Deficiency of NONO is associated with impaired cardiac function and fibrosis in mice

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology journal homepage: www.elsevier.com/locate/yjmcc

Original article

Deficiency of NONO is associated with impaired cardiac function and fibrosis in mice

T

Xingli Xu, Hong Jiang, Yue Lu, Meng Zhang, Cheng Cheng, Fei Xue, Meng Zhang, Cheng Zhang, ⁎ ⁎ Mei Ni , Yun Zhang The Key Laboratory of Cardiovascular Remodeling and Function Researcdh, Chinese Ministry of Education, Chinese National Health Commission and Chinese Academy of Medical Sciences, The State and Shandong Province Joint Key Laboratory of Translational Cardiovascular Medicine, Department of Cardiology, Qilu Hospital of Shandong University, Jinan, China

A R T I C LE I N FO

A B S T R A C T

Keywords: NONO Heart defects Cardiac collagen metabolism Cardiac fibroblasts RNA-seq

Non-POU-domain-containing octamer-binding protein (NONO), a component of multifunctional Drosophila behavior/human splicing (DBHS) family, plays an important role in regulating glucose and fat metabolism, circadian cycles, cell division, collagen formation and fibrosis. Dysfunctional variants of NONO have been described as the cause of congenital heart defects in males. However, the effects of NONO deficiency on the ventricular function and cardiac fibrosis as well as the related mechanisms are not clear. In the present study, we aimed to reveal the overall phenotypes, cardiac function and fibroblasts in NONO knockout (NONO KO) mice compared with the wild-type (WT) male littermates. The results showed that the birth rate of NONOgt/0 mice was much lower than their WT male littermates at the time of weaning. The body weight of NONOgt/0 mice was 19% lower than that of WT male littermates (27.2 ± 1.49 g vs. 22.01 ± 1.20 g, P < .001). NONO KO mice exhibited continuous higher mortality from birth to a year later (P < .05). Compared with those in the WT mice, the heart weight was lower(142.0 ± 8.7 mg vs. 179.0 ± 10.4 mg, P < .001), the heart weight to body weight ratio (HW/BW) was similar, the E/A ratio was higher (1.80 ± 0.47 vs. 1.44 ± 0.26, P < .05), and the left ventricular end diastolic diameter (LVEDd) was significantly lower (2.72 ± 0.51 mm vs.3.54 ± 0.43 mm, P < .001) in the NONO KO mice. We also found excessive matrix deposition in vivo. In vitro, NONO deficiency led to fibroblasts hyperproliferation, while migration was inhibited, which would induce collagen maturation and deposition. Conversely, overexpression of NONO inhibited fibroblasts proliferation and increased migration which reduced collagen deposition. RNA-seq of cardiac fibroblasts further indicated that NONO deficiency upregulated the cell cycle regulators, which included cyclin B2, the origin recognition complex 1 (ORC1) and cell division cycle 6 (CDC6), while downregulated the migration regulators, which included myosins, integrin and coagulation factor II. Overexpression of NONO further verified the effects of these indicators. In conclusion, our study demonstrated that NONO deficiency was associated with developing heart defects in mice. Hyperproliferation of cardiac fibroblasts with dramatically excessive collagen secretion might be the cause of heart defects of NONO KO mice.

Abbreviations and acronyms: ASD, atrial septal defect; CDC6, cell division cycle 6; CFs, cardiac fibroblasts; CHD, congenital heart disease; Col1A1, Collagen I; Col3A1, Collagen III; DAPI, 4–6-diamidino-2-phenyl indole; DBHS, Drosophila behavior/human splicing; DBP, diastolic blood pressure; DMEM, Dulbecco's Modified Eagle Medium; ECM, extracellular matrix; F2, coagulation factor II; FBS, fetal bovine serum; FDR, false discovery rate; FS, fractional shortening; GFP, green fluorescent protein; gt, gene trap; HDL-C, high-density lipoprotein; HE, hematoxylin and eosin; IHC, immunohistochemistry; KO, knockout; LDL-C, low-density lipoprotein; LV, lentiviral; LVEDd, the left ventricular end diastolic diameter; LVEF, left ventricular ejection fraction; LVNC, left ventricular non-compaction; LVPWd, left ventricular posterior wall thickness; MMP, matrix metalloproteinases; MOI, multiplicity of infection; Myh 14, myosin heavy polypeptide 14; NONO, Non-POU Domain-containing Octamer-binding Protein; ORC1, the origin recognition complex 1; P4Hα1, prolyl-4-hydroxylase I; PBS, phosphate-buffered saline; PI, propidium iodine; SBP, systolic blood pressure; SEM, standard error of mean; SFM, serum-free media; TC, total cholesterol; TG, triglyceride; TTE, transthoracic echocardiography; VSD, ventricular septal defect; WT, wild-type ⁎ Corresponding authors at: Qilu Hospital, Shandong University, No. 107, Wen Hua Xi Road, Jinan, Shandong 250012, China. E-mail addresses: [email protected] (M. Ni), [email protected] (Y. Zhang). https://doi.org/10.1016/j.yjmcc.2019.10.004 Received 18 April 2019; Received in revised form 6 October 2019; Accepted 17 October 2019 Available online 18 October 2019 0022-2828/ © 2019 Published by Elsevier Ltd.

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

1. Introduction

with the estrogen hormone in female mice. The animal protocol was reviewed and approved by the Ethics Committee and the Scientific Investigation Board of Shandong University Qilu Hospital.

Congenital heart disease (CHD) is one of the leading causes of infant morbidity and disability worldwide, and has been proved to strongly correlated with chromosome abnormalities [1,2]. The non-POU domain-containing octamer-binding protein (NONO) is an RNA- and DNAbinding protein involved in DNA repairing, RNA splicing and stabilization, and transcriptional activity [3–9]. Previous studies have reported that NONO loss-of-function variants could lead to left ventricular non-compaction (LVNC) and CHD, such as atrial septal defect (ASD) and ventricular septal defect (VSD) in males [10–12]. However, the effects of NONO protein on cardiac structure and function in vivo and the primary cardiac fibroblasts in vitro have not been fully elucidated. NONO protein, a component of Drosophila behavior/human splicing (DBHS) family, has different biological functions. It was known as a circadian transcriptional repressor to interact with circadian PERIOD proteins and couple the circadian clock to the cell cycle in dermal fibroblasts [13–15]. Researches on cancer cells showed that NONO had function to regulate cell proliferation and mediate cell migration [16,17]. Benegiamo et al. demonstrated that NONO played an important role in regulating glucose and fat metabolism [9]. Zhang et al. found that NONO gene silence increased expression of proly1–4 hydroxylase alpha1 (P4Hα1), which was responsible for procollagen hydroxylation, maturation and organization, and decreased expression of matrix metalloproteinases (MMPs) [18–20]. NONO might have effects on cardiac function and fibrosis via targeting extracellular matrix (ECM) metabolism, cell proliferation and migration, which were important factors in the development of heart [21–24]. Clinical data reported three patients with NONO loss-of-function variants who all presented with LVNC and two of them were VSD and ASD respectively [12]. These suggested that NONO deficiency might impair cardiac structure and function. In the present study, we aimed to observe the effects of NONO on cardiac structure and function with NONO gene knockout (NONO KO) mice and their wild-type (WT) male littermates. In vitro, we investigated collagen expression, cell proliferation and migration in NONO KO and WT cardiac fibroblasts (CFs) from NONO KO mice and their WT male littermates. Overexpression of NONO in CFs was also performed to further confirm the experiments mechanistically in WT CFs.

