received February 3, 2008; accepted July 16, 2008.
Kumar et al: ABCD1 Mutation With Adrenoleukodystrophy 289
gradually became weak, complained of headache and loss of vision, and exhibited difficulty in hearing, feeding, and walking. The handwriting of the patient grew worse within 6 months, and he was unable to write anything at age 7 years. He also experienced difficulty in urination at age 6 years and 10 months. During the neurologic examination, it became evident that the patient had reduced attention, hyperreflexia of the deep tendons, bilateral knee and ankle jerks, increased superficial cremasteric and planter reflexes, and increased tone and hyperpigmentation of the face and trunk. Plain and contrast enhanced computerized tomography scans of the brain revealed bilateral demyelination in the peritrigonal area. Magnetic resonance imaging of brain revealed large, confluent, hyperintense areas (T2/fluid attenuated inversion recovery) in the bilateral cerebral white matter, predominantly parieto-occipital, with extensions into posterior regions. Laboratory data indicated an increased total white blood cell count (12,000/mm3; normal range, 4,000-11,000/ mm3) and neutrophil count (86%; normal range, 56-65%), and a decreased number of lymphocytes (8%; normal range, 30-35%). However, his cortisol, Na⫹, K⫹, urea, and creatinine levels were within normal limits. The plasma levels of very long chain fatty acids were increased, i.e., C26:0 was at 1.080 g/mL (normal, 0.23 ⫾ 0.09 g/mL S.D.), C26:1 was at 0.890 g/mL (normal, 0.18 ⫾ 0.09 g/mL S.D.), and C22:1 (n-9) was at 9.050 g/mL (normal, 1.36 ⫾ 0.79 g/mL S.D.), with an increase in his C24:0/C22:0 ratio of 1.405 (normal, 0.84 ⫾ 0.10 S.D.), and in his C26:0/C22:0 ratio of 0.099 (normal, 0.01 ⫾ 0.004 S.D.). Peripheral blood was drawn from the patient and his mother, and genomic DNA was isolated from the white blood cells, using a reference phenol-chloroform standard protocol. All 10 exons, including the flanking region of each exon (exon-intron boundaries), were amplified by polymerase chain reaction, using the primers designed by us with the help of the software DNASTAR (DNASTAR Inc., Madison, WI), and their specificity was confirmed by the Basic Local Alignment Search Tool in the Human Genome Database at the National Centre for Biotechnology Information (Bethesda, MD). The sequence analysis revealed a mutation in intervening sequence 4 at position ⫺2a ⬎ g. Therefore, we studied the expression of the ABCD1 gene. Total RNA was isolated from the leukocytes of the probands, his mother, and healthy human subjects, followed by the preparation of complementary DNA by reverse transcription. Primers for complementary DNA amplification in the region of the mutation were designed, and included one forward primer within exon 4 (EX4FR5=AGATGTTCAGCGCTGTCACTTCAA3=) and two reverse primers, i.e., one within exon 5 (EX5RV-5=GGCCACCACCACCTCTCCTG3=), and the other within exon 6 (EX6RV-5=GCTGGGGTGGGGGCTTGTAGA3=) for the amplification of the exon region to obtain amplicons of 193 bp and 332 bp, respectively. To assess the effect of the mutation upstream from the splicing site, a primer
290
PEDIATRIC NEUROLOGY
Vol. 39 No. 4
pair within exon 3 (EX3FR-5=TGAGCGAGCGCACAGAAGC3=) and exon 4 (EX4RV-5=GGGGGCCCTCCACACG3=) was designed, which produced an amplicon of 249 bp from the complementary DNA. Similarly, for the downstream region from the mutation site, another pair of primers within exon 5 (EX5FR-5=GAACAGGGGATCATCTGCGAGAAC3=) and exon 6 (EX6RV) was used to amplify complementary DNA (amplicon size, 202 bp). Exons were amplified by using Taq DNA polymerase. A polymerase chain reaction was performed for 35 cycles with the MJ Research Peltier Thermal Cycler (GMI Inc., Ramsey, MN)/Touchgene Gradient 200 (Techne Ltd., Cambridge, United Kingdom). Each cycle consisted of 30 seconds at 94°C for denaturation, 30 seconds at 56-62°C for annealing (depending on the primers sets used), 30 seconds at 72°C for extension, and 10 minutes for final extension at 72°C. Polymerase chain reaction amplicons were further purified using a DNA