Dehydrocostus lactone (DHC) suppresses estrogen deficiency-induced osteoporosis

Biochemical Pharmacology 163 (2019) 279–289

Contents lists available at ScienceDirect

Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm

Dehydrocostus lactone (DHC) suppresses estrogen deficiency-induced osteoporosis

T

Zhaoning Lia,1, Guixin Yuanb,1, Xixi Linc,d, Qian Liuc,d, Jiake Xue, Zhen Lianb, Fangming Songc,d, ⁎ Jinjian Zhengb, Dantao Xieb, Lingzi Chenf, Xinjia Wangb, Haotian Fengc,d,e, Mengyu Zhoug, , ⁎ Guanfeng Yaob, a

Department of Orthopedics, Dongguan People’s Hospital, Dongguan, Guangdong 523000, China Department of Orthopedics, The Second Affiliated Hospital, Shantou University Medical College, Shantou, Guangdong 515041, China c Guangxi Key Laboratory of Regenerative Medicine, Guangxi Medical University, Guangxi, China d Centre for Regenerative Medicine, Guangxi Medical University, Nanning, Guangxi 530021, China e School of Biomedical Sciences, The University of Western Australia, Perth, Western Australia, Australia f Affiliated Chaozhou Central Hospital, Southern Medical University (Chaozhou Central Hospital), China g Department of Dentistry, The First Affiliated Hospital of Guangxi Medical University, Nanning, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: RANKL Dehydrocostus lactone NF-κB pathway Osteoclast Osteoporosis Bone resorption

Osteoporosis is a chronic bone lytic disease, because of inadequate bone ossification and/or excessive bone resorption. Even though drugs are currently available for the treatment of osteoporosis, there remains an unmet need for the development of more specific novel agents with less adverse effects. Dehydrocostus lactone (DHC), a natural sesquiterpene lactone, was previously found to affect the differentiation of inflammatory cells by inhibiting NF-κB pathways, and garnered much interest for its anti-cancer properties via SOCS-mediated cell cycle arrest and apoptosis. As NF-κB pathway plays an essential role in osteoclast differentiation, we sought to discover the biological effects of DHC on osteoclast differentiation and resorptive activity, as well as the underlying mechanisms on these effects. Our research found that DHC inhibited RANKL-induced osteoclast differentiation, bone resorption and osteoclast specific genes expression via suppression of NF-κB and NFAT signaling pathways in vitro. We further demonstrated that DHC protected against ovariectomy (OVX)-induced bone loss in mice and the protective effect was mediated at least in part through the attenuation of NF-κB signaling pathway. Thus, this study provides insight that DHC might be used as a potential pharmacological treatment for osteoporosis.

1. Introduction Osteoporosis and osteoporotic fractures have become a major international health problem around the world with an accident of osteoporotic fracture every 3 seconds [1]. About 40% of women over 50 years old and 13% of men suffer from osteoporosis related fractures in their lifetime in America [2]. With the rapid growth in the financial and health burden of osteoporotic fractures, much effort has made on the reduction of fractures as the primary treatment goal, but adequate, effective and specific therapy remains a challenge worldwide. The cause of osteoporosis is a multifactorial process with a complicated pathophysiology. However, the main cause is an imbalance in bone remodeling, the coordinated process of osteoblastic formation and osteoclastic resorption [3,4]. Osteoblastic and osteoclastic activities are

⁎

controlled by various hormones, cytokines and mechanical loads [5]. Among them, sex hormones play a critical role in the maintenance of bone homeostasis [6]. Lack of estrogen or testosterone could lead to bone loss and increase the risk of osteoporosis [7,8]. Post-menopausal women are more prone to develop osteoporotic fractures due to accelerated bone turnover that is secondary to estrogen deficiency. Elevated osteoclast formation and excessive osteoclastic resorptive activity contribute significantly to the pathogenesis of osteoporosis [9]. Osteoclasts are derived from hematopoietic stem cells of the monocytemacrophage lineage in response to two major cytokine stimulation including macrophage-colony stimulating factor (M-CSF) and receptor activator of NF-κB ligand (RANKL) [9,10]. Recently, much interests have developed in the use of Chinese medicinal herbs as candidate agents for the treatment of a wide range of pathological conditions

Corresponding authors. E-mail addresses: [email protected] (M. Zhou), [email protected] (G. Yao). 1 Zhaoning Li and Guixin Yuan contributed equally to this work. https://doi.org/10.1016/j.bcp.2019.02.002 Received 6 December 2018; Accepted 1 February 2019 Available online 02 February 2019 0006-2952/ © 2019 Elsevier Inc. All rights reserved.

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

including osteoclast-mediated bone lytic diseases. In particular, we and others have previously found that sesquiterpene compounds, dihydroartemisinin and costunolide, can inhibit osteoclastogenesis and osteoclast function in vitro, with dihydroartemisinin attenuating osteopenia in OVX mice in vivo [11,12]. Costunolide and dehydrocostus lactone (DHC) are natural derived sesquiterpene lactones extracted from the roots of Saussurea lappa [13]. Costunolide and DHC share the same structure of α,β-unsaturated carbonyl group in the α-methylene-γ-butyrolactone moiety, which at least in part explain why both chemicals exert similar biological activities, like anti-inflammatory and anti-cancer effects [14,15]. Previously DHC was reported to exhibit anti-inflammatory effects via the inhibition of NF-kB pathway [16] and suppresses angiogenesis via the inhibition of AKT/GSK-3β and mTOR pathways [17]. DHC exhibited anti-cancer effects via the SOCS-mediated cell cycle arrest and apoptosis [18]. Interestingly costunolide was shown to inhibit osteoclast differentiation by suppressing c-Fos transcriptional activity. Here we aimed to elucidate the effects of DHC on osteoclastogenesis and osteoclastic bone resorbing function. In this study, we found that DHC inhibited osteoclasts proliferation, differentiation and resorption activity via suppression of NF-κB and NFAT signaling pathways in vitro and prevented OVX-induced bone loss in mice in vivo.