2.2. Blood pressure, blood glucose and lipid measurements Systolic blood pressure (SBP), diastolic blood pressure (DBP) and heart rate (HR) were measured in 16-week-old NONO KO and WT mice by use of a noninvasive tail-cuff device (Softron BP-98A; Softron, Tokyo, Japan) as described previously [25]. The blood pressure and HR were measured three times per mouse and the average values were recorded. Fasting Blood glucose level was analyzed by using the Bayer 1650 blood chemistry analyzer (Bayer, Tarrytown, NY). Blood lipid levels were measured by using full-automatic biochemical analyzer (Chemray 240, Rayto, Shenzhen, China). 2.3. Echocardiographic imaging Mice underwent transthoracic echocardiography (TTE) after anesthesia with isoflurane to detect the cardiac function and cavity size by using the Vevo 770 high-resolution imaging system (RMV-710B, VisualSonics, Toronto, Canada) [25]. The left ventricular ejection fraction (LVEF), fractional shortening (FS), the left ventricular enddiastolic diameter (LVEDd) and left ventricular posterior wall thickness (LVPWd) were measured in M-mode via the long and short axis view, respectively. The early peak flow velocity (E) and late peak flow velocity (A) of mitral were measured and the E/A ratio was calculated by pulsed-wave Doppler mode. Also, the early peak annulus velocity (E') and the late peak annulus velocity (A') of mitral were measured and the E'/A' ratio was calculated by tissue Doppler mode. The data were averaged from three measurements of consecutive cardiac cycles. 2.4. Histology and immunohistochemistry (IHC) Mice heart tissue were isolated, perfuse-fixed with 4% paraformaldehyde, dehydrated through an alcohol gradient, embedded in paraffin and cut into 4-μm thick cross sections. Then, the sections were treated with hematoxylin and eosin (HE) staining Immunohistochemical staining was performed as previous methods [26]. Sections were incubated with the following primary antibodies at the appropriate concentrations overnight at 4 °C: anti-NONO (Santa Cruz, USA), anti-collagen I, anti-collagen III and anti-P4Hα1 (all from Abcam, Cambridge, MA, USA). The secondary antibodies were used according to the manufacturer's specifications. Nuclei were stained with hematoxylin. Data were analyzed by use of Image J software.

2. Method and materials 2.1. Mice and study design

2.5. Immunofluorescence

NONO KO mice on a C57BL/6 J background modified by a CRISPR/ Cas9 technology were graciously gifted by Prof. Hong Jiang. Mice were bred under the same conditions with 12/12-h light-dark cycles at the Animal Facility of Shandong University Qilu Hospital (Jinan, Shandong Province, China). Four genotypes of mice were described as follows. NONO+/0, NONOgt/0, NONO+/+ and NONOgt/+ mice denoted WT male mice, NONO KO male mice or NONOgt/0 (gene trap) mice, WT female mice and NONO heterozygous female mice, respectively. Thus, the genotyping of NONO KO mice was confirmed by sequencing PCR fragments (242 bp) in the CRISPR/Cas9-targeting region amplified with genomic DNA, isolated from mouse tail tips with the following primers: forward 5′ -TGAAGGCTTGACTATTGACC-3′ and reverse 5′ -CCCAGGT TTCCCTATCTC-3′. Western blot was also used for further verification for NONOgt mice that lacked NONO protein expression [14]. The WT male littermates of NONO KO male mice were used as controls. The sequence analysis of WT and NONO KO mice involved the sequences CCCCCTGATATCACTGAGGA and CCCCCTCACTGAGGAGGAAA (5 bp) or CCCCCTGAGGGGAAA (10 bp). Food and sterile water were provided ad libitum to all mice during the entire experimental period. Only male mice were included in this study to prevent potential sex differences

WT heart tissues were used for immunofluorescence. Sections were incubated with the following primary antibodies, anti-NONO (Santa Cruz, USA), anti-Vimentin and anti-α-actin (both from Abcam, Cambridge, MA, USA) at the appropriate concentrations at 4 °C overnight. Alexa Fluor 488 or 594 as the secondary antibody were applied at 37 °C for 1 h. Nuclei were visualized with 4–6-diamidino-2-phenyl indole (DAPI). Fluorescent images were visualized with a confocal laser scanning microscope. 2.6. Cell isolation and culture Adult primary CFs were extracted from 2- to 3- month-old WT and NONO KO mice [27]. Briefly, mice hearts were excised, rinsed in cold Hank's balanced salt solution, minced and digested at 37 °C for 15 min with collagenase medium contained type II collagenase (100 U/ml) and pancreatin (0.6 mg/ml). The first digestion was discarded. The digestion containing fibroblasts was repeated for 5–6 times. The collagenase medium was collected together and centrifuged for 5 min at 800 rpm 47

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

2.12. Western blot analysis

and resuspended in Dulbecco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS, Gibco) and 1% antibiotic solution. Cells were plated in 60-mm dishes and incubated at 37 °C in a 5% CO2 incubator for 1 h, during which most of the cardiac fibroblasts rapidly adhered to the dishes. Subsequently, the attached CFs were washed and further cultured in DMEM supplemented with FBS and antibiotics. Only passage 1 CFs were used in our experiments to prevent the myofibroblast differentiation.

Western blots were performed as previously described [29]. The blots were incubated with the following specific primary antibodies overnight at 4 °C: anti-NONO (1:1000, Santa Cruz, USA) anti-collagen I, anti-collagen III and anti-P4Hα1 (1:1000; all from Abcam, UK). Appropriate secondary antibodies were incubated for 1 h at room temperature. All protein levels were normalized to GAPDH (1:5000; Abcam, UK). Bands were detected using an Amersham Imager 600 (Fairfield, CT, USA) and were quantified with Image J software.

2.7. Immunocytochemistry

2.13. Gelatin zymography

CFs were seeded onto coverslips and cultured in DMEM containing 10% FBS. After fixation with 4% paraformaldehyde and permeabilization in 0.03% Triton X-100, cells were incubated with Vimentin antibody (1:1000; Abcam, Cambridge, UK) at 4 °C overnight. Alexa Fluor 594 as the secondary antibody were applied at 37 °C for 1 h. Nuclei were visualized with DAPI. Fluorescent images were visualized with a confocal laser scanning microscope.

Gelatin Zymography was performed by use of the MMP gelatin zymography kit (GenMed Scientific Inc., USA). Cardiac tissue homogenate or CFs supernatants were harvested and mixed with the gel sample buffer. The equal amounts of protein were separated by 10% SDS-PAGE polymerized with 0.1% gelatin to measure the activities of MMP-2 and MMP-9. Gels were washed with renaturing buffer, incubated with developing buffer at 37 °C, stained with Coomassie Brilliant Blue, and destained with stilled water until clear white bands appeared. Gel images were captured by use of a Bio-Red chemiluminescence imaging instrument (ChemiDoc™ Touch, Bio-Rad Laboratories, USA).

2.8. Overexpression of NONO in CFs The murine NONO cDNA (NM_023144.2) was amplified by RT-PCR and cloned into the pRRLSIN-EF1α-3FLAG-CMV-EGFP-T2A-Puro vector to construct the lentiviral (LV) overexpression system for overexpression of NONO (LV-NONO). The negative control was expression of green fluorescent protein (GFP) alone (GeneChem, Shanghai). GFP or LV-NONO was transfected into CFs seeded in 6-well plates at a multiplicity of infection (MOI) of 500. At day 3 after transfection, cells were harvested for western blot analysis to detect the expression of NONO.