isolation kit (Biological Industries, Kibbutz Beit Haemek, Israel). Direct sequencing of the ABCD1 gene from 50 control samples was also performed. We performed a mutation analysis of all 10 exons of the ABCD1 gene, using an ABI 3100 DNA automated sequencer (Applied Biosystems Inc., Foster City, CA). Results Molecular genetic analysis via sequencing of the complete ABCD1 gene revealed no mutation anywhere in the proband, except a point mutation at the acceptor splice site (intervening sequence 4, ⫺2a ⬎ g (Fig 1). This splice-site mutation may cause the formation of the aberrant adrenoleukodystrophy protein. This contention is supported by the results of our polymerase chain reaction of the complementary DNA (prepared from RNA of the patient’s blood leukocytes), which did not express the ABCD1 gene transcript in the segment of the mutated gene. To amplify the complementary DNA spanning the region of the
Figure 1. Sequence of ABCD1 gene in the region of intron 4 and exon 5. (Above) Sequence of proband’s mother and wild type (which are identical). (Below) Proband expresses mutation at ⫺2 position (intervening sequence 4, ⫺2a ⬎ g).
Figure 2. The M-100 bp marker, lanes 1, 4, 7, 10, and 13-Control, lane no. 2, 5, 8, 11 and 14-proband’s mother, lane no. 3, 6, 9, 12 and 15-proband. Amplified complementary DNA products of 249 bp (within exons 3 and 4), 193 bp (within exons 4 and 5), and 332 bp (within exons 4 and 6, including exon 5) were present in controls and the proband’s mother, but absent in the proband, indicating aberrant splicing in the patient. The complementary DNA of product length 202 bp between exons 5 and 6 was present in all samples, including the proband, indicating amplification of complementary DNA up to exon 5, and downstream from the splice site. The housekeeping gene -actin (330-bp product) was used as positive control.
splicing mutation site of the ABCD1 gene, the forward primer in exon 4 was paired independently with two reverse primers, one each in exon 5 and exon 6, which gave products of 193-bp and 332-bp length, respectively. The amplification of complementary DNA (prepared similarly from peripheral blood leukocytes of proband, control, and proband’s mother) was performed, which took place in control and proband’s mother but was absent in proband, confirming degradation of mRNA due to aberrant splicing in the patient (Fig 2). To check further for the presence of complementary DNA of the ABCD1 gene in the proband, two sets of primer pairs were used, one upstream (within exons 3 and 4) and another downstream (within exons 5 and 6) from the splicing mutation site. It is evident (Fig 2) that in the proband’s mother and the wild type, there was amplification of these regions. However, there was no amplification in the upstream set in the proband (249 bp), but interestingly, the downstream set revealed amplification (202 bp), suggesting the absence of upstream but a presence of a downstream mRNA region from the mutation site. Furthermore, this mutation appears to be de novo, because it was not present in the gene of the proband’s mother. Our screening of 50 normal control samples by direct sequencing did not indicate any nucleotide change at this position, suggesting that it is a mutation in the patient, and not a polymorphism. The amplification of complementary DNA of the -actin gene was used as a positive control to check the overall expression. The confirmation of the case was supported by the analysis of very long chain fatty acids, magnetic resonance imaging, and clinical data, which indicated that the patient manifested childhood cerebral adrenoleukodystrophy. Discussion The genetic aspects of X-linked adrenoleukodystrophy in Indians are almost unknown, compared with other populations. Moreover, the data listed at http://www.x-
