- Email: [email protected]
Dedifferentiated chondrosarcoma mimicking a giant cell tumor. Is this low grade dedifferentiated chondrosarcoma?
Pathology – Research and Practice 210 (2014) 194–197
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Teaching Cases
Dedifferentiated chondrosarcoma mimicking a giant cell tumor. Is this low grade dedifferentiated chondrosarcoma? Thomas Knösel a,∗ , Mathias Werner b , Andreas Jung a , Thomas Kirchner a , Hans Roland Dürr c a
Institute of Pathology, Ludwig-Maximilians-Universität (LMU), Munich, Germany Department of Pathology, Helios Hospital, Berlin, Germany c Orthopaedic Oncology, Department of Orthopaedic Surgery, Ludwig-Maximilians-University (LMU), Munich, Germany b
a r t i c l e
i n f o
Article history: Received 11 June 2013 Received in revised form 16 September 2013 Accepted 3 December 2013 Keywords: Dedifferentiated chondrosarcoma Giant cell tumor Malignant potential Immunohistochemistry Mutational analysis
a b s t r a c t We report a very rare case of a dedifferentiated chondrosarcoma mimicking a benign giant cell tumor. A 22-year-old male was admitted to our hospital with a history of mild left wrist pain after a skiing trauma. Radiology revealed an extensive meta-epiphyseal osteolytic lesion in the distal ulna, which appeared to be a giant cell tumor. Histological examination showed a biphasic tumor comprising chondroid and non-chondroid areas with a giant cell-rich lesion resembling a conventional giant cell tumor of the bone. Immunohistochemistry showed no expression of p16INK4a , VEGFR1, KDR (VEGFR2), VEGFR3, cKIT, MDM2 or CDK4. However, high expression of the tyrosine kinases PDGFRA and PDGFRB was observed. Molecular analysis showed no amplification of the cMYC gene and no activating mutations in the cKIT (exons 9 and 11) or PDGFRA (exon 18) genes. He has been on follow-up for ten months, with no evidence of local recurrence or metastatic disease. In summary, this report highlights a very rare case of a dedifferentiated chondrosarcoma in which the dedifferentiated component of the tumor bears histologic resemblance to a conventional giant cell tumor of bone. We suggest that this tumor might be categorized in the group of low-grade dedifferentiated chondrosarcomas. © 2013 Elsevier GmbH. All rights reserved.
Case report A 22-year-old male had a history of mild left wrist pain after a skiing trauma in the Alpes. He experienced swelling and increased pain. Plain radiographs and CT scan revealed an extensive metaepiphyseal osteolytic lesion in the distal ulna (Fig. 1A and B). The lesion extended to the diaphysis, displayed by magnetic resonance imaging. Based on radiologic features, the osteolytic lesion was suspected of being a giant cell tumor (Fig. 1C). A true-cut biopsy was performed which showed ovaloid cells with osteoclastic like giant cells compatible with a giant cell tumor. After the biopsy, a wide resection with free margins was performed using a fibula transplant as reconstruction (Fig. 1D). The resected tissue measured 4.5 cm in length. The tumor centrally showed a typical gray-blue area of hyaline cartilage 1.2 cm in length. Histological examination revealed a biphasic tumor comprising chondroid and non-chondroid areas with an abrupt transition between both of them (Fig. 2A). The
∗ Corresponding author at: Institute of Pathology Ludwig-MaximiliansUniversität (LMU), Thalkirchnerstr. 3680337, Munich, Germany. Tel.: +49 89 2180 73728; fax: +49 89 2180 73742. E-mail address: [email protected] (T. Knösel). 0344-0338/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2013.12.003
chondroid area had moderate to low cellularity (Fig. 2B) with moderate to low atypia. As the lesion showed no osteodestruction or permeative growth pattern, we regarded it as an enchondroma. The non-chondroid tumor component was sharply demarcated from the cartilaginous island and contained numerous osteoclast-like giant cells accompanied by stromal mononuclear cells (Fig. 2C). The non-chondroid area was almost undistinguishable from the conventional giant cell tumor of the bone. Only after a detailed search were very rare atypical mitoses (3 atypical mitosis/10 HPF) found. Multinucleated giant cells were scattered uniformly throughout the lesion and embedded in stromal cells. The noncartilagenous component of the lesion exhibited aggressive growth with pushing margins toward the bone trabeculae (Fig. 2D). However, none of the areas showed the obvious features of high-grade tumor cells or necrosis. We performed immunohistochemistry for tumor aggressiveness and for identifying possible targets for treatment. Immunohistochemistry showed no expression of p16INK4a , VEGFR1, KDR (VEGFR2), VEGFR3, cKIT, MDM2 or CDK4. However, high expression of the tyrosine kinases PDGFRA and PDGFRB was observed in the non-chondroid area and PDGFRB was also observed in the chondrocytes of the chondroid area. Ki67 was expressed in 10–20% of tumor cells. No amplification of the cMYC gene was detected by applying fluorescence in situ hybridization (FISH).