Table 1 Primer sequences for qPCR. Genes

Primer sequences (5′ → 3′)

Cathepsin K

Forward Reverse

CTTCCAATACGTGCAGCAGA TCTTCAGGGCTTTCTCGTTC

NFATc1

Forward Reverse

CCGTTGCTTCCAGAAAATAACA TGTGGGATGTGAACTCGGAA

ATP6V0d2

Forward Reverse

AAGCCTTTGTTTGACGCTGT TTCGATGCCTCTGTGAGATG

CTR

Forward Reverse

TGCAGACAACTCTTGGTTGG TCGGTTTCTTCTCCTCTGGA

DC-STAMP

Forward Reverse

CACTCCCACCCTGAGATTTGT CCCCAGAGACATGATGAAGTCA

ACP5

Forward Reverse

CACTCCCACCCTGAGATTTGT CCCCAGAGACATGATGAAGTCA

β-actin

Forward Reverse

TCTGCTGGAAGGTGGACAG CCTCTATGCCAACACAGTGC

BMMs were seeded onto 96-well plate at 5000 cells/well in complete αMEM and cultured overnight. Cells were then incubated in the presence of DHC for further 48 h. The absorbance was measured after adding 20 μL MTS reagent to each well for 4 h by ELx808 Absorbance Spectrophotometer at 490 nm (BioTek Instruments, Winooski, VT, USA).

2. Materials and methods 2.1. Materials and reagents

2.5. RNA extraction and analysis

DHC was purchased from Must Bio-Technology Co, Ltd (Chengdu, Sichuan, China) which is dissolved in dimethyl sulfoxide (DMSO, SIGMA, USA) for long term storage. Alpha-modified Eagle’s Medium (αMEM) and fetal bovine serum (FBS) were obtained from Gibco (NY, USA). All antibodies were purchased from CST. Recombinant GSTrRANKL (referred to as RANKL) protein was produced as previously described [19] and recombinant macrophage colony stimulating factor (M-CSF) was perchased from R&D Systems (MN, USA). The MTS assay kit was achieved from Promega (Madison, WI, USA).

Osteoclasts were lysed and total RNA was extracted by Trizol following the manufacturer’s protocol. cDNA generated from reverse transcription of extracted RNA were proceeded to quantitative real-time PCR (qPCR). Each 10 μL reaction mixture, contained 5 μL of Taq enzyme Premix, 0.2 μL of forward or reverse primer respectively and 1 μg of cDNA. The cycling conditions for PCR were as follows: 95 °C for 5 min, and 35 cycles of 94 °C for 40 s, 65 °C for 40 s, and 72 °C for 40 s, followed by 72 °C for 5 min as elongation step. Primers sets for the detection and quantification of specific genes were in Table 1. Reaction were conducted using 7300 Real-time PCR System (ABI, Warrington, UK). Comparative 2−ΔΔCT method was used to calculate the expression of each target gene. ΔCT value was obtain by normalizing the CT value of each specific target gene to that of β-actin. ΔΔCT was obtain by further normalization to control samples.

2.2. Osteoclastogenesis assay Bone marrow macrophages (BMMs) were freshly extracted from C57BL/6 mice and cultured in T-75 flasks in α-MEM with 25 ng/ml MCSF (henceforth referred to as complete α-MEM). When nearly confluent, BMMs were trypsinized and re-seeded onto a 96-well plate at 6000 cells/well (in triplicates) and cultured overnight. Cells were stimulated with 50 ng/ml RANKL in the absence or presence of DHC and change media every other day until the formation of multinucleated osteoclasts. 4% paraformaldehyde was used for the fixation of cells. After 10 min, cells were stained for tartrate resistant acid phosphatase (TRAP) activity. Cells with more than 3 nuclei which are TRAP positive were regarded as osteoclasts.

2.6. Immunofluorescence staining BMMs were seeded onto glass coverlids in 96-well plate at 6000 cells/well in triplicate in complete α-MEM stimulated by 50 ng/ml RANKL with or without DHC (0.5, 1, and 2.5 μM). Media were changed every two days till the formation of multinucleated osteoclasts which were fixed with 4% paraformaldehyde for 15 min. Following permeabilization with 0.1% Triton X-100, immune-reactivity was blocked with 3% BSA in PBS, and then stained for actin using rhodamine phalloidin for 2 h in the dark. Nuclei were counterstained with DAPI and observed by a fluorescence microscopy (Leica, Germany).

2.3. Alkaline phosphatase (ALP) and alizarin red (ARS) staining BMSCs were planted onto 24-well plates in the presence of osteogenic differentiation medium or lack BMP-2 (50 ng/ml) and simultaneously administered 0, 0.5, 1, 2.5 μM DHC stimulation. After washing 3 times with PBS, the cells were fixed with 4% paraformaldehyde for 15 min. ALP and ARS were conducted according to kit instructions (Nanjing Jiancheng Chemical Industrial Co., Nanjing, China) and observed under a microscope (Leica, Germany), and the mineralized area was analyzed by ImageJ software (National Institutes of Health, USA).

2.7. Bone resorption assay BMMs were planted onto 6-well plate at 100,000 cells/well with complete α-MEM and cultured for overnight. Next day cells were stimulated with 50 ng/ml RANKL until pre-osteoclasts formation. After gently harvested using cell trypsin, cells were seeded onto hydroxyapatite 96-well plates (Corning, NY, USA) with or without treatment with DHC. After 48 h, cells were washed away and visualized the resorption area using an optical microscope (Leica, Germany), and resorption domain was scored using ImageJ software.

