Deficiency of alpha-calcitonin gene-related peptide induces inflammatory responses and lethality in sepsis

Cytokine 64 (2013) 548–554

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

Deficiency of alpha-calcitonin gene-related peptide induces inflammatory responses and lethality in sepsis Jin-Koo Lee a,b, Jun-Sub Jung c, Soo-Hyun Park c, Yun-Beom Sim c, Hong-Won Suh c,d,⇑ a

Department of Pharmacology, College of Medicine, Institute of Bio-Science Technology, Dankook University, Cheonan 330-714, Republic of Korea Translational Research Center, Institute of Bio-Science Technology, Dankook University, Cheonan 330-714, Republic of Korea c Institute of Natural Medicine, College of Medicine, Hallym University, Chuncheon 200-702, Republic of Korea d Department of Pharmacology, College of Medicine, Hallym University, Chuncheon 200-702, Republic of Korea b

a r t i c l e

i n f o

Article history: Received 13 March 2013 Received in revised form 8 July 2013 Accepted 30 July 2013 Available online 8 September 2013 Keywords: Alpha-calcitonin gene-related peptide Cecal ligation and puncture Neuropeptides Cytokines Sepsis

a b s t r a c t In the present study, we examined the role of alpha-calcitonin gene-related peptide (aCGRP) on expression of neuropeptides in the brain, inflammatory responses, and survival rate in septic shock condition. We examined expression of neuropeptides such as aCGRP, proopiomelanocortin (POMC), corticotrophin releasing hormone (CRH), and proenkephalin (ProENK) in the hippocampus and hypothalamus in C57BL/ 6 (WT) or aCGRP/ (KO) mice subjected to sepsis. Cecal ligation and puncture (CLP) or lipopolysaccharide/D-galactosamine (LPS/D-GalN) treatment showed significant increases of hippocampal and hypothalamic aCGRP, POMC, CRH, and ProENK mRNA levels in WT mice, but not ProENK mRNA in the hypothalamus at 6 h after on-set of sepsis. However, enhanced mRNA levels of POMC, CRH, and ProENK genes were not increased in the hippocampus and hypothalamus of CLP-subjected KO mice at 6 h following sepsis. KO mice treated with LPS/D-GalN displayed a significant enhancement of plasma corticosterone, aspartate aminotransferase, and alanine aminotransferase levels compared to LPS/D-GalN treated WT mice at 12 h after induction of sepsis. In addition, plasma levels of pro-inflammatory cytokines, such as IL-1b and TNF-a, were also further increased in KO mice compared to WT mice at 24 h after CLP or LPS/ D-GalN treatment. Interestingly, mRNA expressions of IL-6 and IL-10, anti-inflammatory cytokines, were synergistically enhanced in liver and lymph node of KO mice compared to WT mice at 6 h after CLP. However, plasma level of IL-10 but not IL-6 was significantly decreased in KO mice compared to WT mice at 24 h after CLP or LPS/D-GalN challenge. The survival rate of KO mice was significantly reduced compared to WT mice following mild (1 punch) and moderate (2 punch) CLP and LPS/D-GalN administration. Taken together, our findings suggest that the activation of aCGRP may induce other neuropeptides associated with immunomodulation at CNS level and modulate immune responses as enhancing anti-inflammatory cytokines and reducing pro-inflammatory cytokines during the sepsis. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction The calcitonin gene peptide superfamily consists of calcitonin, calcitonin gene-related peptide (CGRP), and amylin. CGRP, a 37amino acid neuropeptide, is derived from the tissue-specific splicing of the primary transcript of the calcitonin/aCGRP gene [1–3]. The two CGRP genes, a and b in the rat and mice, or I and II in humans, differ in their protein sequences by one and three amino acids, respectively, and the biological activities of the two peptides are quite similar in most vascular systems [4]. The neuro⇑ Corresponding author. Address: Department of Pharmacology, College of Medicine, Hallym University, 1 Hallymdaehak-gil, Chuncheon 200-702, Republic of Korea. Tel.: +82 33 248 2614; fax: +82 33 248 2612. E-mail address: [email protected] (H.-W. Suh). 1043-4666/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.cyto.2013.07.030

transmitter, aCGRP shows multiple physiological roles, such as peripheral vasodilation, cardiac acceleration nicotinic acetylcholine receptor synthesis and function, testicular descent, nociception, carbohydrate metabolism, gastrointestinal motility, neurogenic inflammation, and gastric acid secretion and is widely expressed throughout the central and peripheral nervous systems [5,6]. Previously, several reports have shown that CGRP is released into the circulation during pathogenesis of septic shock condition in humans [7–9], and endotoxicosis in rats and pigs [10,11]. CGRP inhibits inflammatory responses and protects mice against lethal endotoxemia [12] and induces immunosuppression during the early phase of septic peritonitis [13]. Furthermore, CGRP inhibits the release of pro-inflammatory cytokines such as IL-1b, TNF-a and CCL4 in mononuclear phagocytes, dendritic cells, human