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
195
Fig. 1. (A) and (B) CT scan in axial and coronar reconstruction shows an expansive osteolytic lesion in the metaepiphysis of the distal ulna without any calcifications inside the tumor. (C) and (D) Coronar MRI-scan shows the lesion extending to the diaphysis (C). The arrow is indicating the region with chondrogenic differentiation found later. Reconstruction was done with a fibula transplant and plate osteosynthesis (D).
Furthermore, no activating mutations were detected in the cKIT (exons 9 and 11) or PDGFRA (exon 18) genes. The overall appearance, the cartilaginous component and the abrupt transition to the giant cell tumor like component led us to the diagnosis of dedifferentiated chondrosarcoma with giant cell tumor like features, which is in support with the literature. The patient received neither chemotherapy nor radiation therapy after the operation. He has been on follow-up for ten months, with no evidence of local recurrence or metastatic disease. Material and methods Immunohistochemistry Commercially available antibodies specific for cKIT, VEGFR1, KDR/VEGFR2, VEGFR3, PDGFRA, PDGFRB, CDK2, MDM2 or Ki67 were applied for immunohistochemistry (IHC). Immunohistochemical staining was performed according to standard procedures (Table 1). Briefly, tissue was pretreated, incubated in the presence of the antibodies, followed by antibody detection using biotinylated anti-mouse secondary antibodies together with the multilink biotin-streptavidin-amplified detection system (Biogenex, San Ramon, CA). Staining was visualized using the Fastred chromogen system (DAKO, Hamburg, Germany) following in all cases the manufacturer’s recommendations. Expression was scored
Table 1 Antibodies for immunohistochemistry. Antigen
Product no.
Supplier
Dilution
Pre-treatment
Ki 67 PDGFRA PDGFRB VEGFR1 VEGFR2/KDR VEGFR3 MDM2 CDK4 P16INK4a
M7240 3174 Sc339 Ab32152 2479 NCC-L OP46 GTX75694 9512
DAKO Cell Signaling Santa Cruz DAKO Cell Signaling Novocastra Calbiochem GeneTex CINtec
1:50 1:150 1:150 1:100 1:150 1:20 1:50 1:50 Ready to use
Microwave Microwave Microwave Microwave Microwave Microwave Microwave Microwave Microwave
semi-quantitatively by a 4-tier scale (0 – negative, 1 – weak, 2 – moderate, 3 – strongly positive). Fluorescence in situ hybridization analyses Fluorescence in situ hybridization was performed according to standard procedures. Briefly, 1.5–2 m FFPE-slides were dewaxed (Xylol, abs. ETOH), air-dried, pretreated in 1 M NaSCN (sodium isothiocyanat) at 80 ◦ C for 30 min, washed twice shortly in a. bidest, incubated in pepsin-HCl (final conc. 8 mg/ml in 10 mM HCl) at 37 ◦ C for 30 min, washed again twice shortly in a. bidest, and subsequently air-dried. Thereafter, c-myc/cen8 dual color probe
196
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
Fig. 2. Histological features with a biphasic tumor (A) showing an abrupt transition (H&E, 40×) between the chondroid and non-chondroid component (B, HE 100×), The non-chondroid component shows atypical mitosis (black arrow) and an aggressive growth toward the bone trabeculae (HE 200×).
