ARE signal pathway

Brain Research Bulletin 153 (2019) 181–190

Contents lists available at ScienceDirect

Brain Research Bulletin journal homepage: www.elsevier.com/locate/brainresbull

Dehydroepiandrosterone alleviates oxidative stress and apoptosis in ironinduced epilepsy via activation of Nrf2/ARE signal pathway Chandra Prakasha, Monika Mishraa, Pavan Kumarb, Vikas Kumara, Deepak Sharmaa, a b

T

⁎

Neurobiology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi, 110067, India Department of Developmental Neurogenetics, Medical University of South Carolina, Charleston, SC, USA

A R T I C LE I N FO

A B S T R A C T

Keywords: Epilepsy Seizures Dehydroepiandrosterone Oxidative stress Apoptosis Antioxidant enzymes

Epilepsy is a neurological disorder characterized by the prevalence of spontaneous and recurrent seizures. Oxidative stress has been recognized as an intrinsic mechanism for the initiation and progression of epilepsy. In the present study, we investigated the neuroprotective effect of dehydroepiandrosterone (DHEA) against ironinduced epilepsy in rats. Animals were made epileptic by intracortical injection of FeCl3 (5 μl of 100 mM), and DHEA (30 mg/kg b. wt., for 7, 14, and 21 days) was administered intraperitoneally. The results showed electrophysiological alterations, excessive oxidative damage, diminished antioxidant defence and induction of apoptosis in the cortex and hippocampus of epileptic rats. Expression of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1) and NAD(P)H: quinone oxidoreductase-1 (NQO-1) was downregulated in both brain regions. While, DHEA treatment for 14 and 21 days has counteracted oxidative stress, reduced neuronal apoptosis and improved electrophysiological changes along with upregulation of Nrf2, HO-1, and NQO-1. In conclusion, our findings demonstrate that neuroprotective effect of DHEA against iron-induced epilepsy might be escorted by the alleviation of oxidative stress through Nrf2-mediated signal pathway.

1. Introduction Epilepsy is a severe neurological disorder, affecting more than 50 million people worldwide (Megiddo et al., 2016). The hallmark of epilepsy is the occurrence of spontaneous and recurrent seizures. The etiopathology of epilepsy is very complex and the molecular mechanism behind this is not clearly understood. Acquired epilepsies are the consequences of various types of neurological insults such as ischemic stroke, trauma, status epilepticus (SE) etc. (Allen and Bayraktutan, 2009; Rodriguez-Rodriguez et al., 2014; Puttachary et al., 2015). These injuries can increase oxidative stress and produce short and long-term biochemical changes in the brain, resulting in spontaneous recurrent seizures (Pearson-Smith and Patel, 2017). Oxidative stress triggers neuronal hyperexcitability and apoptosis by causing a variety of cellular alterations including oxidative damage to macromolecules (Méndez-Armenta et al., 2014). Recently, several human and animal studies have shown that oxidative stress is an underlying

mechanism for the initiation and progression of epilepsy (Shin et al., 2011; Sun et al., 2017; Liu et al., 2018). In addition, enhanced seizures activity can also contribute to the generation of reactive oxygen species (ROS) so the brain may be under immense oxidative stress (Puttachary et al., 2015). Iron-induced epilepsy in rat model represents the post-traumatic epilepsy (PTE) in human (Willmore et al., 1978). The model mimics release of iron by the breakdown of haemoglobin from blood, after head injury. Interaction between iron-neuronal tissues believes to produce ROS in brain and a single injection of FeCl3 into somatosensory cortex produces a chronic epileptogenic focus (Zou et al., 2017). This model has been widely used to investigate the mechanism of epileptogenesis and for therapeutic interventions. Previous studies have shown that intracortical iron injection causes epileptic seizures, behavioral alterations and neurological deficits in rats (Mishra et al., 2010; Das et al., 2017). The studies have also shown oxidative damage to lipids and proteins, reduced activities of antioxidant enzymes viz. catalase (CAT)

Abbreviations: ARE, antioxidant response element; BSA, bovine serum albumin; CAT, catalase; DHEA, dehydroepiandrosterone; DMSO, dimethylsulphoxide; DNPH, 2,4-dinitrophenylhydrazine; DTNB, 5,5-dithiobis-2-nitrobenzoic acid; EEG, electroencephalographic; GPx, glutathione peroxidase; GSH, glutathione; HO-1, heme oxygenase-1; LPO, lipid peroxidation; MUA, multiple unit activity; NQO-1, NADPH quinone oxidoreductase-1; Nrf2, nuclear factor erythroid 2-related factor 2; PC, protein carbonyls; PTE, post-traumatic epilepsy; ROS, reactive oxygen species; SOD, superoxide dismutase; TUNEL, terminal deoxynucleotidyl transferase; dUTP, nick end labeling ⁎ Corresponding author. E-mail address: [email protected] (D. Sharma). https://doi.org/10.1016/j.brainresbull.2019.08.019 Received 29 April 2019; Received in revised form 16 August 2019; Accepted 26 August 2019 Available online 28 August 2019 0361-9230/ © 2019 Elsevier Inc. All rights reserved.