549

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

circulating blood cells and cultured mouse peritoneal macrophages induced by bacteria, LPS or Toll-like receptor agonists [14–18]. CGRP increases the production of anti-inflammatory cytokines, IL-6 and IL-10 in murine models endotoxemia [12,19], thereby reducing pro-inflammatory cytokines. However, the function of CGRP in sepsis is currently controversial and unknown. Thus, in the present study, we investigated the role of aCGRP using aCGRP(/) (KO) mice by producing experimental septic shock by either CLP or LPS/D-GalN administration. Here we report that aCGRP modulates the expression of neuropeptides such as aCGRP, POMC, CRH, and ProENK in the brain, the inhibition of plasma corticosterone level and hepatic damage, the attenuation of pro-inflammatory cytokines, the activation of anti-inflammatory cytokines, and the inhibition of mortality following experimental sepsis. 2. Materials and methods The experiments were approved by the Hallym University Animal Care and Use Committee (Registration Number: Hallym 2009-05-01). All procedures were conducted in accordance with the ‘Guide for Care and Use of Laboratory Animals’ published by the National Institutes of Health and the ethical guidelines of the International Association for the Study of Pain. 2.1. Experimental animals and drugs The animals used in the present study were 20–24 g male C57BL/6 (WT) mice, supplied by MJ Co. (Seoul, Korea) and male aCGRP(/) (KO) mice [6], a kind gift from J. Lee (Hallym university, Korea). Animals were provided a commercial diet and water ad libitum under controlled temperature, humidity, and lighting conditions (22°C±2°C, 55% ± 5% humidity, and 12-h light/12-h dark cycle). The number of animals used and their suffering was minimized in all cases. Experiments were performed during the light phase of the cycle (10:00-17:00). All reagents were obtained from Sigma–Aldrich unless otherwise indicated. 2.2. Septic shock mouse models For lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced lethality [20], LPS (Escherichia coli 055:B5, Sigma, USA) and D-GalN (ICN, USA) were dissolved in PBS at 1 lg/ll and 0.16 g/ml, respectively, and stored at 70 °C until use. The LPS/D-GalN mixture was used immediately. Each mouse received LPS/D-GalN (LPS 36 lg/kg, D-GalN 0.8 g/kg or LPS 18 lg/kg, D-GalN 0.4 g/kg) intraperitoneally (i.p.) at a volume of 1 ml/100 g of body weight. For cecal ligation and puncture (CLP) [21], mice were anaesthetized with pentobarbital (50 mg/kg, i.p.), and a small abdominal midline incision was made and the cecum was exposed. The cecum was mobilized, ligated below the ileocecal valve, and punctured through both surfaces twice or once (for mild CLP) with a 22-gauge needle, and the abdomen was closed. Mice subjected to Sham-operation underwent the same procedure as above except for CLP.

CORT level was determined by the fluorometric determination method [22]. 2.4. Cytokine measurement Blood was collected from the retro-orbital venous plexus at 24 h after LPS/D-GalN administration or CLP and centrifuged at 4000g at 4°C for 15 min. Plasma sample was stored at 70°C until analyses. Plasma levels of IL-1b, TNF-a, IL-6 and IL-10 were measured with an enzyme-linked immunoassay kit according to the manufacturer’s instructions (Genzyme, USA). 2.5. Total RNA isolation and reverse transcription After septic shock challenge, the tissues were homogenized in TRIzolÒ reagent (Invitrogen). Total RNA was extracted from the cells according to the manufacturer’s suggested protocol. Total RNA concentration was determined from spectrophotometric optical density measurement (260 and 280 nm). Total RNA (2 lg) was treated with 1 U DNase I (Promega) for 15 min at RT in 18 ll of volume containing 1 PCR buffer and 2 mM MgCl2. Then it was inactivated by incubation with 2 ll of 25 mM EDTA at 65 °C for 15 min. Reverse transcriptase reactions were carried out using MuLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol. Each reaction tube contained 2 lg of total in a volume of 25 ll containing 5 ll of MuLV 5 RT buffer, 1 lg of Oligod(T)15 (promega), 2.5 ll of dNTP Mixture (Promega), 40 U of RNasin (Promega), 20 U of MuLV Reverse Transcriptase and nuclease-free water to volume. Reverse transcriptase reactions were carried out in a DNA Thermal Cycler 480 (Perkin Elmer, Branchburg, NJ, USA) at 25 °C for 20 min, 42 °C for 60 min and 95 °C for 10 min. The cDNA was then stored at 20 °C until use. 2.6. Quantitative real-time PCR Real-time PCR for the analysis of aCGRP, POMC, CRH, ENK mRNA levels were performed in a Rotor-Gene Q (Qiagen). The primer sets (Table 1) for real-time PCR were designed using PrimerQuest (Integrated DNA Technologies) and synthesized from Bioneer (Daejeon, Korea). QuantiTect SYBR Green PCR kit was purchased from Qiagen. The reaction mixture consisted of 2 ll of cDNA template, 10 ll of SYBR Green PCR master mix and 10 pmol of primers in total volume of 20 ll. The cDNA was denatured at 95°C for 10 min followed by 45 cycles of PCR at 95°C for 10 s,