(ZytoVision GmbH, Bremerhaven, Germany; 3 l/cm2 sample) was applied and denatured. Then, the probe and sample were incubated as a sandwich at 79 ◦ C for 10 min and then incubated for hybridization overnight. After standard posthybridization washes, slides were stained with DAPI and mounted in antifade (Vectashield, Vector Laboratories, Burlingame, CA). Since there are at yet no standard criteria for the definition of cMYC amplification, we used the same cut-off values as used for the analysis of Her2 amplification [10]: <1.8 negative, 1.8–2.2 unclear, >2.2 amplified. Analysis was performed with a Zeiss Axioskop (Jena, Germany) using a tri-color filter set (AHF, Tübingen, Germany). In addition, we applied a centrosome X/Y color probe (Zytovision GmbH, Bremerhaven, Germany) and a centrosome 8 probe (Zytovision GmbH, Bremerhaven, Germany). cKIT and PDGFR mutational analysis The mutational analysis was done in the Institute of Pathology of the Ludwig-Maximilians University in Munich. Genomic DNA was isolated from FFPE tissue using QIAamp DNA Mini kits (Qiagen, Germany) following the user’s instructions. 200 ng genomic DNA was used as the template in PCRs together with Hot Taq DNA Polymerase (Qiagen, Germany) in the presence of the following tailed primer-pairs: cKit exon 9: GTAAAACGACGGCCAGTAAGCCAGGGCTTTTGTTTTCT, TAATACGACTCACTATAGGGCAGAGCCTAAACATGCCCTTA; cKit exon 11: GTAAAACGACGGCCAGTCCAGAGTGCTCTAATGAC, TAATACGACTCACTATAGGGTGACATGGAAAGCCCCTGTT; PDGFRA exon 18: TAATACGTAAAACGACGGCCAGTTCCACCGTGATCTGGCTGCT, GACTCACTATAGGGAGCCTGACCAGTGAGGGAAG. PCR conditions were: 15 min at 95 ◦ C; 40 cycles: 30 s at 94 ◦ C, 30 s at 61 ◦ C and 1 min at 72 ◦ C; 5 min at 72 ◦ C. Subsequently, 1 l of PCR products was used for didesoxytermination-sequencing employing BD Big-dye terminator v.1.0 kits (Applied Biosystems, Germany) together with primers binding to the tail sequences of the PCR products: GTAAAACGACGGCCAGT and TAATACGACTCACTATAGGG following the user’s
manual. PCR products were purified using DyEx v.2.0 kits (Qiagen, Germany). 2 l of these PCR products was mixed with 18 l formamide (HiDi, Applied Biosystems, Germany), denatured for 2 min at 94◦ and loaded onto a genetic analyser 3130 (Applied Biosystems, Germany). The resulting sequences were compared to reference sequences for cKIT (NM 000222) and PDGFRA (NM 006206) employing the Software Geneious v.5.5.3 (Biomatters Ltd., Australia). Discussion Dedifferentiated chondrosarcoma comprises up to 10–15% of all reported chondrosarcomas. The distinctive morphological feature is characterized by two clearly defined components: (1) a well differentiated cartilage tumor, either as an enchondroma or a low-grade chondrosarcoma, juxtaposed to (2) a high-grade noncartilaginous sarcoma with an abrupt transition between these two components [1,6]. Our case presented itself as a very rare dedifferentiated chondrosarcoma with features of a giant cell tumor of the bone. Only six case reports have been described in the literature until now [1,2,5,7–9]. Mimicking a giant cell tumor, this neoplasm is a challenge even for an experienced pathologist. Moreover, the malignant potential of this tumor is far from understood and has not been extensively described in any detail. The follow up of our patient was 10 months without recurrent disease or metastatic spread. All the other six cases reported in the literature also showed no distant metastases. Thus, in our opinion, the term low-grade dedifferentiated chondrosarcoma is more appropriate than the classical dedifferentiated chondrosarcoma with a high-grade component, as the latter terminology might mislead to very aggressive surgery overtreating the patient. In high grade dedifferentiated chondrosarcoma, despite aggressive therapy, approximately 90% of patients did not survive the two following years and developed distant metastasis of the high-grade component. Grimer et al. (2007) report the EMSOS-data and give a 5-year survival rate of 25% [4].