2.4. MTS cell viability assay MTS assay (Madison, WI, USA) was used to detect the effect of DHC on BMMs viability according to manufacturer’s instruction. Briefly, 280

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 1. DHC inhibits RANKL-induced osteoclastogenesis and osteoclast marker gene expression. (A) Representative images of osteoclast culture treated with varying doses of DHC for 5 days. (B) Quantification of TRAP positive multinucleated cells following treatment with varying doses of DHC. (C) Proliferation of M-CSF stimulated BMMs following incubation with DHC at different doses for 48 hrs as measured by MTS assay. (D) Real-time PCR analyses was performed on RNA extracted from cells stimulated for 5 days with RANKL and varying doses of DHC. Gene expression of osteoclast marker genes ACP5, Cathepsin K, Calcitonin receptor, and DC-STAMP was normalized to β-actin RNA and then compared to RANKL-only control samples to obtain the relative fold change. N = 3; *p < 0.05, **p < 0.01, ***p < 0.001 relative to DHC-untreated controls.

281

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

2.8. Western blot assays

2.12. Statistical analysis

BMMs plated onto 6-well plates in complete α-MEM were pretreated with DHC for 1 h before RANKL stimulation for 5, 10, 20, 30, and 60 min (NF-κB signaling) or for 12, 24, 48, and 72 h (NFAT signaling). Total cellular proteins were extracted and quantified. Protein samples (20 μg) were loaded on SDS-PAGE gel and separated proteins were electroblotted onto 0.45 μm PVDF membrane (Thermo Scientific, Rockford, USA). Membranes blocked in 5% BSA for 1 h were probed with primary antibodies overnight at 4 °C. Next day membranes were incubated with relative secondary antibodies and visualized by an Odyssey CLx Imager (Li-COR, Lincoln, NE, USA).

All values are presented as mean ± standard deviation (SD) of the values from at least three independent experiments. Student’s-test was used to compare the mean values of different groups of data, and a pvalue < 0.05 was considered to be statistically significant (95% confidence intervals).

2.9. NFAT luciferase assay

In vitro osteoclastogenesis assay was performed to explore the biological effect of DHC on osteoclast formation. As shown in Fig. 1A and B, DHC dose-dependently suppressed RANKL-induced formation of multinucleated osteoclasts. The cytotoxic effects of DHC on BMMs were examined by MTS assay. The results showed that DHC at a dose range from 0.5 μM to 2.5 μM, which were effective at inhibiting osteoclastogenesis, did not show any cytotoxic effect on BMMs after 48 h treatment (Fig. 1C). In addition, using in vitro osteoblastogenesis, alkaline phosphatase staining and alizarin red staining assays, we found DHC exerted no biological effect on osteoblast formation and bone mineralization (Fig. 5A and B) and thus focused solely on the effects of DHC on osteoclasts. Real-time PCR analysisof osteoclast specific gene expression further confirmed the inhibitory effect of DHC on osteoclastogenesis. Osteoclastic marker gene expression including Cathepsin K, Calcitonin receptor, ACP5 and DC-STAMP was dose dependently suppressed by DHC (Fig. 1D).

3. Results 3.1. DHC suppresses RANKL-induced osteoclastogenesis and gene expression

For luciferase analysis of NFAT, RAW264.7 cells stably transfected with an NFAT luciferase reporter construct [20] were seeded at 50,000 cells/well onto a 48-well plate. The next day cells were treated with DHC 1 h before RANKL stimulation for 24 h with DHC. Cells were lysed using lysis buffer contain Dithiothreitol (DTT) and centrifuged for 20 min. Luciferase activity is measured with Promega luciferase kit (Promega, Beijing, China). 2.10. Ovariectomy (OVX) mouse model The in vivo OVX mouse model was approved by the Animal Ethics Committee of Academy of Military Medical Sciences (SCXK-(JUN) 2012-0004, Beijing, China). 9-week old C57BL/6J mice were divided randomly into 5 groups, 6 mice per group: sham group, OVX group, OVX + E2 (Estradiol, 0.08 mg/kg) group, OVX + low dose DHC (3 mg/ kg) group, and OVX + high dose DHC (6 mg/kg) group. Each group were kept in ventilated cages with a 12 h light/dark cycle, with standard chow and water ad libitum. Except sham group, all groups were given ovariectomy procedure, while the sham group was given sham operation. By giving 10% chloral hydrate solution, mice were anesthetized. Shortly after small incisions were made on the back of mice and ovaries including part of the oviducts were removed. Incisions were closed using 5-0 synthetic absorbable sutures. All mice were given 1 week for post-operative recovery prior to subsequent treatments. Mice in the OVX + E2 group, OVX + low dose DHC group and OVX + high dose DHC group were given an intraperitoneal injection of 0.08 mg/kg Estradiol, 3 mg/kg DHC or 6 mg/kg DHC respectively every other day. Mice in sham and OVX group were injected intraperitoneally with PBS containing 1% DMSO as a control. No adverse events were recorded after the treatment with DHC throughout the experimental period. Mice were sacrificed after 6 weeks treatment, and left lower limbs were obtained and fixed in 4% paraformaldehyde. Excess soft tissues were removed and the clean tibias were processed for micro-computed tomography (μCT) analyses.