Table 1 Primer sequences for real-time PCR.

2.3. Corticosterone (CORT), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) assays Four hundred ll of blood was collected by puncturing the retroorbital venous plexus at 12 h after LPS/D-GalN treatment. Plasma were isolated by centrifugation and frozen at 70°C until analyses. Levels of plasma AST (GOT) and ALT (GPT) were measured using GOT–GPT kit (Reitman-Frankel method) according to the manufacturer’s instructions (Asan Pharmaceutical, Seoul, Korea). Plasma

Primer sequence (50 –30 )

Gene

a b

a

aCGRP

F Rb

AGAAGAGATCCTGCAACACTGCCA GCCCACATTGGTGGGAACAAAGTT

POMC

F R

CCCAACGTTGCTGAGAACGAGTCG GGAGGTCATGAAGCCACCGTAACG

CRH

F R

TTGAATTTCTTGCAGCCGGAGCAG AGCAGCGGGACTTCTGTTGAGATT

ProENK

F R

GACAGCAGCAAACAGGATGA GTTGTCTCCCGTTCCCAGTA

IL-6

F R

GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA

IL-10

F R

GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT

b-actin

F R

AGAGGGAAATCGTGCGTGAC CAATAGTGACCTGGCCGT

Forward sequence. Reverse sequence.

550

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

Fig. 1. Expression of aCGRP mRNA in brain of WT mice after CLP and LPS/D-GalN treatments. Expression of aCGRP mRNA level was examined in the hippocampus and hypothalamus of C57BL/6 (WT) mice after CLP (A) and LPS (36 lg/kg) plus Dgalactosamine (0.8 g/kg) (LPS/D-GalN) i.p. injection (B). Total RNA was isolated from the hippocampus and hypothalamus of WT mice at 6 h after septic shock challenge. Gene expression of aCGRP was measured by quantitative real-time PCR using Rotor-Gene Q. The expression of gene was normalized with b-actin gene expression. Data were obtained from triplicated PCR reactions, and values are mean ± SEM (p < 0.05, saline vs. LPS/D-GalN, Sham vs. CLP, n = 6).

60°C for 15 s and 72°C for 20 s. Data acquisition and analysis of real-time PCR were performed using the Rotor-Gene Q series software (version 1.7). Delta–delta Ct method was used to calculate the relative quantitation of each target gene normalized with b-actin level in each individual sample. 2.7. Statistical analysis All values shown in the figures are expressed as the mean ± SEM obtained from at least three independent experiments. Statistical analysis was carried out by Student t test (Fig. 1), one-way analysis of variance (ANOVA) with Tukey’s post hoc test (Figs. 2–5), and Log-rank (Mantel-Cox) test (Fig. 6) using GraphPad Prism (GraphPad Software, San Diego, CA, USA). Statistically significant differences between groups were assumed when p < 0.05. 3. Results 3.1. Expression of hippocampal and hypothalamic neuropeptides in

Fig. 2. Expressions of POMC, CRH, and ProENK mRNAs in brain of WT and aCGRP KO mice after CLP challenge. Expressions of POMC (A), CRH (B), and ENK (C) mRNAs were examined in the hippocampus and hypothalamus of C57BL/6 (WT) and aCGRP/ (KO) mice after CLP (2 punched). Total RNA was isolated from the hippocampus and hypothalamus of WT and KO mice at 6 h after CLP. Gene expression of POMC (A), CRH (B), and ProENK (C) were measured by quantitative real-time PCR using Rotor-Gene Q. The expression of gene was normalized with bactin gene expression. Data were obtained from triplicated PCR reactions, and values are mean ± SEM (p < 0.05, p < 0.01, and p < 0.001; Sham vs. CLP in WT, # p < 0.05, ##p < 0.01, and ###p < 0.001; CLP in WT vs. CLP in KO, n = 6).