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
Low-grade dedifferentiated chondrosarcoma with giant cell features and without a high-grade component, as described in the literature and presented in our case, obviously have a low risk of distant metastases and should be classified as a distinct entity with different clinical behavior and malignant potential. On the protein level, distinct receptor kinases, PDGFRA and PDGFRB, were highly expressed in the non-chondroid areas with a cytoplasmic and membranous immunostaining, thus opening new avenues to the tyrosine kinase inhibitor therapy of these tumors. PDGFRB was also expressed in the chondrocytes of the chrondroid area. However, this should be evaluated within a large collective of dedifferentiated chondrosarcomas. Mutational analysis revealed no activating mutations in the hotspots of the cKIT and PDGFRA genes. FISH revealed no amplification of the MYC gene and no amplification of centrosome X and 8. Until now, a close cooperation between clinicians, radiologists and pathologists with early detection, adequate histological sampling and a wide excision has been the gold standard to improve the prognosis of the patient. Interestingly, Grignani et al. investigated in a phase 2 trial imatinib mesylate in patients with recurrent non-resectable chondrosarcomas expressing PDGFRA or B [3]. They could not show any benefit in terms of freedom from disease progression and/or tumor shrinkage. However, they investigated recurrent sarcomas in tumor progression, which might have acquired secondary mutations. The newly developed multiple tyrosine kinase inhibitors of the next generation might be worth investigating in vitro and in vivo. Our patient was not treated with denosumab due to the diagnosis of a dedifferentiated chondrosarcoma. In summary, this report highlights a very rare case of a dedifferentiated chondrosarcoma mimicking a benign giant cell tumor. This tumor was characterized for the first time with immunohistochemistry, fluorescence in situ hybridization and mutational analysis. The tyrosine kinases PDGFRA and PDGFRB might be interesting targets for tyrosine kinase inhibitor therapy in dedifferentiated chondrosarcomas. Furthermore, in the context with the clinical behavior and the literature, we suggest that this tumor might be categorized in the group of low-grade dedifferentiated chondrosarcomas.
197
Conflict of interest None. Funding None. References [1] R. Arora, A. Sharma, A.K. Dinda, Dedifferentiated chondrosarcoma of the femur mimicking a conventional giant cell tumour: a diagnostic pitfall, Indian J. Pathol. Microbiol. 51 (2008) 561–562. [2] E.G. Estrada, A.G. Ayala, V. Lewis, et al., Dedifferentiated chondrosarcoma with a noncartilaginous component mimicking a conventional giant cell tumour of bone, Ann. Diagn. Pathol. 6 (2002) 159–163. [3] G. Grignani, E. Palmerini, P. Dileo, S.D. Asaftei, L. D’Ambrosio, Y. Pignochino, M. Mercuri, P. Picci, F. Fagioli, P.G. Casali, S. Ferrari, M. Aglietta, A phase II trial of sorafenib in relapsed and unresectable high-grade osteosarcoma after failure of standard multimodal therapy: an Italian Sarcoma Group study, Ann. Oncol. 23 (February (2)) (2012) 508–516. [4] R.J. Grimer, G. Gosheger, A. Taminiau, D. Biau, Z. Matejovsky, Y. Kollender, M. San-Julian, F. Gherlinzoni, C. Ferrari, Dedifferentiated chondrosarcoma: prognostic factors and outcome from a European group, Eur. J. Cancer 43 (September (14)) (2007) 2060–2065 (Epub 2007 August 27). [5] J. Huang, Z. Jiang, Q. Yang, et al., Malignant or benign? Benign looking giant cell component in dedifferentiated chondrosarcoma: a case report, Int. J. Surg. Pathol. 21 (February (1)) (2013) 48–53. [6] C. Inwards, P.C.W. Hogendoorn, WHO Classification of Tumours of Soft Tissue and Bone: Dedifferentiated Chondrosarcoma, 4th ed., IARC Press, 2013, pp. 269–270. [7] T. Ishida, H.D. Dorfman, E.T. Habermann, Dedifferentiated chondrosarcoma of humerus with giant cell tumour-like features, Skeletal Radiol. 24 (1995) 76–80. [8] J.M. Mirra, Bone Tumours: Clinical, Radiologic and Pathologic Correlations, Lea & Febiger, Philadelphia, PA, 1989, pp. 565–569. [9] H.A. Sissons, J.A. Matlen, M.M. Lewis, Dedifferentiated chondrosarcoma. Report of an unusual case, J. Bone Joint Surg. Am. 73 (1991) 294–300. [10] A.C. Wolff, M.E. Hammond, J.N. Schwartz, K.L. Hagerty, D.C. Allred, R.J. Cote, M. Dowsett, P.L. Fitzgibbons, W.M. Hanna, A. Langer, L.M. McShane, S. Paik, M.D. Pegram, E.A. Perez, M.F. Press, A. Rhodes, C. Sturgeon, S.E. Taube, R. Tubbs, G.H. Vance, M. van de Vijver, T.M. Wheeler, D.F. Hayes, American Society of Clinical Oncology/College of American Pathologists, American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer, J. Clin. Oncol. 25 (January (1)) (2007) 118–145.