2.14. Library construction for RNA-seq and sequencing procedures Total RNA was isolated using RNeasy mini kit (Qiagen, Germany). Paired-end libraries were synthesized by using the TruSeq® RNA Sample Preparation Kit (Illumina, USA) following TruSeq® RNA Sample Preparation Guide [30,31]. Briefly, the poly-A containing mRNA molecules were purified using poly-T oligo-attached magnetic beads. Following purification, the mRNA was fragmented into small pieces using divalent cations under 94 °C for 8 min. The cleaved RNA fragments were copied into first strand cDNA using reverse transcriptase and random primers. This was followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments then went through an end repair process, the addition of a single ‘A' base, and then ligation of the adapters. The products were then purified and enriched with PCR to create the final cDNA library. Purified libraries were quantified by Qubit® 2.0 Fluorometer (Life Technologies, USA) and validated by Agilent 2100 bioanalyzer (Agilent Technologies, USA) to confirm the insert size and calculate the mole concentration. Cluster was generated by cBot with the library diluted to 10 pM and then were sequenced on the HiSeq X Ten (Illumina, USA). The library construction and sequencing were performed at Shanghai Sinomics Corporation.

2.9. Cell cycle analysis A cell cycle analysis was performed by use of a propidium iodine (PI) based flow cytometry protocol (BestBio, BB-4104) [28]. Briefly, cells were cultured in DMEM containing 10% FBS until 70% confluence. After starvation for 12 h, cells were trypsinized, washed twice with phosphate-buffered saline (PBS), centrifuged for 5 min at 800 rpm, resuspended and fixed in 70% ethanol at 4 °C overnight. Then, cells were washed in PBS, resuspended in PBS with RNase A and incubated in 37 °C water. Finally, nuclei were stained with PI. Cell cycle progression was measured by flow cytometry. The results were measured by ModFit LT 3.1 software. 2.10. Cell Counting Kit (CCK8)

2.15. Data analysis for gene expression

Cell viability was analyzed using a Cell Counting Kit (CCK-8) (Dojindo, Kumamoto, Japan) according to the manufacturers' directions. Briefly, 100 μl CFs were seeded into 96-well plates, precultured in incubator. 100 μl CCK-8 was added into each hole. After incubation for 2 h, the absorbance was determined at 450 nm by microplate reader.

Sequencing raw reads were processed by filtering out rRNA reads, sequencing adapters, short-fragment reads and other low-quality reads. We used Tophat v2.0.9 to map the cleaned reads to the mouse mm10 reference genome with two mismatches [32]. After genome mapping, Cufflinks v2.1.1 was run with a reference annotation to generate FPKM values for known gene models [33]. Differentially expressed genes were identified using Cuffdiff) [33]. The p-value significance threshold in multiple tests was set by the false discovery rate (FDR) [34,35]. The fold-changes were also estimated according to the FPKM in each sample. The differentially expressed genes were selected using the following filter criteria: FDR ≤0.05 and fold-change ≥1.5.

2.11. Cell migration assay Primary CFs migration was evaluated using cell invasion chambers (Corning, 3422) following the manufacturer's instructions. In brief, WT and NONO deficient CFs were incubated in serum-free media (SFM) for 12 H. Media containing 10%FBS was added to the lower chamber, and 200 μl cell suspension (1*104 counts/ml cell concentration) was added to each chamber. After incubation for 12 h, the invasive cells were stained with crystal violet (KeyGEN BioTECH, KGA229) and the noninvading cells were wiped off with cotton-tipped swabs through washing with water for 5–6 times until no extra stains. Cell invasion was photographed by the Nikon microscope. Cell numbers were quantified by Image J.

2.16. Quantitative real-time RT-PCR Total RNA was extracted from freshly isolated CFs by using RNA extraction kit (Fastagen, Shanghai, China). RNA was reverse transcribed from each sample using the PrimeScript RT reagent kit (RR047A, Takara Bio Inc., Otsu, Shiga, Japan). The cDNA was amplified 48

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

males to maintain the X-linked NONOgt allele. The genotypes of NONOgt/0 and NONOgt/+ mice were identified by Sanger sequence. (Fig. 1A). The offspring of NONOgt/0 male mice underwent a serious survival disadvantage that the birth rate of NONO KO mice was much lower than their WT male littermates at the time of weaning (Fig. 1B). 16-week-old NONO KO mice and their WT littermates consumed equivalent amounts of food when fed a normal chow ad libitum (Supplementary Fig. 1A).The body weight of NONO KO mice was 19% lower than that of WT male littermates (27.2 ± 1.49 g vs. 22.01 ± 1.20 g, P < .001) and the weight difference was also found in female mice (22.67 ± 1.14 g vs. 20.74 ± 1.39 g, P < .05, Fig. 1C and Supplementary Fig. 1B). NONO KO mice exhibited constant higher mortality from birth to one year later (P < .05; Fig. 1D). Lower right kidney weight and liver weight were also found in NONO KO mice (Supplementary Fig. 1C and D). Craniofacial morphology also changed in NONO KO mice compared with WT mice (Fig. 1E).

with a SYBR Green I Master (04887352001, Roche, Swiss). The sequences of the primers were designed by Oligo 7.0 software (Molecular Biology Insights, Inc., Cascade, USA). The primer sequences for the cell cycle indicators, such as cyclin B2, the origin recognition complex 1 (ORC1) and cell division cycle (CDC6), migration regulators including myosin heavy polypeptide 14 (Myh14), integrin and coagulation factor II (F2), and GAPDH. Levels of RNA were normalized to GAPDH and expressed as relative values compared to control cells using the 2-△△Ct method. The PCR primer sequences were shown in Table 3. 2.17. Statistical analysis All data from at least three independent experiments were expressed as mean ± standard error of mean (SEM). Independent samples t-test was used to study differences in variables between NONO KO and WT mice. SPSS software 18.0 (SPSS, Chicago, IL, USA) was used for statistical analysis and P < .05 was regarded as statistically significant.

3.2. Characteristics of 16-week-old NONO KO mice and their WT littermates

3. Results

No difference was detected in blood pressure including SBP, DBP, MBP and HR between NONO KO mice and their male littermates (Table 1). No difference was found in fasting glucose and the lipid

3.1. Phenotypes of NONO KO mice and their WT littermates NONOgt/+ heterozygous females were backcrossed to C57BL/6

Fig. 1. Phenotypes of NONO knockout (KO) mice and their wild-type (WT) male littermates. A, Sanger sequence for indicated NONO alleles. B, Fraction of mice of each genotype at weaning, based on 339 consecutive genotyping of mice. NONO+/0, NONOgt/0, NONO+/+ and NONOgt/+ mice denoted WT male mice, NONO KO male mice, WT female mice and NONO heterozygous female mice, respectively. C, Body weight of four different genotypes of mice at 4 months after birth. n = 8 per group. ***P < .001 vs. NONO+/0 mice. *P < .05 vs. NONO+/+ mice. D, Overall survival of mice in four different genotypes from birth to one year later. n = 15 per group. *P < .05 vs. WT male mice. E, Representative photograph of NONO KO mouse (left) and its WT littermate (right). Scale bar, 15 mm. 49

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Table 1 Biochemical indicators in WT mice and NONO KO mice.

Blood glucose (mM) SBP (mmHg) DBP (mmHg) HR (bpm) TC (mmol/L) TG (mmol/L) LDL-C (mmol/L) HDL-C (mmol/L)

WT mice (n = 10)

NONO KO mice (n = 10)

9.59 ± 0.56 116.10 ± 12.46 64.36 ± 5.90 547.73 ± 46.72 3.11 ± 0.54 1.46 ± 0.09 1.74 ± 0.22 0.66 ± 0.14

9.63 ± 0.68 121.00 ± 11.58 66.17 ± 8.08 542.50 ± 36.32 2.92 ± 0.41 1.54 ± 0.10 1.80 ± 0.24 0.82 ± 0.24

Table 2 Body weight and heart weight in WT mice and NONO KO mice.