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

Jawaharlal Nehru University, New Delhi.

and superoxide dismutase (SOD), and cytokines levels in iron-induced epilepsy (Mishra et al., 2010; Srivastava et al., 2019). Nuclear factor erythroid 2-related factor 2 (Nrf2) regulates the expression of an array of antioxidant enzymes by interacting with antioxidant response element (ARE). It has been reported that the Nrf2/ ARE signal pathway regulates the expression of more than 200 genes encoding cytoprotective enzymes such as heme oxygenase-1 (HO-1) and NAD(P)H: quinone oxidoreductase-1 (NQO-1) (Gao et al., 2014). A line of evidence suggests that Nrf2/ARE signal pathway is involved in the protection of brain tissue in various neurodegenerative diseases (Gao et al., 2014). Recently, the therapeutic potential of Nrf2 has been reported in experimental epilepsy. Studies demonstrated that Nrf2/ARE pathway protects brain damage in kindling (Wang et al., 2014), pentetrazol (Cheng et al., 2018), lithium-pilocarpine (Zhang et al., 2018; Dai et al., 2018; Kang et al., 2017) and kainate-induced (Liu et al., 2018) epilepsy models. However, to the best of our knowledge, regulation of the Nrf2/ARE signal pathway has not been studied in ironinduced epilepsy. Dehydroepiandrosterone (DHEA, 3-hydroxy-5-androstene-17-one) is an androgen hormone mainly synthesized in the adrenal cortex. It has been reported that DHEA is also synthesized de novo in the central nervous system (Baulieu, 1999; Rupprecht and Holsboer, 1999). A line of studies showed neuroprotective potential of DHEA in different pathological conditions like ischemia, traumatic brain injury, spinal cord injury, glutamate excitotoxicity, and neurodegenerative diseases (Arbo et al., 2018). DHEA treatment has shown to ameliorate oxidative stress, antioxidant defense, and apoptosis in the Alzheimer’s disease (Aly et al., 2011). Moreover, DHEA has protected dopaminergic neurons in mice model of Parkinson’s (D’Astous et al., 2003) and improved memory deficits, and neuronal cell death in ischemic mice (Yabuki et al., 2015). Previous research from our laboratory, have demonstrated that DHEA suppresses iron-induced epileptic seizures, ameliorates oxidative stress and upregulates glutamate transporters (Mishra et al., 2010, 2013). However, the effect of DHEA in iron-induced epilepsy with respect to the Nrf2/ARE signal pathway and apoptotic cell death is still warranted. Therefore, we investigated whether exogenous administration of DHEA alleviates Nrf2-mediated signaling and protects neurons from apoptotic death.

2.3. Experimental design The rats were randomly divided into five different groups: (1) Control: (n = 12) rats were given an intracortical injection of saline instead of iron. (2) Epileptic: (n = 12) rats were given an intracortical injection of FeCl3 to induce epilepsy (procedure described below). (3) Epileptic + 7 days DHEA: (n = 12) rats were given an intracortical injection of FeCl3 and received DHEA (i.p.) once a day for 7 days. (4) Epileptic + 14 days DHEA: (n = 12) rats were given an intracortical injection of FeCl3 and received DHEA once a day for 14 days. (5) Epileptic + 21 days DHEA: (n = 12) rats were given an intracortical injection of FeCl3 and received DHEA once a day for 21 days. The dose for DHEA administration was in accordance to previous studies of our laboratory (Mishra et al., 2010, 2013). DHEA was dissolved in 0.1% DMSO and administered after 20 days of FeCl3 injection at a dose of 30 mg/kg b. wt. per day. Literature suggests that neuroprotective effect of DHEA exerts longer than one year of its supplementation to humans (Evans et al., 2006) and 1 year of treatment period in human is approximately 13.7 days in rats (Agoston, 2017). Hence, we have selected the treatment period of 7, 14 and 21 days. 2.4. Induction of epilepsy and electrode implantation Epilepsy was induced by the intracortical injection of FeCl3 solution as described previously by Mishra et al. (2010). Briefly, rats were operated under 4% isoflurane anesthesia, and skull was exposed by removing skin and tissues. The burr holes of 0.5 mm diameter were drilled in the skull (one for saline/FeCl3 injection and four for electrode implantation). Then, 5 μl of saline/FeCl3 (100 mM FeCl3 in saline) was stereotaxically injected in the somatosensory cortex region (AP- 1, ML1, DV- 1.5 mm) of rats over 5 min (1 μl/min) using motorised injector. For electroencephalographic (EEG) and multiple unit activities (MUA) recordings from the cortex, stainless steel screws were placed (from bregma AP + 2 and −2, ML + 2 and −2, DV −1.5 mm) over the occipital and frontal cortices. For hippocampal recordings, intra-cerebral bipolar wire electrode was placed in the CA1 region (AP- 2.8, ML- 2.5 DV- 2.71 mm). One screw electrode was also placed over the frontal sinus to serve animal as ground. The free ends of these electrodes were soldered to a nine-pin connector, which was fixed to the skull with dental acrylic cement to make a robust platform.