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Teaching Cases
Dedifferentiated chondrosarcoma mimicking a giant cell tumor. Is this low grade dedifferentiated chondrosarcoma? Thomas Knösel a,∗ , Mathias Werner b , Andreas Jung a , Thomas Kirchner a , Hans Roland Dürr c a
Institute of Pathology, Ludwig-Maximilians-Universität (LMU), Munich, Germany Department of Pathology, Helios Hospital, Berlin, Germany c Orthopaedic Oncology, Department of Orthopaedic Surgery, Ludwig-Maximilians-University (LMU), Munich, Germany b
a r t i c l e
i n f o
Article history: Received 11 June 2013 Received in revised form 16 September 2013 Accepted 3 December 2013 Keywords: Dedifferentiated chondrosarcoma Giant cell tumor Malignant potential Immunohistochemistry Mutational analysis
a b s t r a c t We report a very rare case of a dedifferentiated chondrosarcoma mimicking a benign giant cell tumor. A 22-year-old male was admitted to our hospital with a history of mild left wrist pain after a skiing trauma. Radiology revealed an extensive meta-epiphyseal osteolytic lesion in the distal ulna, which appeared to be a giant cell tumor. Histological examination showed a biphasic tumor comprising chondroid and non-chondroid areas with a giant cell-rich lesion resembling a conventional giant cell tumor of the bone. Immunohistochemistry showed no expression of p16INK4a , VEGFR1, KDR (VEGFR2), VEGFR3, cKIT, MDM2 or CDK4. However, high expression of the tyrosine kinases PDGFRA and PDGFRB was observed. Molecular analysis showed no amplification of the cMYC gene and no activating mutations in the cKIT (exons 9 and 11) or PDGFRA (exon 18) genes. He has been on follow-up for ten months, with no evidence of local recurrence or metastatic disease. In summary, this report highlights a very rare case of a dedifferentiated chondrosarcoma in which the dedifferentiated component of the tumor bears histologic resemblance to a conventional giant cell tumor of bone. We suggest that this tumor might be categorized in the group of low-grade dedifferentiated chondrosarcomas. © 2013 Elsevier GmbH. All rights reserved.
Case report A 22-year-old male had a history of mild left wrist pain after a skiing trauma in the Alpes. He experienced swelling and increased pain. Plain radiographs and CT scan revealed an extensive metaepiphyseal osteolytic lesion in the distal ulna (Fig. 1A and B). The lesion extended to the diaphysis, displayed by magnetic resonance imaging. Based on radiologic features, the osteolytic lesion was suspected of being a giant cell tumor (Fig. 1C). A true-cut biopsy was performed which showed ovaloid cells with osteoclastic like giant cells compatible with a giant cell tumor. After the biopsy, a wide resection with free margins was performed using a fibula transplant as reconstruction (Fig. 1D). The resected tissue measured 4.5 cm in length. The tumor centrally showed a typical gray-blue area of hyaline cartilage 1.2 cm in length. Histological examination revealed a biphasic tumor comprising chondroid and non-chondroid areas with an abrupt transition between both of them (Fig. 2A). The
∗ Corresponding author at: Institute of Pathology Ludwig-MaximiliansUniversität (LMU), Thalkirchnerstr. 3680337, Munich, Germany. Tel.: +49 89 2180 73728; fax: +49 89 2180 73742. E-mail address: [email protected] (T. Knösel). 0344-0338/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2013.12.003
chondroid area had moderate to low cellularity (Fig. 2B) with moderate to low atypia. As the lesion showed no osteodestruction or permeative growth pattern, we regarded it as an enchondroma. The non-chondroid tumor component was sharply demarcated from the cartilaginous island and contained numerous osteoclast-like giant cells accompanied by stromal mononuclear cells (Fig. 2C). The non-chondroid area was almost undistinguishable from the conventional giant cell tumor of the bone. Only after a detailed search were very rare atypical mitoses (3 atypical mitosis/10 HPF) found. Multinucleated giant cells were scattered uniformly throughout the lesion and embedded in stromal cells. The noncartilagenous component of the lesion exhibited aggressive growth with pushing margins toward the bone trabeculae (Fig. 2D). However, none of the areas showed the obvious features of high-grade tumor cells or necrosis. We performed immunohistochemistry for tumor aggressiveness and for identifying possible targets for treatment. Immunohistochemistry showed no expression of p16INK4a , VEGFR1, KDR (VEGFR2), VEGFR3, cKIT, MDM2 or CDK4. However, high expression of the tyrosine kinases PDGFRA and PDGFRB was observed in the non-chondroid area and PDGFRB was also observed in the chondrocytes of the chondroid area. Ki67 was expressed in 10–20% of tumor cells. No amplification of the cMYC gene was detected by applying fluorescence in situ hybridization (FISH).