Body weight (g) Heart weight (mg) ⁎ #

WT mice (n = 10)

NONO KO mice (n = 10)

27.1 ± 1.52 120.59 ± 5.56

23.42 ± 1.15⁎ 109.63 ± 3.68#

P < .05 vs. the WT mice group based on the body weight. P < .05 vs. the WT mice group based on the heart weight.

(16.03 ± 0.36 μm vs. 12.58 ± 0.50 μm, P ≤ .001, Fig. 2C and F). Echocardiography was performed to evaluate cardiac function in the 16-week-old NONO KO mice and their WT male littermates (Fig. 2D). LVEDd was decreased in NONO KO mice (2.72 ± 0.51 mm vs.3.54 ± 0.43 mm, P < .001, Fig. 2L). There was a significantly higher of E/A ratio in NONO KO mice which indicated the impaired cardiac diastolic function (1.80 ± 0.47 vs. 1.44 ± 0.26, P < .05, Fig. 2J). No significant differences in the heart weight to body weight ratio (HW/BW), LVEF, FS and LVPWd were found between NONO KO mice and their littermates (Fig. 2E, G-2I). No ventricular enlargement and non-compacted ventricular myocardium were observed in NONO KO mice (Fig. 2B).

WT, wild type; NONO, non-POU-domain-containing octamer-binding protein; KO, knockout; SBP, systolic blood pressure; DBP, diastolic blood pressure; HR, heart rate; TC, total cholesterol; TG, triglycerides; LDL-C, low-density lipoprotein cholesterol; HDLeC, high-density lipoprotein cholesterol. All results were presented as mean ± SEM *P < .05 versus the WT mice group.

levels, including total cholesterol (TC), triglyceride (TG), low-density lipoprotein (LDL-C) and high-density lipoprotein (HDLeC) in two groups mice (Table 1).

3.3. NONO KO mice exhibited impaired cardiac diastolic function and decreased left ventricular end diastolic diameter (LVEDd)

3.4. NONO deficiency resulted in excessive cardiac fibrosis

We observed that NONO KO mice showed smaller heart size (Fig. 2A and B) and the heart weight was 142.0 ± 8.7 mg, significantly lower than those of the WT mice 179.0 ± 10.4 mg (P ≤ .001, Table 2). The diameter of cardiomyocytes was also smaller in NONO KO mice

To further investigated whether NONO deficiency would result in excessive cardiac fibrosis, we performed Masson's trichome staining to observe extracellular matrix (ECM). Moreover, we detected the expressions of Collagen I, Collagen III, P4Hα1, MMP2 and MMP9 by IHC

Fig. 2. NONO KO mice exhibited impaired cardiac diastolic function and decreased left ventricular end diastolic diameter (LVEDd). A, Representative photographs of hearts in 16-week-old NONO KO mice and their WT male littermates. Scale bar, 1 cm. B, Representative cross-sectional images of hematoxylin and eosin (HE) staining at the papillary muscle level of hearts in 2 groups of mice. Scale bar, 500 μm. C, Representative images of HE-stained sections of cardiomyocytes of hearts in 2 groups of mice. Scale bar, 20 μm. D, Representative two-dimensional and M-mode echocardiograms of hearts in 2 groups of mice. E, Heart weight (mg)/body weight (g) (HW/BW) ratio in 2 groups of mice. n = 8 per group. F, Quantitative analysis of diameter of cardiomyocytes in 2 groups of mice. n = 7 per group. G-L, Quantitative analysis of LVEF (%), FS (%), LVPWd, E/A, E'/A' and LVEDd in 2 groups of mice. n = 8 per group. *P < .05 vs. WT group; ***P < .001 vs. WT group. 50

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

3.7. NONO deficiency impaired collagen metabolism in CFs

Table 3 Designed primer sequences. Gene name

Direction

sequence

GAPDH

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CTACACTGAGGACCAGGTTGTCT GGTCTGGGATGGAAATTGTG AATGGTGCTCCTGGTATTGC GGCACCAGTGTCTCCTTTGT CACAGCAGTCCAACGTAGATGAAT TGACATGGTTCTGGCTTCCA ATGACCCTGAGACTGGAAA GCCAGGCACTCTTAGATACT CTTCCAGCCATCTTTCATTGG ATATCACACTTCATGATGCTGTTATAGGT CTTACACCAGTTCCCAAATCC TGCTGTTCAACATCCACCTCT TTAAGGGCCTTTGAGGACGAT AGTCACCGCGTAGATGGGAAA GCCAAGATTGCATTTACAGAT ACAGTCCACAGAAAGCCCTAT TGACGAGGAAGAGGCTGAAGG TGCCAGAAAGTGCCAGAGGAC GACTCTGCGTTTGCCCTGCTT TGTCCTTGTACTGCCGCTTGA GTGGTGAACCTGCCCATTGTA CCTTGAAGCCAGCACAGAACA

Collagen I Collagen III P4Hα1 α-SMA Cyclin B2 ORC1 CDC6 Myh14 Integrin Coagulation factor II

The mRNA expressions of collagen I, collagen III, P4Hɑ1 and ɑ-SMA in CFs derived from NONO KO mice were all greater than those from WT mice (Supplementary Fig. 2A-2D). We also observed the higher levels of protein expression of Collagen I, Collagen III, P4Hα1, ɑ-SMA, MMP2, MMP9 and TIMP2 in CFs from NONO KO mice (Fig. 6A and C). Reduced MMP2 and MMP9 activities were also found in supernatant of NONO KO CFs (Fig. 6D-F). Conversely, overexpression of NONO inhibited collagen deposition, increased degredation and increased the activities of MMP2 and MMP9 in vitro (Supplementary Fig. 4A-F). 3.8. Differential expression of RNA-Seq in NONO KO and wild-type CFs In the differential expression analysis, we were able to identify 197 genes within the DEG analysis. A complete list of the 197 genes showing fold change (FC) values ≥1.5 (overexpressed in NONO KO vs WT) and FC ≤ −1.5 (under-expressed in NONO KO vs WT) with P value ≤.05 (67 with P value (Padj) corrected by FDR ≤ 0.05) (Fig. 7A-C and Supplementary Table 1). These genes were described in Supplementary Table S1, which of them were associated with cell cycle and DNA replication, vascular disease, immune system and ECM-receptor interaction (Fig. 7D and E). We found that NONO deficiency upregulated the cell cycle regulators, such as cyclin B2, the origin recognition complex 1 (ORC1) and CDC6 (Supplementary Fig. 5A-C), and downregulated the migration regulators, such as Myh14, integrin and F2 (Supplementary Fig. 5D-F). These indicators were further confirmed in CFs with GFP or NONO overexpression (Supplementary Fig. 6A-6F). This suggested that NONO deficiency could promote cell cycle and inhibiting cell migration.

with the heart tissue of NONO KO mice and their WT male littermates. The results showed that the interstitial areas of NONO KO mice were rich in the ECM compared to the WT mice (Fig. 3A and B). IHC examination demonstrated that the expression of Collagen I and Collagen III were both significantly higher in the NONO KO group than those in the WT group (Fig. 3A, C and D). P4Hα1 is the key enzyme of collagen synthesis. Results showed the P4Hα1 expression dramatically elevated in NONO KO mice (Fig. 3A and E). Expression levels of MMP2 and MMP9 decreased in NONO KO group (Fig. 3A, F and G). Western blot was performed and similar results were found in WT and NONO KO heart tissue (Fig. 3H-3J). Besides, α-SMA expression elevated significantly in NONO KO group to further show the association with the increased fibrotic markers, including Collagen I, Collagen III and P4Hα1. Expression level of tissue inhibitor of metalloproteases 2 (TIMP2) decreased in NONO KO group (Fig. 3H and J). We also observed the lower levels of activities of MMP2 and MMP9 in tissues from NONO KO mice (Fig. 3K and L).