ald.nl indicate that almost 50.2% of the mutations found in the ABCD1 gene are nonrecurrent. Hence, the identification of mutations affecting a new family is a demanding task [8], and it is imperative to perform mutation studies of such a proband by complete scanning of the ABCD1 gene. We sequenced all 10 exons of the available patient samples, but to our knowledge, this patient manifested the mutation in the splice site, a finding that was not reported previously in the literature (recently our group uploaded the data to the adrenoleukodystrophy database, at www. x-ald.nl). Our patient manifested a novel, unique 3= splice-site mutation in the interface of intron 4 and exon 5, within the adenosine triphosphate-binding domain. This point mutation in intervening sequence 4 (⫺2a ⬎ g) was expected to produce a larger band in the polymerase chain reaction amplification of the complementary DNA formed from the RNA obtained from the patient’s blood leukocytes, because of nonsplicing. Interestingly, we found no expression of the gene upstream from the mutation site, although the exon region downstream from the site, i.e., exons 5 and 6, was expressed. This finding may be attributable to aberrant splicing of the transcript of the ABCD1 gene, suggesting the presence of degraded mRNA, which did not contain the region upstream from exon 5, compared with the transcript of the patient’s mother and control samples. Another group also reported the absence of a transcript because of a different splice-site mutation in this disorder in another ethnic group [9]. Because no aberrant splicing was detected in complementary DNA amplicons derived from the proband’s mother, this finding indicates the possibility of a de novo mutation in either the maternal germline or the proband. In conclusion, our mutation-screening methodology was the most reliable assay for the establishment of the genetic status of the proband as well as all relatives at risk in X-linked adrenoleukodystrophy families. More than half of the mutations in families with X-linked adrenoleukodystrophy are unique, so it is imperative to identify all disease-causing mutations in every kindred in different ethnic groups for future genetic screening, to facilitate comparisons of different mutational spectra. Although molecular genetic studies were performed all over the world in X-linked adrenoleukodystrophy families, we are not aware of any such study of this disease in the Indian population. To our knowledge, the present report has initiated the study of adrenoleukodystrophy mutations in the world’s second largest populated country, for which a very large-scale analysis will be obligatory.
The authors are grateful to Madhulika Kabra, MD, All India Institute of Medical Sciences, New Delhi, India, and Hugo W. Moser, MD and Ann Moser, BA (Neurogenetics, Kennedy Krieger Institute, Baltimore, MD) for their support of this work, and to the Council of Scientific and Industrial Research, India, for a senior research fellowship to N.K.
Kumar et al: ABCD1 Mutation With Adrenoleukodystrophy 291
References [1] Kemp S, Pujol A, Waterham HR, et al. ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: Role in diagnosis and clinical correlations. Hum Mutat 2001;18:499-515. [2] Moser HW, Raymond GV, Dubey P. Adrenoleukodystrophy: New approaches to a neurodegenerative disease. JAMA 2005;294: 3131-4. [3] Guimarães CP, Lemos M, Sá-Miranda C, Azevedo JE. Molecular characterization of 21 X-ALD Portuguese families: Identification of eight novel mutations in the ABCD1 gene. Mol Genet Metab 2002;76:62-7. [4] Burset M, Seledtsov IA, Solovyev VV. Analysis of canonical and non-canonical splice-sites in mammalian genomes. Nucleic Acids Res 2000;28:4364-75.
292
PEDIATRIC NEUROLOGY
Vol. 39 No. 4
[5] Stenson PD, Ball EV, Mort M, et al. Human Gene Mutation Database (HGMD): 2003 update. Hum Mutat 2003;21:577-81. [6] Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences. Hum Genet 1992;90:41-54. [7] Chong A, Zhang G, Bajic VB. Information for the Coordinates of Exons (ICE): A human splice sites database. Genomics 2004;84:762-6. [8] Bezman L, Moser AB, Raymond GV. Adrenoleukodystrophy incidence, new mutation rate, and results of extended family screening. Ann Neurol 2001;49:512-7. [9] Chiu HC, Liang JS, Wang JS, Lu JF. Mutational analyses of Taiwanese kindred with X-linked adrenoleukodystrophy. Pediatr Neurol 2006;35:250-6.