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
195
Fig. 1. (A) and (B) CT scan in axial and coronar reconstruction shows an expansive osteolytic lesion in the metaepiphysis of the distal ulna without any calcifications inside the tumor. (C) and (D) Coronar MRI-scan shows the lesion extending to the diaphysis (C). The arrow is indicating the region with chondrogenic differentiation found later. Reconstruction was done with a fibula transplant and plate osteosynthesis (D).
Furthermore, no activating mutations were detected in the cKIT (exons 9 and 11) or PDGFRA (exon 18) genes. The overall appearance, the cartilaginous component and the abrupt transition to the giant cell tumor like component led us to the diagnosis of dedifferentiated chondrosarcoma with giant cell tumor like features, which is in support with the literature. The patient received neither chemotherapy nor radiation therapy after the operation. He has been on follow-up for ten months, with no evidence of local recurrence or metastatic disease. Material and methods Immunohistochemistry Commercially available antibodies specific for cKIT, VEGFR1, KDR/VEGFR2, VEGFR3, PDGFRA, PDGFRB, CDK2, MDM2 or Ki67 were applied for immunohistochemistry (IHC). Immunohistochemical staining was performed according to standard procedures (Table 1). Briefly, tissue was pretreated, incubated in the presence of the antibodies, followed by antibody detection using biotinylated anti-mouse secondary antibodies together with the multilink biotin-streptavidin-amplified detection system (Biogenex, San Ramon, CA). Staining was visualized using the Fastred chromogen system (DAKO, Hamburg, Germany) following in all cases the manufacturer’s recommendations. Expression was scored
Table 1 Antibodies for immunohistochemistry. Antigen
Product no.
Supplier
Dilution
Pre-treatment
Ki 67 PDGFRA PDGFRB VEGFR1 VEGFR2/KDR VEGFR3 MDM2 CDK4 P16INK4a
M7240 3174 Sc339 Ab32152 2479 NCC-L OP46 GTX75694 9512
DAKO Cell Signaling Santa Cruz DAKO Cell Signaling Novocastra Calbiochem GeneTex CINtec
1:50 1:150 1:150 1:100 1:150 1:20 1:50 1:50 Ready to use
Microwave Microwave Microwave Microwave Microwave Microwave Microwave Microwave Microwave
semi-quantitatively by a 4-tier scale (0 – negative, 1 – weak, 2 – moderate, 3 – strongly positive). Fluorescence in situ hybridization analyses Fluorescence in situ hybridization was performed according to standard procedures. Briefly, 1.5–2 m FFPE-slides were dewaxed (Xylol, abs. ETOH), air-dried, pretreated in 1 M NaSCN (sodium isothiocyanat) at 80 ◦ C for 30 min, washed twice shortly in a. bidest, incubated in pepsin-HCl (final conc. 8 mg/ml in 10 mM HCl) at 37 ◦ C for 30 min, washed again twice shortly in a. bidest, and subsequently air-dried. Thereafter, c-myc/cen8 dual color probe
196
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
Fig. 2. Histological features with a biphasic tumor (A) showing an abrupt transition (H&E, 40×) between the chondroid and non-chondroid component (B, HE 100×), The non-chondroid component shows atypical mitosis (black arrow) and an aggressive growth toward the bone trabeculae (HE 200×).