4. Discussion In the present study, we observed that NONO KO mice showed reduced body weight, serious survival disadvantage and constant higher mortality. Despite the effects of NONO deficiency on the overall phenotypes of mice, we also surprisingly found that NONO KO led to impaired cardiac diastolic function and decreased LVEDd. We further detected the CFs with NONO deficiency and found more proliferation in the stage of cell synthesis, however, less migration. As a result, ECM maturation and deposition were increasing. Conversely, overexpression of NONO inhibited fibroblasts proliferation and increased migration with reduced collagen deposition. The underlying mechanisms indicated that NONO knockout upregulated the cell cycle regulators, such as cyclin B2, ORC1 and CDC6 and downregulated the migration regulators, such as Myh14, integrin and F2. Overexpression of NONO further verified the effects of these indicators. Therefore, NONO is a positive regulator for the maintenance of cardiac function, ECM metabolism and cell biology including cell cycle and migration. The phenotypes of NONO KO mice indicated that lack of NONO protein might be embryonic lethality and lead to high mortality in mice which was consistent with the previous study [36]. The cause of high mortality rate of NONO KO mice during the first year may be as follows. Firstly, since NONO KO mice had cognitive and affective deficits, the severe epilepsy and intellectual disability may increase the mortality of mice [9,37]. Secondly, NONO KO mice showed reduced glucose and fat storage, and increased fat breakdown [9]. These metabolic defects led to the disruption of the temporal coordination between metabolic demand and gene expression, which may also increase the mortality of mice [9]. Last but not least, NONO regulates in almost every step of gene expression, including DNA break repair, RNA splicing, stabilization and export, and transcription [9,38,39]. As the multi-functional factor, NONO participates in many biological and pathological process, and may also play an essential role in keeping mice alive. However, we thought that the phenotypic changes of cardiovascular system in NONO KO mice might be not responsible for their higher rate of mortality

3.5. Localization of NONO protein in WT heart tissues The localization of NONO expression in cardiac fibroblasts and cardiomyocytes was investigated by double immunofluorescence in WT heart tissues. NONO-positive fibroblasts cells were significantly more than cardiomyocytes in the heart tissues of WT mice (Fig. 4A-4C). Thus, we speculated that cardiac fibroblasts played an important role in regulating cardiac function and fibrosis in NONO KO mice. 3.6. Increased proliferation and decreased migration in NONO deficient CFs The primary CFs isolated from adult mice ventricular tissues were identified by immunocytochemistry marked as Vimentin (+) cells (Fig. 5A). Flow cytometry experiments showed that NONO deficiency induced a great deal of proliferation in the CFs which were dramatically in S phase of cells cycle (Fig. 5B and C). The effects of NONO deficiency on CFs proliferation in S phase were further measured by CCK8 (Fig. 5D). Both experiments revealed that NONO-deficiency-induced CFs proliferation was mostly in the stage of cell synthesis. In addition, the transwell assay demonstrated that NONO deficiency also inhibited the migration of CFs (Fig. 5E and F). Conversely, overexpression of NONO inhibited fibroblasts proliferation and increased migration in vitro (Supplementary Fig. 3A-E). 51

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Fig. 3. NONO deficiency resulted in impaired collagen metabolism in vivo. A, Representative immunohistochemical staining of NONO, Masson staining, and immunohistochemical staining of Collagen I, Collagen III, P4Hɑ1, MMP2 and MMP9 of cardiac tissues in NONO KO mice and their WT male littermates. Scar bar, 100 μm. High magnification images were shown in the bottom panel. Scar bar, 20 μm. B-G, Quantitative analysis of fibrosis area, Collagen I, Collagen III, P4Hɑ1, MMP2 and MMP9 of cardiac tissues in 2 groups of mice. n = 8 per group. **P ≤ .01 vs. WT group. H, Representative western blot images of NONO, Collagen I, Collagen III, P4Hɑ1, ɑ-SMA, MMP2, MMP9 and TIMP2 protein expression of cardiac tissues in 2 groups of mice. I-J, Quantitative analysis of Collagen I (Col1A1), Collagen III (Col3A1), P4Hɑ1, ɑ-SMA, MMP2, MMP9 and TIMP2 protein expression of cardiac tissues in 2 groups of mice. n = 3 per group. **P ≤ .01 vs. WT group. K, Representative image of gelatin zymography of MMP-2 and MMP-9 activities in 2 groups of cardiac tissue homogenate. L, Quantitative analysis of MMP-2 and MMP-9 activities in 2 groups of cardia tissue homogenate. n = 3 per group. *P ≤ .05 vs. WT group.

during the first year in our study. Although16-week-old NONO KO mice and their WT male littermates consumed equivalent amounts of food when fed a normal chow ad libitum, NONO KO mice still showed less body weight which was consistent with other investigations [9,36]. The possible reasons may be that NONO deficiency had profound metabolic

impacts, including inefficient glucose uptake, reduced glucose and fat storage, and increased fat breakdown. All of these would resulte in the low weight of NONO KO mice [9]. We further found that the fasting glucose and serum liquid levels are normal in NONO KO mice. Benegiamo et al. found that NONO KO and 52

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Fig. 4. The localization of NONO in cardiac fibroblasts and cardiomyocytes in hearts of WT mice. A, Representative immunofluorescence staining of NONO and Vimentin in WT heart tissues. Scar bar, 50 μm. High magnification images were shown in the bottom panel. Scar bar, 20 μm. B, Representative immunofluorescence staining of NONO and α-actin in WT heart tissues. Scar bar, 50 μm. High magnification images were shown in the bottom panel. Scar bar, 20 μm. C, Quantitative analysis of numbers of NONO co-expression cells in cardiac fibroblasts and cardiomyocytes in WT heart tissues. n = 4 per group. D, Quantitative analysis of percentage of NONO co-expression cells in cardiac fibroblasts and cardiomyocytes in WT heart tissues. n = 4 per group. 53

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Fig. 5. Increased proliferation and decreased migration in NONO KO CFs. A, Representative immunofluorescence staining of vimentin in primary cardiac fibroblasts. Scale bar, 10 μm. B, Representative images of the distribution of cell cycle for WT and NONO KO CFs by flow cytometry. C, Quantitative analysis of percentage of each phase in 2 groups of CFs. n = 3 per group. **P ≤ .01 vs. WT group. D, Cell viability was measured by CCK-8 assay in 2 groups of CFs. n = 3 per group. ***P ≤ .001 vs. WT group. E, Representative images of invading CFs by crystal violet staining in 2 groups of CFs. Scale bar, 100 μm. F, Quantitative analysis of cell invasion in 2 groups of CFs. n = 3 per group. **P < .01 vs. WT group. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

glucose and fat storage without influencing the maintenance of fasting blood glucose and lipid metabolism under physiological conditions in mice. The developmental delay and intellectual disability with abnormal behavior in NONO KO mice were consistent to males with NONO lossof-function variants [10–12]. However, VSD, ASD or LVNC were not found in NONO KO mice in this study which was different with Daryl et al. study. They found that NONO loss-of-function variants lead to left ventricular non-compaction and CHD, such as ASD and VSD in males [12]. Several possibilities might explain the differences between NONO loss-of-function variants of patients and NONO KO mice. On the one

WT mice exhibited the similar fasting blood glucose levels, increased post-prandial blood glucose levels, reduced levels of liver triglycerides and liver lipid content based on the strictly controlled feeding time of mice with a 12-h fasting: 12-h feeding cycle [9]. However, they did not test the lipid levels in NONO KO and WT mice. Our study was different from the previous study that the normal diet was provided ad libitum to all mice during the entire experimental period. The fasting blood glucose was similar in two groups of mice, which was as same as the previous study [9]. We found for the first time that lipid levels were similar in two groups of mice. This might indicate that NONO deficiency may have a profound metabolic impact on glucose tolerance, 54