aCGRP KO mice subjected to CLP or LPS/D-GalN administration We for the first time examined the mRNA expressions of neuropeptides such as aCGRP, POMC, CRH, and ProENK genes in C57BL/6 (WT) and aCGRP/ (KO) mice following induction of sepsis. Expression of aCGRP mRNA level was significantly increased in the hippocampus and hypothalamus of WT mice at 6 h following CLP and LPS/D-GalN administration (Fig. 1A and B). In addition to aCGRP mRNA expression, CLP causes an up-regulation of POMC, CRH, and ProENK genes in the hippocampus and hypothalamus, but not ProENK in the hypothalamus, of WT mice at 6 h after sepsis

induction (Fig. 2). However, mRNA levels of POMC, CRH, and ProENK genes were not increased in the hippocampus and hypothalamus of KO mice at 6 h following CLP-induced sepsis (Fig. 2). 3.2. Plasma levels of corticosterone (CORT), AST and ALT in LPS/DGalN-treated aCGRP KO mice Mice treated with LPS/D-GalN displayed an increase of plasma CORT, AST, and ALT levels, thereby inducing lethal liver injury

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

551

icantly decreased by CLP or LPS/D-GalN treatment compared to WT mice (Fig. 4D). 3.4. Expressions of IL-6 and IL-10 in liver and lymph node in CLPinduced aCGRP KO mice Expressions of IL-6 and IL-10 mRNAs were measured in the liver and lymph node of WT and KO mice after CLP challenge. WT mice displayed a slight increase of IL-6 and IL-10 mRNA levels in the liver and lymph node at 6 h after CLP challenge (Fig. 5). Furthermore, KO mice showed marked increase of IL-6 and IL-10 mRNA levels in the liver (Fig. 5A and C) and lymph node (Fig. 5B and D) compared to WT mice at 6 h after CLP-induced sepsis. 3.5. Survival rate in aCGRP KO mice subjected to CLP-induced sepsis We investigated the survival rate over time in WT and KO mice after 1 punched CLP-, 2 punched CLP-, and LPS/D-GalN-induced sepsis (Fig. 6). We found that the survival rate of KO mice was significantly decreased compared to that of WT mice in both 1 punched and 2 punched CLP models. LPS/D-GalN administration was tend to reduce the survival rate of KO mice but the results was not statistically significant (p = 0.09). 4. Discussion

Fig. 3. Changes of plasma corticosterone, AST, and ALT levels in WT and aCGRP KO mice after LPS/D-GalN administration. Plasma corticosterone (A), AST (B), and ALT (C) levels were measured at 12 h after LPS (18 lg/kg) plus D-galactosamine (0.4 g/ kg) (LPS/D-GalN) i.p. injection in C57BL/6 (WT) and aCGRP/ (KO) mice. The vertical bars indicate mean ± SEM (p < 0.01, p < 0.001; saline vs. LPS/D-GalN in WT or KO, ###p < 0.001; LPS/D-GalN in WT vs. LPS/D-GalN in KO, n = 8).

[23,24]. Thus, we investigated the plasma level changes of CORT, AST, and ALT in KO mice at 12 h after LPS/D-GalN treatment. As shown in Fig. 3, WT injected with LPS/D-GalN showed a significant increase of CORT, ALT, and AST levels. Interestingly, in KO mice, levels of CORT, AST, and ALT were further increased by LPS/D-GalN administration compared to WT mice.

3.3. Plasma levels of IL-1b, TNF-a, IL-6, and IL-10 in aCGRP KO mice subjected to sepsis induced by CLP or LPS/D-GalN treatment Plasma levels of IL-1b, TNF-a, IL-6 and IL-10 were measured in WT and KO mice subjected to CLP and LPS/D-GalN administration. In WT mice, marked increases of IL-1b, TNF-a, IL-6 and IL-10 were observed at 24 h after CLP or LPS/D-GalN treatment (Fig. 4). In addition, in KO mice, levels of IL-1b and TNF-a were further increased by CLP or LPS/D-GalN treatment compared to WT mice (Fig. 4A and B). Plasma IL-6 level did not change in WT and KO mice following two sepsis model (Fig. 4C). However, plasma IL-10 level was signif-