3.2. DHC suppresses RANKL-induced osteoclast fusion and bone resorption Pre-osteoclast fusion and reorganization of the actin cytoskeleton is a prerequisite for the formation of giant multinucleated osteoclasts and subsequent bone resorptive activity. In inactive osteoclasts, actin is organized into a podosomal belt that circumscribes the individual osteoclasts, and can be used as a distinguishing marker for these multinucleated ‘pancake-shaped’ cells as shown in Fig. 2A (top row). Treatment with DHC dose dependently decreased the size and eventually the formation of the podosomal belt (Fig. 2A, rows 2–4) consistent with inhibited osteoclast formation (Fig. 2B and C) and decreased expression of osteoclast fusion factor DC-STAMP (Fig. 1D). When cultured on bone or bone-mimicking substrate such as hydroxyapatite, the podosomal belt is rapidly reorganized into tight structure known as the F-actin ring which seals off the underlying extracellular to enable bone resorption to take place. As shown in Fig. 2B, osteoclasts cultured on hydroxyapatite-coated plates for 48-h showed extensive resorption, whereas cells treated with 1 and 2.5 μM DHC showed marked impairment of bone resorption. The percentage of resorbed area was significantly decreased following treatment with 1 and 2.5 μM DHC (Fig. 2C). These results indicated that DHC not only inhibited osteoclast formation but also osteoclast bone resorption. However, the mechanisms by which DHC inhibits osteoclast bone resorption requires further investigations.

2.11. Micro-computed tomography (μCT) and histological assessments Cleaned tibias were wrapped in tissue and loaded into a 1.5 ml microtube filled with PBS to maintain position and hydration. Tubes were then immobilized on the specimen spindle. Each tibia was imaged by Skyscan 1176 μCT System (Bruker microCT, Kontich, Belgium). Region of interest (ROI) was selected 50 slices below the growth plate with height of 100 slices. Cancellous bone parameters within this ROI were determined using CTAn (Bruker microCT, Kontich, Belgium). Following the μCT analyses, tibias were decalcified and embedded in paraffin wax for histology sectioning, and 5 mm thick sections were prepared. After mounting, sections were stained for hematoxylin and eosin (H&E), or TRAP activity. Slides were visualized using Leica DM100 light microscope (Leica, Germany), and the TRAP area was analyzed by ImageJ software.

3.3. DHC suppresses RANKL-induced NF-κB signaling NF-κB signaling is one of the earliest signaling cascades activated by RANKL stimulation. To define the underlying mechanism of impaired osteoclast formation induced by DHC, western blot analysis on NF-κB signaling pathway was performed. As demonstrated in Fig. 3A, pretreatment of BMMs with 1 μM DHC inhibited RANKL stimulated rapid induction of IKKα/β phosphorylation, IκBα phosphorylation and degradation and p65 phosphorylation. MAPK signaling pathway is also instrumental in osteoclast formation. However, as shown in Fig. 3A, we did not observe any biologic effect of DHC on phosphorylation of ERK, 282

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 2. DHC inhibits RANKL-induced hydroxyapatite resorption and osteoclast fusion. (A) Representative confocal images of osteoclasts stained for F-actin and nuclei. (B) Representative images of osteoclastic resorption on hydroxyapatite-coated surfaces. (C) The percentage of the area of hydroxyapatite surface resorption. N = 3; *p < 0.05, **p < 0.01 relative to DHC-untreated controls.

one of important elements for the MAPK signaling pathway, indicating DHC could selectively suppress NF-κB signaling pathway.

3.4. DHC suppresses RANKL-induced NFATc1 expression NFATc1 is a master transcription factor that regulates the differentiation of osteoclasts, which is induced by RANKL-induced NF-κB and MAPK signaling pathways. The effect of DHC on NFAT activity was first 283

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

(caption on next page)

284

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 3. DHC suppresses RANKL-induced NF-κB activation, NFAT activity and the expression of NFATc1 and ATP6V0d2. (A) BMMs pretreated with DHC (1 μM) for 1 h were then stimulated with RANKL (100 ng/mL) for 0, 5, 10, 20, 30, and 60 min. Protein was then extracted for western blot analyses using antibodies as shown. The ratios of the density of p-IKK β bands relative to IKK β bands, p-IκB-α bands relative to total IκB-α bands, IκB-α bands relative to β-actin bands, p-P65 bands relative to total P65 bands, p-ERK bands relative to ERK were then determined using Image J. (B) Real-time PCR analyses was performed on RNA extracted from cells stimulated for 0, 1, 2, 3 days with RANKL and varying concentrations of DHC. Gene expression of NFATc1 and ATP6V0d2 was normalized to β-actin RNA and then compared to RANKL-only control samples to obtain the relative fold change. N = 3; *p < 0.05, ***p < 0.001 relative to RANKL-treated, DHC-untreated controls. (C) RAW264.7 cells stably transfected with an NFAT luciferase reporter construct were treated with different dose of DHC for 1 h before RANKL stimulation for 24 h. The cells were harvested and lysed for luciferase analysis. *p < 0.05, ***p < 0.001 relative to RANKL-treated, DHC-untreated controls. (D) BMMs were pretreated with DHC (1 μM) for 1 h, then stimulated with RANKL (100 ng/mL) for 0, 12, 24, 48 and 72 h. Protein was then extracted for western blot analyses using antibodies against NFATc1 and β-actin antibodies. The ratio of the density of NFATc1 bands relative to β-actin bands shown below was then determined using Image J.