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Fig. 6. NONO deficiency resulted in impaired collagen metabolism in vitro. A, Representative western blot images of NONO, Collagen I, Collagen III, P4Hɑ1, ɑ-SMA, MMP2, MMP9 and TIMP2 protein expression of CFs from WT and NONO KO mice. BeC, Quantitative analysis of Collagen I (Col1A1), Collagen III (Col3A1), P4Hɑ1, ɑ-SMA, MMP2, MMP9 and TIMP2 protein expression in 2 groups of CFs. n = 5 per group. *P ≤ .05 vs. WT group or **P ≤ .01 vs. WT group. D, Representative image of gelatin zymography of MMP-2 and MMP-9 activities in 2 groups of CFs supernatants. E-F, Quantitative analysis of MMP-2 and MMP-9 activities in 2 groups of CFs supernatants. n = 3 per group. *P ≤ .05 vs. WT group or **P ≤ .01 vs. WT group.

various organs, such as hearts, kidney and liver. We further found that NONO KO mice showed less body weight along with less heart, kidney and liver weight compared with those in their WT littermates. Thus, the HW/BW might be not able to reflect the extent of cardiac function and fibrosis in NONO KO mice. Last, NONO KO resulted in the smaller adult cardiomyocyte size which may also affect the heart weight and HW/ BW. NONO KO may also important in regulating the cardiomyocytefibroblast crosstalk in both developing and adult heart. Further investigations are still needed to explore the HW/BW and the cardiac function in elder NONO KO mice or NONO KO mice with pathological status, and the underlying mechanism, such as cardiomyocyte-fibroblast crosstalk in both developing and adult hearts of mice. The structure and function of the heart can be affected by cardiac fibrosis, which is characterized by the excess production of the ECM including collagen types I and III [21]. Cardiac fibroblasts are the main orchestrators of ECM remodeling [40]. It has been reported that the increased proliferation of CFs results in excessive secretion of ECM proteins [41]. Both in vivo and in vitro, we observed that NONO deficiency accelerated the synthesis and deposition of collagen within the interstices of the myocardium and CFs, which were consistent with the previous study [42]. In our previous study, we found that NONO regulated tumor necrosis factor (TNF-ɑ) expression, inhibited collagen synthesis and destabilized atherosclerosis [18–20]. However, the hemizygous male mice exhibited dermal wound repair disrupting due to the lack of collagen deposition [15]. Previous study had showed that NONO participated the regulation of metabolic genes and energy homeostasis which might explain possible reasons for the lighter body weight and smaller size of heart in NONO deficient mice [9]. NONO deficiency led to collagen maturation and deposition which participated in the cardiac remodeling and impaired diastolic function in younger adult mice. Further studies are needed to explore the function of NONO on elder adult mice as well as the diseases related to cardiac remodeling. NONO, as a mediator coupling circadian cycle to cell cycle, regulates cell division to maintain cardiac morphology and function. Some researchers found that clock-controlled genes, such as Clock, Bmal1 and Klf9, were also necessary for proliferation of fibroblasts [43–45].

hand, NONO KO mice are not exactly the same as NONO loss-of-function human variants. The phenotypes of NONO KO mice are substantially different from clinical phenotype of dysfunctional variants of NONO, that is complete loss of NONO protein might be different from dysfunctional NONO. On the other hand, the pathogenesis of left ventricular non-compaction (LVNC) and CHD are variable. By now only three cases of NONO loss-of-function human variants were reported to have LVNC and CHD [12]. Mircsof et al. did not report the cardiacrelated phenotypes, such as LVNC, ASD and VSD in other three males with NONO loss-of-function variants [11]. Thirdly, CHD in males may not be caused by NONO loss-of-function variants. It might indicate that males with NONO protein loss-of-function predispose to being more vulnerable to the genetic, environmental of stochastic differences and affecting the expression or function of other cardiac-related genes or compensatory mechanisms [11]. It is interesting to observe that HW/BW, an important indicator with impact on cardiac function, was similar in NONO KO mice and their WT male littermates. The similar HW/BW seems paradox that NONO KO resulted impaired cardiac function and fibrosis in mice. Several possible reasons may explain this difference. Firstly, the collagen deposition could not cause heavier heart weight in 16-week-old NONO KO mice since the NONO KO mice might be under the early stage of heart remodeling. We found that the cardiac systolic function did not show differences between NONO KO mice and the WT male littermates, while ventricular diastolic function was elevated in the former which indicated the impaired diastolic function. The diameter of cardiomyocytes was significantly smaller in NONO KO mice compared with that in WT littermates which indicated that a smaller heart may be the result of smaller size of CM. In the course of 16 weeks, the period may be not long enough or NONO deficiency may be not effective enough to cause more collagen deposition to affect HW/BW. This result was different with pathological diseases, such as diabetic cardiomyopathy, which usually exhibited both systolic and diastolic dysfunction, severe myocardial fibrosis and higher HW/BW. Secondly, previous study has shown that NONO KO mice reduced fat storage and increased fat breakdown compared with those in their WT male littermates [9]. The metabolic disorders may affect the development of mice and their 55

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Fig. 7. Differential expression of RNA-Seq in NONO KO and WT CFs. A, Number of differentially expressed genes in 2 groups of CFs. B, The visualization of volcano plot in 2 groups of CFs. C, Module trait relationship for detected modules in 2 groups of CFs. D, GO functional enrichment analysis in 2 groups of CFs. E, KEGG pathways enrichment analysis in 2 groups of CFs. n = 3 per group.

year. Further study is necessary to investigate the specific cause of high mortality rate in NONO KO mice. It would be extremely interesting to compare the phenotypes of NONO KO mice with those of dysfunctional variants of NONO. Moreover, the effect of NONO on the development of some pathologic conditions, such as obesity and diabetes, and the underlying mechanism about the cardiomyocyte-fibroblast crosstalk during the development of the heart in NONO KO mice are also urgent to investigate. In conclusion, our study firstly provided a better understanding of the correlation between NONO deficiency and cardiac structure and function in NONO KO mice. It would be of great importance for the exploring its role in cardiac remodeling diseases such as diabetic cardiomyopathy and myocardial infarction. A more delicate animal model with cardio-fibroblast specific NONO deficiency would be more convincing to explore effects of NONO on cardiac functions in the future. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.yjmcc.2019.10.004.

Notably, our results proved that NONO deficiency led to the hyperproliferation of dermal fibroblasts [15]. Previous studies also found the similar tendency on cell cycle regulation by NONO in cancer cells [46]. It was the first study to investigate the role of NONO in regulating migration in cardiac fibroblasts. Also, we found the inhibition effects of NONO deficiency on CFs migration, which is also coincide with previous studies in other types of cells, such as HUVECs, THP-1, smooth muscle cells and cancer cell lines [47–50]. The RNA-seq experiments further reveals the underlying mechanism for NONO to regulate proliferation and migration. We performed RNAseq in cultured primary CFs abstracted from NONO KO mice and their WT littermates. We found for the first time that NONO deficiency was associated with cell cycle, mitosis, cell division, DNA replication, cell migration and other relative functions in primary cardiac fibroblasts. This indicated the underlying mechanisms for NONO deficiency to promote the cell cycle and inhibit cell migration. There are still some limits in this study. We did not elucidate the specific reasons for high mortality of NONO KO mice during the first 56

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

Disclosures None.