We examined the role of aCGRP in the modulation of the inflammatory responses during septic shock. The results found in the present study suggest that aCGRP has anti-inflammatory properties in septic shock condition induced by CLP or LPS/D-GalN administration. aCGRP produces (1) activation of POMC, CRH, ProENK mRNA expressions in hippocampus and hypothalamus, (2) inhibition of plasma CORT, AST, and ALT levels, (3) attenuation of plasma pro-inflammatory cytokines, IL-1b and TNF-a levels, and (4) activation of anti-inflammatory cytokine, IL-10 level, thereby protecting mice against mortality induced by the septic shock. Our findings that aCGRP induces an anti-inflammatory effect is in part in line with previous findings by several groups. CGRP inhibits local acute inflammation and protects mice against lethal endotoxemia [12], suppresses lymphoproliferation in the serum of endotoxin-treated rats [25], and induces immunosuppression during the early phase of septic peritonitis [13]. Taken together, these studies suggest that CGRP may act as an anti-inflammatory modulator that is important for reducing enhanced inflammatory responses and organ damage during the septic shock. The nervous and immune systems communicate through extensive delicate connections for the reciprocal control of cellular functions [26]. Thus, the peripheral nervous system may influence immune systems through the release of neuropeptides such as CGRP and substance P from sensory nerves that mediate pain signals. Key brain systems are tightly interconnected to modulate homeostasis in stressful conditions such as sepsis, trauma, pain, surgery. These systems include: the limbic system (such as hippocampus, amygdala, limbic cortex, and septal area), the hypothalamic-pituitary axis and the locus coeruleus/noradrenergic system [27,28]. Thus, we examined the expression of neuropeptides such as alpha-CGRP, ENK, CRH, and POMC, which are related to stress and immune response in this study. And then findings showed that sepsis induced by CLP or LPS/D-GalN treatment causes up-regulation of aCGRP, POMC, CRH, and ProENK mRNA levels in the hypothalamus and in hippocampus. In CGRP KO mice, the expression of ENK, CRH, and POMC did not increase during the septic condition. These neuropeptides can act as immune modulators or pain repressors during the sepsis. For example, increased plasma levels of POMC derivatives have been found in septic patients [29]

552

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

Fig. 4. Plasma IL-1b, TNF-a, IL-6 and IL-10 levels in CLP or LPS/D-GalN treated WT and aCGRP KO mice. Plasma IL-1b (A), TNF-a (B), IL-6 (C), and IL-10 (D) levels were measured at 24 h after LPS (18 lg/kg) plus D-galactosamine (0.4 g/kg) (LPS/D-GalN) i.p. injection and CLP (2 punched) in C57BL/6 (WT) and aCGRP/ (KO) mice. The vertical bars indicate mean ± SEM (A, B, and D: p < 0.05; WT vs. KO, n = 8).

Fig. 5. Expressions of IL-6 and IL-10 mRNAs in liver and lymph node of WT and aCGRP KO mice after CLP challenge. Expression of IL-6 (A and B) and IL-10 (C and D) were examined in liver (A and C) and lymph node (B and D) of C57BL/6 (WT) and aCGRP/ (KO) mice after CLP challenge (2 punched). Total RNA was isolated from liver and lymph node of WT and KO mice at 6 h after CLP. Gene expression of IL-6 (A and B) and IL-10 (C and D) were measured by quantitative real-time PCR using Rotor-Gene Q. The expression of gene was normalized with b-actin gene expression. Data were obtained from triplicated PCR reactions, and values are mean ± SEM (p < 0.05, p < 0.01, and  p < 0.001; sham vs. CLP in WT or KO, ###p < 0.001; CLP in WT vs. CLP in KO, n = 6).

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

Fig. 6. Survival rate in WT and aCGRP KO mice following CLP or LPS/D-GalN challenge. Survival rate was monitored over time in C57BL/6 (WT) and aCGRP/ (KO) mice after CLP 1 punched (A) and 2 punched (B) challenge and LPS (36 lg/kg) plus D-galactosamine (0.8 g/kg) (LPS/D-GalN) i.p. injection (C). Survival curves were compared by a Log-rank (Mantel-Cox) test. Statistically significant differences between groups were assumed when p < 0.05. ((A) p < 0.001, (B) p < 0.05, and (C) p = 0.09).

and acute administration of endotoxin stimulates release of CRH [30]. Enkephalin improves survival in a rat model of sepsis {Tang, 2011 #119}. Furthermore, we also found that CLP does not induce the expression of POMC, CRH, ProENK mRNAs in the hippocampus and hypothalamus of aCGRP KO mice after CLP-induced sepsis. This finding indicates that aCGRP may activate the neuropeptides, POMC, CRH, and ProENK in up-stream level during the septic shock condition. Thus, these neuropeptides can reduce the enhanced inflammatory responses with one accord. Septic shock condition induces the plasma CORT, AST, and ALT levels, serve as a biochemical marker of liver damage. Plasma CORT