[23–25]. In this study we provided evidence that extends DHC biological benefits to the bone. Our data showed that DHC could inhibit osteoclastogenesis and osteoclast function in vitro and protect against OVX-induced bone loss in vivo. Elevated osteoclast formation results in excessive osteoclastic bone resorption, which is a forerunner of osteoporosis in postmenopausal women [26,27]. M-CSF and RANKL/RANK signaling axis induces monocytic precursors to differentiate, mediates osteoclast marker genes expression, and induces the differentiation and fusion of precursor cells to form multinucleated giant cells, which initiate bone resorption [28]. By binding to its cognate receptor RANK, RANKL can rapidly activate several key downstream signaling pathways, of which NF-κB, and MAPK cascades, are important for the early commitment of monocytic precursor cell to the osteoclast lineage [29,30]. Activation of NF-κB pathway necessitates the phosphorylation and subsequent degradation of inhibitor of NF-κB (IκBα) by IκB kinase (IKK) complex (IKKα, IKKβ, and IKKγ/NEMO) [31,32]. This in turn allows NF-κB (p65/RelA) dimers that was previously sequestered in the cytoplasm by IκBα to translocate to nuclei to carry out its transcriptional activities [31,33]. Our study found that DHC could inhibit RANKL-induced NF-κB signaling pathway through suppression of IκBα phosphorylation and degradation, inhibiting the phosphorylation of p65/RelA, and thus preventing it from translocating into the nucleus. Although the MAPK cascade is also instrumental in osteoclast formation, we did not observe any biologic effect of DHC on ERK, one of the MAPK signaling pathways. However, we can not rule out the effect of DHC on other MAPK pathways such as p38 and JNK. The early activation of the NF-κB signaling pathway leads to the induction of NFATc1. Τhe calcium/calcineurin dependent nuclear translocation pathways and MAPK/c-Fos dependent transcriptional pathway also plays crucial roles in the induction of NFATc1 [34,35]. Loss of NFATc1 protein expression and activity in mice results in severe osteopetrosis due to the lack of osteoclasts in bone [36]. We demonstrated that DHC reduced the gene and protein expression of NFATc1 induced by RANKL stimulation. The suppressive effect of DHC on NFATc1 may due to the early suppression of NF-κB. In addition to anti-osteoclastogenic effects on osteoclast precursor cells, we also showed that DHC exhibited anti-resorptive effects on osteoclasts. Osteoclasts treated with DHC had impaired bone resorptive activity when cultured on bone mimicking hydroxyapatite substrate. Consistent with these in vitro effects, administration of DHC protects OVX model mice against bone loss in vivo, with protective biological effects comparable to treatment with estradiol. Furthermore, DHC treatment showed no systemic or specific organ toxicity (Fig. 7A). Our histological assessment showed that DHC markedly reduced the appearance of TRAP positive osteoclasts on bone surface thus minimizing bone loss induced by ovariectomy. Sesquiterpene lactones are a class of chemical compounds and up to now there are over 6000 sesquiterpene lactone molecules discovered by various sources. Previous studies showed that several naturally derived sesquiterpene lactones could exhibit anti-osteoclastogenic effects both in vitro and in vivo, including costunolide [12], cynaropicrin [37], parthenolide [38] and isodeoxyelephantopin [39]. Costunolide and DHC are the major chemical and bioactive constituents of Saussurea lappa [17]. In addition, costunolide and DHC share the same structure

analyzed. DHC suppressed RANKL-induced NFAT activation dose dependently by luciferase reporter assay (Fig. 3C). To assess the expression of gene and protein of NFATc1 following DHC treatment, quantitative PCR and western blot analyses were conducted respectively. The results showed that both the gene and protein expression of NFATc1 were significantly suppressed following the treatment of 1 μM DHC (Fig. 3B and D). Consistent with attenuated NFATc1 protein expression, the gene expression of ATP6V0d2, a direct down-stream target gene of NFATc1 transcriptional activity encoding the V0 domain subunit of the V-ATPase proton pump, was also significantly decreased following the treatment of 1 μM of DHC (Fig. 3B). The decreased expression of the VATPase V0 d2 subunit could in part explain the anti-resorptive effect of DHC as V-ATPase proton pumps are crucial components of the osteoclast bone resorptive machinery. Collectively, our in vitro data suggests that DHC exhibits anti-osteoclastic effects by the attenuation of RANKLinduced NF-κB and NFAT signaling pathways. 3.5. DHC inhibits OVX-induced bone loss To further elucidate the therapeutic potential of DHC on OVX-induced bone loss, mice were either given sham operation or ovariectomized and then injected intraperitoneally with either 0.08 mg/kg estradiol, 3 mg/kg DHC (low dose), or 6 mg/kg DHC (high dose) every 2 days. Sham and OVX groups received PBS injections every 2 days for 6 weeks post-surgery. μCT scanning of extracted tibias showed extensive bone loss in trabecular bone in OVX mice, whereas mice that received E2 (estradiol) was significantly protected against OVX-induced osteopenia (Fig. 4A). Intriguingly, as shown in μCT analysis of trabecular bone parameters including bone volume/tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), BMD, bone surface/bone volume (BS/BV) and structure model index (SMI), DHC treatments at both low and high doses had similar effect on reversing OVX-induced bone loss, compared with estradiol treatment group (Fig. 4A, B). However, the protective effects of DHC were not apparent on cortical bones (Fig. 6A, B). Histological assessment showed markedly lower levels of TRAP positive osteoclasts in DHC treated mice as compared to OVX mice, which exhibited extensive network of TRAP positive osteoclasts and bone loss (Fig. 4C, D). Together our in vivo results suggested that DHC prevented OVX-induced bone loss by suppressing osteoclast formation. 4. Discussion Osteoporosis is a common health problem of our ageing society with progressive prevalence and heavy socio-economic burden both in the developed and developing countries. Although current anti-resorptive therapies have been somewhat effective in the treatment of osteoporosis, their prolong use entails potential adverse effects. Over recent years, there have been continuous interest in Chinese herbal medicine and plant-derived components as alternative sources of discovering new agents for osteoporosis. DHC is a natural sesquiterpene lactone and the biologically active compound of the roots of Saussurea lappa, a wellknown Chinese traditional herbal medicine. Previous pharmacological studies have shown that DHC possesses anti-inflammatory [14], antiulcer [21], immunomodulatory [22] and anti-cancer properties 285