(ZytoVision GmbH, Bremerhaven, Germany; 3 l/cm2 sample) was applied and denatured. Then, the probe and sample were incubated as a sandwich at 79 ◦ C for 10 min and then incubated for hybridization overnight. After standard posthybridization washes, slides were stained with DAPI and mounted in antifade (Vectashield, Vector Laboratories, Burlingame, CA). Since there are at yet no standard criteria for the definition of cMYC amplification, we used the same cut-off values as used for the analysis of Her2 amplification [10]: <1.8 negative, 1.8–2.2 unclear, >2.2 amplified. Analysis was performed with a Zeiss Axioskop (Jena, Germany) using a tri-color filter set (AHF, Tübingen, Germany). In addition, we applied a centrosome X/Y color probe (Zytovision GmbH, Bremerhaven, Germany) and a centrosome 8 probe (Zytovision GmbH, Bremerhaven, Germany). cKIT and PDGFR mutational analysis The mutational analysis was done in the Institute of Pathology of the Ludwig-Maximilians University in Munich. Genomic DNA was isolated from FFPE tissue using QIAamp DNA Mini kits (Qiagen, Germany) following the user’s instructions. 200 ng genomic DNA was used as the template in PCRs together with Hot Taq DNA Polymerase (Qiagen, Germany) in the presence of the following tailed primer-pairs: cKit exon 9: GTAAAACGACGGCCAGTAAGCCAGGGCTTTTGTTTTCT, TAATACGACTCACTATAGGGCAGAGCCTAAACATGCCCTTA; cKit exon 11: GTAAAACGACGGCCAGTCCAGAGTGCTCTAATGAC, TAATACGACTCACTATAGGGTGACATGGAAAGCCCCTGTT; PDGFRA exon 18: TAATACGTAAAACGACGGCCAGTTCCACCGTGATCTGGCTGCT, GACTCACTATAGGGAGCCTGACCAGTGAGGGAAG. PCR conditions were: 15 min at 95 ◦ C; 40 cycles: 30 s at 94 ◦ C, 30 s at 61 ◦ C and 1 min at 72 ◦ C; 5 min at 72 ◦ C. Subsequently, 1 l of PCR products was used for didesoxytermination-sequencing employing BD Big-dye terminator v.1.0 kits (Applied Biosystems, Germany) together with primers binding to the tail sequences of the PCR products: GTAAAACGACGGCCAGT and TAATACGACTCACTATAGGG following the user’s
manual. PCR products were purified using DyEx v.2.0 kits (Qiagen, Germany). 2 l of these PCR products was mixed with 18 l formamide (HiDi, Applied Biosystems, Germany), denatured for 2 min at 94◦ and loaded onto a genetic analyser 3130 (Applied Biosystems, Germany). The resulting sequences were compared to reference sequences for cKIT (NM 000222) and PDGFRA (NM 006206) employing the Software Geneious v.5.5.3 (Biomatters Ltd., Australia). Discussion Dedifferentiated chondrosarcoma comprises up to 10–15% of all reported chondrosarcomas. The distinctive morphological feature is characterized by two clearly defined components: (1) a well differentiated cartilage tumor, either as an enchondroma or a low-grade chondrosarcoma, juxtaposed to (2) a high-grade noncartilaginous sarcoma with an abrupt transition between these two components [1,6]. Our case presented itself as a very rare dedifferentiated chondrosarcoma with features of a giant cell tumor of the bone. Only six case reports have been described in the literature until now [1,2,5,7–9]. Mimicking a giant cell tumor, this neoplasm is a challenge even for an experienced pathologist. Moreover, the malignant potential of this tumor is far from understood and has not been extensively described in any detail. The follow up of our patient was 10 months without recurrent disease or metastatic spread. All the other six cases reported in the literature also showed no distant metastases. Thus, in our opinion, the term low-grade dedifferentiated chondrosarcoma is more appropriate than the classical dedifferentiated chondrosarcoma with a high-grade component, as the latter terminology might mislead to very aggressive surgery overtreating the patient. In high grade dedifferentiated chondrosarcoma, despite aggressive therapy, approximately 90% of patients did not survive the two following years and developed distant metastasis of the high-grade component. Grimer et al. (2007) report the EMSOS-data and give a 5-year survival rate of 25% [4].