[19]

Acknowledgement [20]

This work was supported by the Program of Introducing Talents of Discipline to Universities (BP 0719033), the National Key Research and Development Project (NO. 2017YFC1700502), the State Key Program of National Natural Science of China (No. 81530014), the International Collaboration and Exchange Program of China (No. 81920108003), the grants of the National Natural Science Foundation of China (No. 81800382, No.81425004, No.81770442, No. 81570324, No.31770977, No 30971096), the Taishan Scholars Program of Shandong Province, and the Natural Science Foundation of Shandong Province (NO. ZR2017BH013, NO. ZR2014CM010, No. 2009ZRA01003).

[21]

[22]

[23]

[24]

References [25] [1] B.K. Koo, H.S. Lim, R. Song, M.J. Yoon, K.J. Yoon, J.S. Moon, Y.W. Kim, M.C. Kwon, K.W. Yoo, M.P. Kong, J. Lee, A.B. Chitnis, C.H. Kim, Y.Y. Kong, Mind bomb 1 is essential for generating functional notch ligands to activate notch, Development. 132 (15) (2005 Aug) 3459–3470. [2] N. Øyen, G. Poulsen, H.A. Boyd, J. Wohlfahrt, P.K. Jensen, M. Melbye, Recurrence of congenital heart defects in families, Circulation. 120 (4) (2009 Jul 28) 295–301. [3] A. Basu, B. Dong, A.R. Krainer, C.C. Howe, The intracisternal A-particle proximal enhancer-binding protein activates transcription and is identical to the RNA- and DNA-binding protein p54nrb/NonO, Mol. Cell. Biol. 17 (2) (1997 Feb) 677–686. [4] Y.S. Yang, M.C. Yang, P.W. Tucker, J.D. Capra, NonO enhances the association of many DNA binding proteins to their targets, Nucleic Acids Res. 25 (12) (1997 Jun 15) 2284–2292. [5] T. Straub, B.R. Knudsen, F. Boege, PSF/p54(nrb) stimulates “jumping” of DNA topoisomerase I between separate DNA helices, Biochemistry. 39 (25) (2000 Jun 27) 7552–7558. [6] B. Dong, D.S. Horowitz, R. Kobayashi, Krainer A.R. Purification, cDNA cloning of HeLa cell p54nrb, a nuclear protein with two RNA recognition motifs and extensive homology to human splicing factor PSF and Drosophila NONA_BJ6, Nucleic Acids Res. 21 (17) (1993) 4085–4092. [7] A. Proteau, S. Blier, A.L. Albert, S.B. Lavoie, A.M. Traish, M. Vincent, The multifunctional nuclear protein p54nrb is multiphosphorylated in mitosis and interacts with the mitotic regulator Pin1, J. Mol. Biol. 346 (4) (2005 Mar 4) 1163–1172. [8] G.J. Knott, S. Panjikar, A. Thorn, A.H. Fox, M.R. Conte, M. Lee, C.S. Bond, A crystallographic study of human NONO (p54(nrb)): overcoming pathological problems with purification, data collection and noncrystallographic symmetry, Acta Crystallogr D Struct Biol. 72 (Pt 6) (2016 Jun) 761–769. [9] G. Benegiamo, L.S. Mure, G. Erikson, H.D. Le, E. Moriggi, S.A. Brown, S. Panda, The RNA-binding protein NONO coordinates hepatic adaptation to feeding, Cell Metab. 27 (2) (2018 Feb 6) 404–418.e7. [10] Deciphering Developmental Disorders Study, Large-scale discovery of novel genetic causes of developmental disorders, Nature 519 (2015) 223–228. [11] D. Mircsof, M. Langouët, M. Rio, S. Moutton, K. Siquier-Pernet, C. Bole-Feysot, N. Cagnard, P. Nitschke, L. Gaspar, M. Znidaric, O. Alibeu, A.K. Fritz, D.P. Wolfer, A. Schroter, G. Bosshard, M. Rudin, C. Koester, F. Crestani, P. Seebeck, N. Boddaert, K. Prescott, D.D.D. Study, R. Hines, S.J. Moss, J.M. Fritschy, A. Munnich, J. Amiel, S.A. Brown, S.K. Tyagarajan, L. Colleaux, Mutations in NONO lead to syndromic intellectual disability and inhibitory synaptic defects, Nat. Neurosci. 18 (2015) 1731–1736. [12] D.A. Scott, A. Hernandez-Garcia, M.S. Azamian, V.K. Jordan, B.J. Kim, M. Starkovich, J. Zhang, L.J. Wong, S.A. Darilek, A.M. Breman, Y. Yang, J.R. Lupski, A.K. Jiwani, B. Das, S.R. Lalani, A.D. Iglesias, J.A. Rosenfeld, F. Xia, Congenital heart defects and left ventricular non-compaction in males with loss-of-function variants in NONO, J. Med. Genet. 54 (1) (2017 Jan) 47–53. [13] S.A. Brown, J. Ripperger, S. Kadener, F. Fleury-Olela, F. Vilbois, M. Rosbash, U. Schibler, PERIOD1-associated proteins modulate the negative limb of the mammalian circadian oscillator, Science 308 (2005) 693–696. [14] E. Kowalska, J.A. Ripperger, C. Muheim, B. Maier, Y. Kurihara, A.H. Fox, A. Kramer, S.A. Brown, Distinct roles of DBHS family members in the circadian transcriptional feedback loop, Mol. Cell. Biol. 32 (2012) 4585–4594. [15] E. Kowalska, J.A. Ripperger, D.C. Hoegger, P. Bruegger, T. Buch, T. Birchler, A. Mueller, U. Albrecht, C. Contaldo, S.A. Brown, NONO couples the circadian clock to the cell cycle, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 1592–1599. [16] S.S. Desai, S.S. Kharade, V.I. Parekh, S. Iyer, S.K. Agarwal, Pro-oncogenic roles of HLXB9 protein in Insulinoma cells through interaction with Nono protein and Down-regulation of the c-met inhibitor Cblb (casitas B-lineage lymphoma b), J. Biol. Chem. 290 (42) (2015 Oct 16) 25595–25608. [17] T. Yu, Y. Zhao, Z. Hu, J. Li, D. Chu, J. Zhang, Z. Li, B. Chen, X. Zhang, H. Pan, S. Li, H. Lin, L. Liu, M. Yan, X. He, M. Yao, MetaLnc9 facilitates lung Cancer metastasis via a PGK1-activated AKT/mTOR pathway, Cancer Res. 77 (21) (2017 Nov 1) 5782–5794. [18] C. Zhang, M.X. Zhang, Y.H. Shen, J.K. Burks, Y. Zhang, J. Wang, S.A. LeMaire,

[26]

[27]

[28] [29]

[30] [31]

[32] [33]

[34] [35] [36]

[37]

[38]

[39]

[40] [41] [42]

[43]

[44]

[45]

[46]

[47]