553

level increased in LPS/D-GalN-induced liver injury mice and CLPsubjected rat [23,31]. Moreover, plasma AST and ALT levels are also increased in mice after acute peritonitis and CLP-subjected rat [23,32]. Plasma AST and ALT levels are increased under hepatic damage condition. In line with these results, our findings also showed that plasma CORT, AST, and ALT levels are increased in WT mice after CLP challenge. Interestingly, plasma CORT, AST, and ALT levels further enhanced in aCGRP KO mice compared to WT mice following CLP. Based on these findings, we suggest that aCGRP may reduce plasma CORT, AST, and ALT levels during the septic shock condition. Several studies have shown that CGRP inhibits the release of potent inflammatory cytokines such as IL-1b, TNF-a and CCL4 by mononuclear phagocytes, dendritic cells, human circulating blood cells and cultured mouse peritoneal macrophages induced by bacteria, LPS or Toll-like receptor agonists [14–18]. Thus, we also investigated plasma IL-1b and TNF-a levels in WT and aCGRP KO mice after CLP- and LPS/D-GalN-induced sepsis. Plasma IL-1b and TNF-a levels were further increased in aCGRP KO mice compared to WT mice subjected to septic shock. These findings indicate that aCGRP can attenuate the enhanced expressions of pro-inflammatory cytokines during the sepsis. Sepsis or inflammatory response induces expressions of antiinflammatory cytokines according to humoral immune responses, reducing activation of pro-inflammatory cytokines [33]. Hence we examined the expression of anti-inflammatory cytokines such as IL-6 and IL-10, in the liver and lymph nodes of WT and aCGRP KO mice at 6 h following CLP-induced sepsis. Expression of IL-6 and IL-10 mRNA levels were further increased in aCGRP KO mice compared to WT mice after CLP-induced sepsis. It was surprising that aCGRP reduced IL-6 and IL-10 mRNA levels in liver and lymph nodes under septic condition. In addition, it was our initial thought that aCGRP might trigger anti-inflammatory cytokines, in turn which attenuate pro-inflammatory cytokines in damaged organ during sepsis. Depending on the degree of septic shock, cytokine production is significant differences. And also, cytokines are differently expressed according to the time frame of ongoing sepsis [34,35]. Thus, we checked the plasma levels of IL-6 and IL-10 at 24 after sepsis challenge. Interestingly, plasma IL-10 level was significantly reduced in KO mice after septic shock challenge but Plasma IL-6 level did not change in WT and KO mice following two sepsis model (Fig. 4C). These findings indicate divergence between mRNA and protein expression of cytokines according to time, site (organ), and degree of ongoing sepsis. In line with our findings, CGRP increases the production of IL-6 and IL-10 in murine models endotoxemia, such as LPS or LPS/D-GalN administration [12,19], thereby reducing pro-inflammatory cytokines and improving survival. Furthermore, it is well documented that treatment with recombinant IL-10 protects mice against LPS-induced lethality, while it decreases the release of several pro-inflammatory cytokines including TNF-a in in vivo [36,37]. In addition, IL-6 and IL-10 act as a pro-inflammatory cytokine in septic shock patients and experimental animal models [33,38–42]. Taken together, our findings suggest that aCGRP activate anti-inflammatory cytokines IL-10 but not IL-6, in turn which attenuate pro-inflammatory cytokines in septic shock animal model. Consistent with a protective role of CGRP in murine lethal endotoxemia [12], our results show that survival rate of aCGRP KO mice is significantly reduced compared to WT mice after the mild and severe CLP challenge. As results of exogenously supplied CGRP, studies with mice which are genetically deficient aCGRP extended these findings and directly demonstrated that potent anti-inflammatory effects of endogenous CGRP during the sepsis. In conclusion, our findings suggest that activation of aCGRP may induce other neuropeptides associated with immunomodulation at CNS level and modulate immune responses as reducing