T. Knösel et al. / Pathology – Research and Practice 210 (2014) 194–197
Low-grade dedifferentiated chondrosarcoma with giant cell features and without a high-grade component, as described in the literature and presented in our case, obviously have a low risk of distant metastases and should be classified as a distinct entity with different clinical behavior and malignant potential. On the protein level, distinct receptor kinases, PDGFRA and PDGFRB, were highly expressed in the non-chondroid areas with a cytoplasmic and membranous immunostaining, thus opening new avenues to the tyrosine kinase inhibitor therapy of these tumors. PDGFRB was also expressed in the chondrocytes of the chrondroid area. However, this should be evaluated within a large collective of dedifferentiated chondrosarcomas. Mutational analysis revealed no activating mutations in the hotspots of the cKIT and PDGFRA genes. FISH revealed no amplification of the MYC gene and no amplification of centrosome X and 8. Until now, a close cooperation between clinicians, radiologists and pathologists with early detection, adequate histological sampling and a wide excision has been the gold standard to improve the prognosis of the patient. Interestingly, Grignani et al. investigated in a phase 2 trial imatinib mesylate in patients with recurrent non-resectable chondrosarcomas expressing PDGFRA or B [3]. They could not show any benefit in terms of freedom from disease progression and/or tumor shrinkage. However, they investigated recurrent sarcomas in tumor progression, which might have acquired secondary mutations. The newly developed multiple tyrosine kinase inhibitors of the next generation might be worth investigating in vitro and in vivo. Our patient was not treated with denosumab due to the diagnosis of a dedifferentiated chondrosarcoma. In summary, this report highlights a very rare case of a dedifferentiated chondrosarcoma mimicking a benign giant cell tumor. This tumor was characterized for the first time with immunohistochemistry, fluorescence in situ hybridization and mutational analysis. The tyrosine kinases PDGFRA and PDGFRB might be interesting targets for tyrosine kinase inhibitor therapy in dedifferentiated chondrosarcomas. Furthermore, in the context with the clinical behavior and the literature, we suggest that this tumor might be categorized in the group of low-grade dedifferentiated chondrosarcomas.
197
Conflict of interest None. Funding None. References [1] R. Arora, A. Sharma, A.K. Dinda, Dedifferentiated chondrosarcoma of the femur mimicking a conventional giant cell tumour: a diagnostic pitfall, Indian J. Pathol. Microbiol. 51 (2008) 561–562. [2] E.G. Estrada, A.G. Ayala, V. Lewis, et al., Dedifferentiated chondrosarcoma with a noncartilaginous component mimicking a conventional giant cell tumour of bone, Ann. Diagn. Pathol. 6 (2002) 159–163. [3] G. Grignani, E. Palmerini, P. Dileo, S.D. Asaftei, L. D’Ambrosio, Y. Pignochino, M. Mercuri, P. Picci, F. Fagioli, P.G. Casali, S. Ferrari, M. Aglietta, A phase II trial of sorafenib in relapsed and unresectable high-grade osteosarcoma after failure of standard multimodal therapy: an Italian Sarcoma Group study, Ann. Oncol. 23 (February (2)) (2012) 508–516. [4] R.J. Grimer, G. Gosheger, A. Taminiau, D. Biau, Z. Matejovsky, Y. Kollender, M. San-Julian, F. Gherlinzoni, C. Ferrari, Dedifferentiated chondrosarcoma: prognostic factors and outcome from a European group, Eur. J. Cancer 43 (September (14)) (2007) 2060–2065 (Epub 2007 August 27). [5] J. Huang, Z. Jiang, Q. Yang, et al., Malignant or benign? Benign looking giant cell component in dedifferentiated chondrosarcoma: a case report, Int. J. Surg. Pathol. 21 (February (1)) (2013) 48–53. [6] C. Inwards, P.C.W. Hogendoorn, WHO Classification of Tumours of Soft Tissue and Bone: Dedifferentiated Chondrosarcoma, 4th ed., IARC Press, 2013, pp. 269–270. [7] T. Ishida, H.D. Dorfman, E.T. Habermann, Dedifferentiated chondrosarcoma of humerus with giant cell tumour-like features, Skeletal Radiol. 24 (1995) 76–80. [8] J.M. Mirra, Bone Tumours: Clinical, Radiologic and Pathologic Correlations, Lea & Febiger, Philadelphia, PA, 1989, pp. 565–569. [9] H.A. Sissons, J.A. Matlen, M.M. Lewis, Dedifferentiated chondrosarcoma. Report of an unusual case, J. Bone Joint Surg. Am. 73 (1991) 294–300. [10] A.C. Wolff, M.E. Hammond, J.N. Schwartz, K.L. Hagerty, D.C. Allred, R.J. Cote, M. Dowsett, P.L. Fitzgibbons, W.M. Hanna, A. Langer, L.M. McShane, S. Paik, M.D. Pegram, E.A. Perez, M.F. Press, A. Rhodes, C. Sturgeon, S.E. Taube, R. Tubbs, G.H. Vance, M. van de Vijver, T.M. Wheeler, D.F. Hayes, American Society of Clinical Oncology/College of American Pathologists, American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer, J. Clin. Oncol. 25 (January (1)) (2007) 118–145.