57

K. Yoshimura, H. Aoki, J.S. Coselli, et al., TNF-alpha suppresses prolyl-4-hydroxylase alpha1 expression via the ASK1-JNK-NonO pathway, Arterioscle Thromb Vasc Biol. 27 (8) (2007) 1760–1767. C. Zhang, M.X. Zhang, Y.H. Shen, J.K. Burks, X.N. Li, S.A. LeMaire, K. Yoshimura, H. Aoki, M. Matsuzaki, F.S. An, et al., Role of NonO-histone interaction in TNFalpha-suppressed prolyl-4-hydroxylase alpha1, Biochim. Biophys. Acta 1783 (8) (2008) 1517–1528. K. Zhang, F. Zhang, J.M. Yang, J. Kong, X. Meng, M. Zhang, C. Zhang, Y. Zhang, Silencing of non-POU-domain-containing octamer-binding protein stabilizes atherosclerotic plaque in apolipoprotein E-knockout mice via NF-kappaB signaling pathway, Int. J. Cardiol. 263 (2018) 96–103. S. Ares-Carrasco, B. Picatoste, A. Benito-Martin, I. Zubiri, A.B. Sanz, M.D. SanchezNino, A. Ortiz, J. Egido, J. Tunon, O. Lorenzo, Myocardial fibrosis and apoptosis, but not inflammation, are present in long-term experimental diabetes, Am. J. Physiol. Heart Circ. Physiol. 297 (2009) H2109–H2119. M. Cui, Z. Wang, R. Bassel-Duby, E.N. Olson, Genetic and epigenetic regulation of cardiomyocytes in development, regeneration and disease, Development. 145 (24) (2018 Dec 20). B. Dong, Q.T. Yu, H.Y. Dai, et al., Angiotensin-converting enzyme-2 overexpression improves left ventricular remodeling and function in a rat model of diabetic cardiomyopathy, J. Am. Coll. Cardiol. 59 (2012) 739–747. Z. Ren, Z. Wang, Z. Hu, X. Hu, H. Zhang, H. Wu, R. Hu, H. Liu, Decreased expression of P54nrb/NonO correlates with collagen deposition and fibrosis in human aortic dissection, Histopathology. 65 (4) (2014 Oct) 570–580. Y. Ti, G.L. Xie, Z.H. Wang, et al., TRB3 gene silencing alleviates diabetic cardiomyopathy in a type 2 diabetic rat model, Diabetes 60 (2011) 2963–2974. M. Torzewski, M. Klouche, J. Hock, et al., Immunohistochemical demonstration of enzymatically modified human LDL and its colocalization with the terminal complement complex in the early atherosclerotic lesion, Arterioscler. Thromb. Vasc. Biol. 18 (1998) 369–378. H. Lal, J. Zhou, F. Ahmad, R. Zaka, R.J. Vagnozzi, M. Decaul, J. Woodgett, E. Gao, T. Force, Glycogen synthase kinase-3alpha limits ischemic injury, cardiac rupture, post-myocardial infarction remodeling and death, Circulation. 125 (2012) 65–75. A. Balsalobre, et al., Resetting of circadian time in peripheral tissues by glucocorticoid signaling, Science 289 (5488) (2000) 2344–2347. X.M. Wang, Y.C. Wang, X.J. Liu, et al., BRD7 mediates hyperglycaemia-induced myocardial apoptosis via endoplasmic reticulum stress signalling pathway, J. Cell. Mol. Med. 21 (2017) 1094–1105. C. Trapnell, L. Pachter, S.L. Salzberg, TopHat: discovering splice junctions with RNA-Seq, Bioinformatics 25 (9) (2009) 1105–1111. C. Trapnell, B.A. Williams, G. Pertea, A.M. Mortazavi, G. Kwan, et al., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat. Biotechnol. 28 (5) (2010) 511–515. C. Trapnell, L. Pachter, S.L. Salzberg, TopHat: discovering splice junctions with RNA-Seq, Bioinformatics 25 (9) (2009) 1105–1111. C. Trapnell, B.A. Williams, G. Pertea, A.M. Mortazavi, G. Kwan, et al., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat. Biotechnol. 28 (5) (2010) 511–515. Y. Benjamini, Y. Hochberg, Controlling the false discovery rate: a practical and powerful approach to multiple testing, J Roy Statist Soc Ser B. 57 (1995) 289–300. Y. Benjamini, D. Yekutieli, The control of the false discovery rate in multiple testing under dependency, Ann. Stat. 29 (2001) 1165–1188. S. Li, F.J. Shu, Z. Li, L. Jaafar, S. Zhao, W.S. Dynan, Cell-type specific role of the RNA-binding protein, NONO, in the DNA double-strand break response in the mouse testes, DNA Repair (Amst) 51 (2017 Mar) 70–78. R.E. Stein, J.S. Kaplan, J. Li, W.A. Catterall, Hippocampal deletion of NaV1.1 channels in mice causes thermal seizures and cognitive deficit characteristic of Dravet syndrome, Proc. Natl. Acad. Sci. U. S. A. 116 (33) (2019 Aug 13) 16571–16576. S. Li, W.W. Kuhne, A. Kulharya, F.Z. Hudson, K. Ha, Z. Cao, W.S. Dynan, Involvement of p54(nrb), a PSF partner protein, in DNA double-strand break repair and radioresistance, Nucleic Acids Res. 37 (20) (2009 Nov) 6746–6753. G.J. Knott, C.S. Bond, A.H. Fox, The DBHS proteins SFPQ, NONO and PSPC1: a multipurpose molecular scaffold, Nucleic Acids Res. 44 (9) (2016 May 19) 3989–4004. F.G. Spinale, Myocardial matrix remodeling and the matrix metalloproteinases: influence on cardiac form and function, Physiol. Rev. 87 (2007) 1285–1342. A. Leask, TGFbeta, cardiac fibroblasts, and the fibrotic response, Cardiovascular Research. 74 (2007) 207–212. M. Tang, W. Zhang, H. Lin, H. Jiang, H. Dai, Y. Zhang, High glucose promotes the production of collagen types I and III by cardiac fibroblasts through a pathway dependent on extracellular-signal-regulated kinase 1/2, Mol. Cell. Biochem. 301 (2007) 109–114. B.H. Miller, et al., Circadian and CLOCK-controlled regulation of the mouse transcriptome and cell proliferation, Proc. Natl. Acad. Sci. U. S. A. 104 (9) (2007) 3342–3347. M. Geyfman, et al., Brain and muscle Arnt-like protein-1 (BMAL1) controls circadian cell proliferation and susceptibility to UVB-induced DNA damage in the epidermis, Proc. Natl. Acad. Sci. U. S. A. 109 (29) (2012) 11758–11763. F. Spörl, et al., Krüppel-like factor 9 is a circadian transcription factor in human epidermis that controls proliferation of keratinocytes, Proc. Natl. Acad. Sci. U. S. A. 109 (27) (2012) 10903–10908. L. Alfano, C. Costa, A. Caporaso, A. Altieri, P. Indovina, M. Macaluso, A. Giordano, F. Pentimalli, NONO regulates the intra-S-phase checkpoint in response to UV radiation, Oncogene. 35 (5) (2016 Feb 4) 567–576. Y.M. Kim, J. Seo, Y.H. Kim, J. Jeong, H.J. Joo, D.H. Lee, G.Y. Koh, K.J. Lee,

Journal of Molecular and Cellular Cardiology 137 (2019) 46–58

X. Xu, et al.

apolipoprotein E-knockout mice via collagen deposition and inflammatory inhibition, J Cell Mol Med (2019 Sep 11), https://doi.org/10.1111/jcmm.14613 4. 658Q1. [50] X. Zhang, C. Wu, W. Xiong, C. Chen, R. Li, G. Zhou, Knockdown of p54nrb inhibits migration, invasion and TNF-alpha release of human acute monocytic leukemia THP1 cells, Oncol. Rep. 35 (6) (2016) 3742–3748.

Systemic analysis of tyrosine phosphorylated proteins in angiopoietin-1 induced signaling pathway of endothelial cells, J. Proteome Res. 6 (8) (2007) 3278–3290. [48] S. Schiffner, N. Zimara, R. Schmid, A.K. Bosserhoff, p54nrb is a new regulator of progression of malignant melanoma, Carcinogenesis. 32 (8) (2011) 1176–1182. [49] X. Xu, F. Zhang, Y. Lu, S. Yu, W. Sun, S. Sun, J. Cheng, J. Ma, M. Zhang, C. Zhang, Y. Zhang, K. Zhang, Silencing of NONO inhibits abdominal aortic aneurysm in

58