554

J.-K. Lee et al. / Cytokine 64 (2013) 548–554

pro-inflammatory cytokines and enhancing anti-inflammatory cytokines during the sepsis. Although further investigations are required to clarify the detailed molecular mechanisms, aCGRP may be an important target for a new drug for the treatment of sepsis. Acknowledgements This research was supported by the Priority Research Centers Program (2012-R1A6A1048184) and the Basic Science Research Program (2011-0006209 and 2011-0012972) the National Research Foundation of Korea (NRF) funded by the Ministry of Education. References [1] Wimalawansa SJ. Calcitonin gene-related peptide and its receptors: molecular genetics, physiology, pathophysiology, and therapeutic potentials. Endocr Rev 1996;17:533–85. [2] Wimalawansa SJ. Amylin, calcitonin gene-related peptide, calcitonin, and adrenomedullin: a peptide superfamily. Crit Rev Neurobiol 1997;11:167–239. [3] Brain SD, Grant AD. Vascular actions of calcitonin gene-related peptide and adrenomedullin. Physiol Rev 2004;84:903–34. [4] Bowers MC, Katki KA, Rao A, Koehler M, Patel P, Spiekerman A, et al. Role of calcitonin gene-related peptide in hypertension-induced renal damage. Hypertension 2005;46:51–7. [5] Brain SD, Williams TJ, Tippins JR, Morris HR, MacIntyre I. Calcitonin generelated peptide is a potent vasodilator. Nature 1985;313:54–6. [6] Lu JT, Son YJ, Lee J, Jetton TL, Shiota M, Moscoso L, et al. Mice lacking alphacalcitonin gene-related peptide exhibit normal cardiovascular regulation and neuromuscular development. Mol Cell Neurosci 1999;14:99–120. [7] Joyce CD, Fiscus RR, Wang X, Dries DJ, Morris RC, Prinz RA. Calcitonin generelated peptide levels are elevated in patients with sepsis. Surgery 1990;108:1097–101. [8] Beer S, Weighardt H, Emmanuilidis K, Harzenetter MD, Matevossian E, Heidecke CD, et al. Systemic neuropeptide levels as predictive indicators for lethal outcome in patients with postoperative sepsis. Crit Care Med 2002;30:1794–8. [9] Berg RM, Strauss GI, Tofteng F, Qvist T, Edvinsson L, Fahrenkrug J, et al. Circulating levels of vasoactive peptides in patients with acute bacterial meningitis. Intens Care Med 2009;35:1604–8. [10] Arden WA, Fiscus RR, Wang X, Yang L, Maley R, Nielsen M, et al. Elevations in circulating calcitonin gene-related peptide correlate with hemodynamic deterioration during endotoxic shock in pigs. Circ Shock 1994;42:147–53. [11] Tang Y, Han C, Fiscus RR, Wang X. Increase of calcitonin gene-related peptide (CGRP) release and mRNA levels in endotoxic rats. Shock 1997;7:225–9. [12] Gomes RN, Castro-Faria-Neto HC, Bozza PT, Soares MB, Shoemaker CB, David JR, et al. Calcitonin gene-related peptide inhibits local acute inflammation and protects mice against lethal endotoxemia. Shock 2005;24:590–4. [13] Jusek G, Reim D, Tsujikawa K, Holzmann B. Deficiency of the CGRP receptor component RAMP1 attenuates immunosuppression during the early phase of septic peritonitis. Immunobiology 2012;217:761–7. [14] Feng Y, Tang Y, Guo J, Wang X. Inhibition of LPS-induced TNF-alpha production by calcitonin gene-related peptide (CGRP) in cultured mouse peritoneal macrophages. Life Sci 1997;61. PL 281-7. [15] Fox FE, Kubin M, Cassin M, Niu Z, Hosoi J, Torii H, et al. Calcitonin gene-related peptide inhibits proliferation and antigen presentation by human peripheral blood mononuclear cells: effects on B7, interleukin 10, and interleukin 12. J Invest Dermatol 1997;108:43–8. [16] Harzenetter MD, Novotny AR, Gais P, Molina CA, Altmayr F, Holzmann B. Negative regulation of TLR responses by the neuropeptide CGRP is mediated by the transcriptional repressor ICER. J Immunol 2007;179:607–15. [17] Monneret G, Pachot A, Laroche B, Picollet J, Bienvenu J. Procalcitonin and calcitonin gene-related peptide decrease LPS-induced TNF production by human circulating blood cells. Cytokine 2000;12:762–4. [18] Torii H, Hosoi J, Beissert S, Xu S, Fox FE, Asahina A, et al. Regulation of cytokine expression in macrophages and the Langerhans cell-like line XS52 by calcitonin gene-related peptide. J Leukocyte Biol 1997;61:216–23.