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 4. DHC inhibits ovariectomy-induced bone loss. (A) Representative 3D reconstructions of trabecular bone from the tibia of sham mice, OVX mice, OVX mice treated with 0.08 mg/kg Estradiol, OVX mice treated with 3 mg/kg DHC and OVX mice treated with 6 mg/kg DHC, showing the protective effect of DHC treatment following OVX. (B) Quantitative analyses of bone volume/tissue volume (BV/TV), trabecular separation (Tb.Sp), trabecular number (Tb.N), trabecular thickness (Tb.Th) and bone mineral density (BMD), bone surface/bone volume (BS/ BV) and structure model index (SMI). N = 6; *p < 0.05, **p < 0.01, ***p < 0.001 relative to OVX control. (C) Representative images of decalcified bone stained with H&E and TRAP from sham mice, OVX mice, OVX mice treated with Estradiol 0.08 mg/kg, OVX mice treated with DHC 3 mg/kg and DHC 6 mg/kg. (D) TRAP positive cells area in femur were analyzed by Image J program, N = 6; ***p < 0.001 relative to OVX control.

286

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 5. DHC shows no affect on osteoblast differentiation. (A) Representative ALP and ARS images of osteoblast culture treated with varying concentrations of DHC. (B) The mineralized area is quantified and expressed as a percentage relative to the control by imageJ.

of α,β-unsaturated carbonyl group in the α-methylene-γ-butyrolactone moiety, explaining at least in part why both chemicals exert similar biological activities, like anti-inflammatory, anti-cancer, anti-virus and activities [14,15]. Interestingly, co-treatment with costunolide and DHC showed synergistic anti-breast cancer efficiency both in vitro and in vivo [15]. As to chemical structure, germacrene-type and guaiane-type are two of the most common types of sesquiterpene lactones. Costunolide and parthenolide are of germacrene-type, whereas DHC refers to guaiane-type sesquiterpene lactones [40]. Our previous study suggested that ester residues in the germacrane-based framework in parthenolide could play important roles in the biological function like inhibiting osteoclast formation [41]. Whether and how these two types of

sesquiterpene lactones differentially affect the downstream target molecules warrant further investigation. Moreover, we explore the possibility that DHC might influence osteoblastic bone formation, but our in vitro results of DHC on osteoblastic function shows no noticeable effect. Collectively, the results present in this study provides evidence for the use of DHC as a potential agent for prevention and therapy of osteoporosis and other bone lytic diseases.

Acknowledgements This project is supported in part by Natural Science Foundation of Guangxi Province (2015GXNSFDA139019), National Natural Science

Fig. 6. DHC has no effect on cortical bone in ovariectomized mice. (A) Representative 3D reconstructions of cortical bone from the tibia. (B) Quantitative analyses of cortical bone Area (Ct.Ar) and cortical bone thickness (Ct.Th), N = 6; ***p < 0.001 relative to OVX control. 287

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

Fig. 7. DHC inhibits OVX-induced bone loss without significant toxicity to important organs. (A) Heart, spleen, liver, kidney and lung were fixed and embedded for sectioning. Tissue sections were stained with hematoxylin and eosin.

Foundation of China (81501910), the Natural Science Foundation of Guangdong Province (2018A030307025), Natural Science Foundation of Guangxi Province (2015GXNSFCA414001) and Postgraduate Innovation and Entrepreneurship Education & Co-Cultivation Program of Guangxi Collaborative Innovation Center for Biomedicine (GXCICBPIEECC-201601).

[5] A.G. Robling, A.B. Castillo, C.H. Turner, Biomechanical and molecular regulation of bone remodeling, Annu. Rev. Biomed. Eng. 8 (2006) 455–498, https://doi.org/10. 1146/annurev.bioeng.8.061505.095721. [6] J.A. Cauley, Estrogen and bone health in men and women, Steroids 99 (2015) 11–15, https://doi.org/10.1016/j.steroids.2014.12.010. [7] P. Garnero, E. Sornay-Rendu, B. Claustrat, P.D. Delmas, Biochemical markers of bone turnover, endogenous hormones and the risk of fractures in postmenopausal women: the OFELY study, J. Bone Miner. Res. 15 (2000) 1526–1536, https://doi. org/10.1359/jbmr.2000.15.8.1526. [8] L. Katznelson, J.S. Finkelstein, D.A. Schoenfeld, D.I. Rosenthal, E.J. Anderson, A. Klibanski, Increase in bone density and lean body mass during testosterone administration in men with acquired hypogonadism, J. Clin. Endocrinol. Metab. 81 (1996) 4358–4365, https://doi.org/10.1210/jcem.81.12.8954042. [9] S.L. Teitelbaum, Bone resorption by osteoclasts, Science 289 (2000) 1504–1508. [10] T. Suda, N. Takahashi, T.J. Martin, Modulation of osteoclast differentiation, Endocr. Rev. 13 (1992) 66–80, https://doi.org/10.1210/edrv-13-1-66. [11] L. Zhou, Q. Liu, M. Yang, T. Wang, J. Yao, J. Cheng, J. Yuan, X. Lin, J. Zhao, J. Tickner, J. Xu, Dihydroartemisinin, an anti-malaria drug, suppresses estrogen deficiency-induced osteoporosis, osteoclast formation, and rankl-induced signaling pathways, J. Bone Miner. Res. 31 (2016) 964–974, https://doi.org/10.1002/jbmr. 2771. [12] Y.-H. Cheon, M.J. Song, J.-Y. Kim, S.C. Kwak, J.H. Park, C.H. Lee, J.J. Kim, J.Y. Kim, M.K. Choi, J. Oh, Y.-C. Kim, K.-H. Yoon, H.B. Kwak, M.S. Lee, Costunolide inhibits osteoclast differentiation by suppressing c-Fos transcriptional activity, Phytother. Res. 28 (2014) 586–592, https://doi.org/10.1002/ptr.5034. [13] D.M. Joel, S.K. Chaudhuri, D. Plakhine, H. Ziadna, J.C. Steffens, Dehydrocostus lactone is exuded from sunflower roots and stimulates germination of the root parasite Orobanche cumana, Phytochemistry 72 (2011) 624–634, https://doi.org/ 10.1016/j.phytochem.2011.01.037. [14] X. Lin, Z. Peng, C. Su, Potential anti-cancer activities and mechanisms of costunolide and dehydrocostuslactone, Int. J. Mol. Sci. 16 (2015) 10888–10906, https://

Conflict of interest The authors declare no conflict of interest. References [1] S. Tomasevic-Todorovic, A. Vazic, A. Issaka, F. Hanna, Comparative assessment of fracture risk among osteoporosis and osteopenia patients: a cross-sectional study, Open Access Rheumatol. Res. Rev. 10 (2018) 61–66, https://doi.org/10.2147/ OARRR.S151307. [2] U.H. Lerner, Bone remodeling in post-menopausal osteoporosis, J. Dent. Res. 85 (2006) 584–595, https://doi.org/10.1177/154405910608500703. [3] B.-J. Kim, Y.-S. Lee, S.-Y. Lee, W.-Y. Baek, Y.J. Choi, S.A. Moon, S.H. Lee, J.-E. Kim, E.-J. Chang, E.-Y. Kim, J. Yoon, S.-W. Kim, S.H. Ryu, S.-K. Lee, J.A. Lorenzo, S.H. Ahn, H. Kim, K.-U. Lee, G.S. Kim, J.-M. Koh, Osteoclast-secreted SLIT3 coordinates bone resorption and formation, J. Clin. Invest. 128 (2018) 1429–1441, https://doi.org/10.1172/JCI91086. [4] T. Miyamoto, Mechanism underlying post-menopausal osteoporosis: HIF1alpha is required for osteoclast activation by estrogen deficiency, Keio J. Med. 64 (2015) 44–47, https://doi.org/10.2302/kjm.2015-0003-RE.

288

Biochemical Pharmacology 163 (2019) 279–289

Z. Li, et al.

1016/j.biopha.2018.03.080. [28] N.S. Soysa, N. Alles, K. Aoki, K. Ohya, Osteoclast formation and differentiation: an overview, J. Med. Dent. Sci. 59 (2012) 65–74. [29] B.F. Boyce, Advances in the regulation of osteoclasts and osteoclast functions, J. Dent. Res. 92 (2013) 860–867, https://doi.org/10.1177/0022034513500306. [30] D.V. Novack, Role of NF-kappaB in the skeleton, Cell Res. 21 (2011) 169–182, https://doi.org/10.1038/cr.2010.159. [31] K.D. Brown, E. Claudio, U. Siebenlist, The roles of the classical and alternative nuclear factor-kappaB pathways: potential implications for autoimmunity and rheumatoid arthritis, Arthritis Res. Ther. 10 (2008) 212, https://doi.org/10.1186/ ar2457. [32] F. Mercurio, A.M. Manning, Multiple signals converging on NF-kappaB, Curr. Opin. Cell Biol. 11 (1999) 226–232. [33] D. Nakagomi, K. Suzuki, H. Nakajima, Critical roles of IkB kinase subunits in mast cell degranulation, Int. Arch. Allergy Immunol. 158 (Suppl) (2012) 92–95, https:// doi.org/10.1159/000337800. [34] G.R. Crabtree, Calcium, calcineurin, and the control of transcription, J. Biol. Chem. 276 (2001) 2313–2316, https://doi.org/10.1074/jbc.R000024200. [35] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation, Nature 423 (2003) 337–342, https://doi.org/10.1038/nature01658. [36] M.M. Winslow, M. Pan, M. Starbuck, E.M. Gallo, L. Deng, G. Karsenty, G.R. Crabtree, Calcineurin/NFAT signaling in osteoblasts regulates bone mass, Dev. Cell 10 (2006) 771–782, https://doi.org/10.1016/j.devcel.2006.04.006. [37] M. Hayata, N. Watanabe, N. Kamio, M. Tamura, K. Nodomi, K. Tanaka, A. Iddamalgoda, H. Tsuda, Y. Ogata, S. Sato, K. Ueda, K. Imai, Cynaropicrin from Cynara scolymus L. suppresses Porphyromonas gingivalis LPS-induced production of inflammatory cytokines in human gingival fibroblasts and RANKL-induced osteoclast differentiation in RAW264.7 cells, J. Nat. Med. 73 (2019) 114–123, https:// doi.org/10.1007/s11418-018-1250-6. [38] J.-Y. Kim, Y.-H. Cheon, K.-H. Yoon, M.S. Lee, J. Oh, Parthenolide inhibits osteoclast differentiation and bone resorbing activity by down-regulation of NFATc1 induction and c-Fos stability, during RANKL-mediated osteoclastogenesis, BMB Rep. 47 (2014) 451–456. [39] H. Ichikawa, M.S. Nair, Y. Takada, D.B.A. Sheeja, M.A.S. Kumar, O.V. Oommen, B.B. Aggarwal, Isodeoxyelephantopin, a novel sesquiterpene lactone, potentiates apoptosis, inhibits invasion, and abolishes osteoclastogenesis through suppression of nuclear factor-kappaB (nf-kappaB) activation and nf-kappaB-regulated gene expression, Clin. Cancer Res. 12 (2006) 5910–5918, https://doi.org/10.1158/10780432.CCR-06-0916. [40] S.M. Adekenov, Sesquiterpene lactones with unusual structure. Their biogenesis and biological activity, Fitoterapia 121 (2017) 16–30, https://doi.org/10.1016/j.fitote. 2017.05.017. [41] S. Qin, E. Ang, L. Dai, X. Yang, D. Ye, H. Chen, L. Zhou, M. Yang, D. Teguh, R. Tan, J. Xu, J. Tickner, N.J. Pavlos, J. Xu, Natural germacrane sesquiterpenes inhibit osteoclast formation, bone resorption, RANKL-induced NF-kappaB activation, and ikappabalpha degradation, Int. J. Mol. Sci. 16 (2015) 26599–26607, https://doi. org/10.3390/ijms161125972.