[19] Kroeger I, Erhardt A, Abt D, Fischer M, Biburger M, Rau T, et al. The neuropeptide calcitonin gene-related peptide (CGRP) prevents inflammatory liver injury in mice. J Hepatol 2009;51:342–53. [20] Galanos C, Freudenberg MA, Reutter W. Galactosamine-induced sensitization to the lethal effects of endotoxin. Proc Natl Acad Sci USA 1979;76:5939–43. [21] Yan JJ, Jung JS, Lee JE, Lee J, Huh SO, Kim HS, et al. Therapeutic effects of lysophosphatidylcholine in experimental sepsis. Nat Med 2004;10:161–7. [22] Glick D, Vonredlich D, Levine S. Fluorometric determination of corticosterone and cortisol in 0.02–0.05 ml of plasma or submilligram samples of adrenal tissue. Endocrinology 1964;74:653–5. [23] Pan Q, Liu Y, Zheng J, Lu X, Wu S, Zhu P, et al. Protective effect of chloral hydrate against lipopolysaccharide/D-galactosamine-induced acute lethal liver injury and zymosan-induced peritonitis in mice. Int Immunopharmacol 2010. [24] Yan JJ, Jung JS, Hong YJ, Moon YS, Suh HW, Kim YH, et al. Protective effect of protocatechuic acid isopropyl ester against murine models of sepsis: inhibition of TNF-alpha and nitric oxide production and augmentation of IL10. Biol Pharm Bull 2004;27:2024–7. [25] Wang X, Fiscus RR, Tang Z, Yang L, Wu J, Fan S, et al. CGRP in the serum of endotoxin-treated rats suppresses lymphoproliferation. Brain Behav Immun 1994;8:282–92. [26] Steinman L. Elaborate interactions between the immune and nervous systems. Nat Immunol 2004;5:575–81. [27] Akrout N, Sharshar T, Annane D. Mechanisms of brain signaling during sepsis. Curr Neuropharmacol 2009;7:296–301. [28] Ulrich-Lai YM, Herman JP. Neural regulation of endocrine and autonomic stress responses. Nat Rev Neurosci 2009;10:397–409. [29] Matejec R, Locke G, Kayser F, Lichtenstern C, Weigand MA, Welters ID, et al. Hemodynamic actions of corticotropin-releasing hormone and proopiomelanocortin derivatives in septic patients. J Cardiovasc Pharmacol 2011;57:94–102. [30] Beishuizen A, Thijs LG. Endotoxin and the hypothalamo–pituitary–adrenal (HPA) axis. J Endotoxin Res 2003;9:3–24. [31] Carlson DE, Chiu WC, Fiedler SM, Hoffman GE. Central neural distribution of immunoreactive Fos and CRH in relation to plasma ACTH and corticosterone during sepsis in the rat. Exp Neurol 2007;205:485–500. [32] Zhang F, Wu R, Qiang X, Zhou M, Wang P. Antagonism of alpha2Aadrenoceptor: a novel approach to inhibit inflammatory responses in sepsis. J Mol Med 2010;88:289–96. [33] Holzmann B. Modulation of immune responses by the neuropeptide CGRP. Amino Acids 2011. [34] Remick DG, Newcomb DE, Bolgos GL, Call DR. Comparison of the mortality and inflammatory response of two models of sepsis: lipopolysaccharide vs. cecal ligation and puncture. Shock 2000;13:110–6. [35] Villa P, Sartor G, Angelini M, Sironi M, Conni M, Gnocchi P, et al. Pattern of cytokines and pharmacomodulation in sepsis induced by cecal ligation and puncture compared with that induced by endotoxin. Clin Diagn Lab Immunol 1995;2:549–53. [36] Howard M, Muchamuel T, Andrade S, Menon S. Interleukin 10 protects mice from lethal endotoxemia. J Exp Med 1993;177:1205–8. [37] Smith SR, Terminelli C, Denhardt G, Manfra D, Davies L, Narula S. Endogenous mouse interleukin-10 is up-regulated by exogenously administered recombinant human interleukin-10, but does not contribute to the efficacy of the human protein in mouse models of endotoxemia. Immunopharmacology 1999;41:119–30. [38] Mutlak H, Jennewein C, Tran N, Mehring M, Latsch K, Habeck K, et al. Cecum ligation and dissection: a novel modified mouse sepsis model. J Surg Res 2012;89:90. [39] Schuerholz T, Doemming S, Hornef M, Martin L, Simon TP, Heinbockel L, et al. The anti-inflammatory effect of the synthetic antimicrobial peptide 19–2.5 in a murine sepsis model: a prospective randomized study. Crit Care 2013;17:R3. [40] Shi DW, Zhang J, Jiang HN, Tong CY, Gu GR, Ji Y, et al. LPS pretreatment ameliorates multiple organ injuries and improves survival in a murine model of polymicrobial sepsis. Inflamm Res: Off J Eur Histamine Res Soc 2011;60:841–9. [41] Tamayo E, Fernandez A, Almansa R, Carrasco E, Heredia M, Lajo C, et al. Proand anti-inflammatory responses are regulated simultaneously from the first moments of septic shock. Eur Cytokine Network 2011;22:82–7. [42] Zhang L, Wan J, Jiang R, Wang W, Deng H, Shen Y, et al. Protective effects of trichostatin A on liver injury in septic mice. Hepatol Res: Off J Jpn Soc Hepatol 2009;39:931–8.