doi.org/10.3390/ijms160510888. [15] Z. Peng, Y. Wang, X. Gu, Y. Xue, Q. Wu, J. Zhou, C. Yan, Metabolic transformation of breast cancer in a MCF-7 xenograft mouse model and inhibitory effect of volatile oil from Saussurea lappa Decne treatment, Metabolomics 11 (2015) 636–656. [16] H. Pyun, U. Kang, E.K. Seo, K. Lee, Dehydrocostus lactone, a sesquiterpene from Saussurea lappa Clarke, suppresses allergic airway inflammation by binding to dimerized translationally controlled tumor protein, Phytomedicine 43 (2018) 46–54, https://doi.org/10.1016/j.phymed.2018.03.045. [17] C.-Y. Wang, A.-C. Tsai, C.-Y. Peng, Y.-L. Chang, K.-H. Lee, C.-M. Teng, S.-L. Pan, Dehydrocostuslactone suppresses angiogenesis in vitro and in vivo through inhibition of Akt/GSK-3beta and mTOR signaling pathways, PLoS One 7 (2012) e31195, , https://doi.org/10.1371/journal.pone.0031195. [18] P.-L. Kuo, W.-C. Ni, E.-M. Tsai, Y.-L. Hsu, Dehydrocostuslactone disrupts signal transducers and activators of transcription 3 through up-regulation of suppressor of cytokine signaling in breast cancer cells, Mol. Cancer Ther. 8 (2009) 1328–1339, https://doi.org/10.1158/1535-7163.MCT-08-0914. [19] J. Xu, J.W. Tan, L. Huang, X.H. Gao, R. Laird, D. Liu, S. Wysocki, M.H. Zheng, Cloning, sequencing, and functional characterization of the rat homologue of receptor activator of NF-kappaB ligand, J. Bone Miner. Res. 15 (2000) 2178–2186, https://doi.org/10.1359/jbmr.2000.15.11.2178. [20] J. Cheng, L. Zhou, Q. Liu, J. Tickner, Z. Tan, X. Li, M. Liu, X. Lin, T. Wang, N.J. Pavlos, J. Zhao, J. Xu, Cyanidin Chloride inhibits ovariectomy-induced osteoporosis by suppressing RANKL-mediated osteoclastogenesis and associated signaling pathways, J. Cell Physiol. 233 (2018) 2502–2512, https://doi.org/10.1002/ jcp.26126. [21] M. Yoshikawa, S. Hatakeyama, Y. Inoue, J. Yamahara, Saussureamines A, B, C, D, and E, new anti-ulcer principles from Chinese Saussureae Radix, Chem. Pharm. Bull. (Tokyo) 41 (1993) 214–216. [22] M.M. Pandey, S. Rastogi, A.K.S. Rawat, Saussurea costus: botanical, chemical and pharmacological review of an ayurvedic medicinal plant, J. Ethnopharmacol. 110 (2007) 379–390, https://doi.org/10.1016/j.jep.2006.12.033. [23] S.G. Ko, H.-P. Kim, D.-H. Jin, H.-S. Bae, S.H. Kim, C.-H. Park, J.W. Lee, Saussurea lappa induces G2-growth arrest and apoptosis in AGS gastric cancer cells, Cancer Lett. 220 (2005) 11–19, https://doi.org/10.1016/j.canlet.2004.06.026. [24] H. Cai, X. Qin, C. Yang, Dehydrocostus lactone suppresses proliferation of human chronic myeloid leukemia cells through Bcr/Abl-JAK/STAT signaling pathways, J. Cell. Biochem. 118 (2017) 3381–3390, https://doi.org/10.1002/jcb.25994. [25] Y.-L. Hsu, L.-Y. Wu, P.-L. Kuo, Dehydrocostuslactone, a medicinal plant-derived sesquiterpene lactone, induces apoptosis coupled to endoplasmic reticulum stress in liver cancer cells, J. Pharmacol. Exp. Ther. 329 (2009) 808–819, https://doi.org/ 10.1124/jpet.108.148395. [26] R. Eastell, T.W. O’Neill, L.C. Hofbauer, B. Langdahl, I.R. Reid, D.T. Gold, S.R. Cummings, Postmenopausal osteoporosis, Nat. Rev. Dis. Prim. 2 (2016) 16069, https://doi.org/10.1038/nrdp.2016.69. [27] L. Zha, L. He, Y. Liang, H. Qin, B. Yu, L. Chang, L. Xue, TNF-alpha contributes to postmenopausal osteoporosis by synergistically promoting RANKL-induced osteoclast formation, Biomed. Pharmacother. 102 (2018) 369–374, https://doi.org/10.

289