2. Materials and methods 2.1. Materials Stainless-steel screw electrodes and wires used for electrophysiological recordings were tissue compatible and obtained from Plastic One, Roanoke, VA, USA. DHEA, FeCl3, dimethylsulphoxide (DMSO), bovine serum albumin (BSA), 2,4-dinitrophenylhydrazine (DNPH), 5,5-dithiobis-2-nitrobenzoic acid (DTNB), thiobarbituric acid (TBA), pyrogallol, nicotinamide adenine dinucleotide phosphate (NADPH) and 4′,6-diamidino-2-phenylindole (DAPI) were obtained from Sigma Aldrich, St. Louis, USA. Dibutylphthalate polystyrene xylene (DPX) was obtained from Fischer Scientific, Mumbai, India. All chemicals used were of analytical grade and glass redistilled water was used throughout the present investigations.

2.5. EEG and MUA recordings Five rats from each group were taken for epileptiform seizures activity analysis. Prior to recordings, all the experimental animals were made familiar with recording set up by habituating inside the recording chamber for 3 days. The cortical and hippocampal EEG (1 Hz to 100 Hz) and MUA (300 Hz to 10 kHz) recordings were performed simultaneously by routing the composite extracellular signals through a high impedance probe (Grass HIP 511 with FET). Both EEG and MAU signals were amplified, filtered (P511 AC preamplifiers), and digitized on PolyVIEW 16 Data Acquisition System (Grass Technologies, USA). MUA counts were collected after electrical discrimination by a window discriminator (WPI, Florida, USA). The MUA counts corresponding to EEG were used to quantify the epileptiform seizures activity.

2.2. Animals and their care A total of 60 adult male Wistar rats, obtained from Central Laboratory Animal Resources, Jawaharlal Nehru University, New Delhi, were housed in standard polypropylene cages (12″ × 9″ × 6″). The rats were given full access to food and water and kept in controlled environment (22–25 °C temperature and 50–55% relative humidity) under 12:12 h light/dark cycle. All animal procedures were carried out by following the guidelines of Committee for the Purpose of Control and Supervision of Experiments on Animals. The use of animals in current study was duly approved by the Animal Ethical Committee of

2.6. Preparation of tissue homogenate After the epileptiform activity analysis, rats (n = 5 in each group) were killed by cervical dislocation. The brains were quickly removed and placed on ice. The cortex and hippocampus were rapidly dissected out. The left and right hippocampi of one rat were pooled to make one tissue sample. For the biochemical analysis of oxidative stress markers and cellular antioxidants each sample was homogenized (10% w/v) 182

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

again incubated on ice for 10 min followed by centrifugation at 850 × g for 15 min on 4 °C. Next, supernatant (2.0 ml) was mixed with 0.4 M Tris-buffer, (4.0 ml, pH 8.9) and 0.01 M DTNB (0.1 ml). Finally, the absorbance was taken at 412 nm and the results were expressed as nmol GSH/mg protein by using the extinction coefficient (13.6 × 10−6 nM−1 cm−1).

with homogenizing medium (0.1 mM EDTA, 0.32 M sucrose, 10 mM Tris−HCl, pH 7.4) using a glass dounce homogenizer. The homogenate was centrifuged at 2500 × g for 10 min on 4 °C and supernatant was stored for biochemical analysis. Protein concentration in the supernatant was estimated by the method of Bradford (1976) using BSA as a standard. 2.7. Biochemical assays of oxidative stress markers

2.9. Tissue preparation for immunofluorescence and histopathology 2.7.1. Lipid peroxidation (LPO) assay The LPO was assayed as described previously by Soni et al. (2018). Briefly, tissue homogenate (0.5 ml) was mixed with 0.1 M Tris−HCl buffer (0.5 ml, pH 7.4) and incubated for 2 h. Then, 1.0 ml of TCA (10%, w/v) was added and centrifuged at 1200 × g for 10 min on 4 °C. Equal volume of TBA (0.67% w/v) was added to the 1.5 ml of supernatant and placed on boiling water for 10 min and cooled. The absorbance was recorded at 532 nm and results were expressed as nmol MDA/mg protein.

For immunofluorescence and histopathological examinations rats (n = 3 in each group) were deeply anesthetized followed by transcardial perfusion with 0.9% saline and 2% paraformaldehyde (PFA). The intact brains were removed from the perfused animals and postfixed in 2% PFA, for overnight. Subsequently, the brains were equilibrated in sucrose (10–30%, w/v) and then stored in 30% sucrose solution. The brain tissues were cut into 10 μm thick coronal sections using a cryotome (Leica CM 1860, Germany) and mounted on gelatin-coated slides for further analysis.

2.7.2. Protein carbonyls (PC) assay The PC was assayed in accordance to the method of Levine et al. (1994). Briefly, 10 mM DNPH (in 2.5 M HCl) was added to the homogenate followed by incubation in dark for 60 min. Then, 20% TCA (w/ v) was added and washed thrice with ethanol/ethyl acetate (1:1 v/v) mixture. Precipitated proteins were dissolved in 6 M guanidine−HCl followed by centrifugation at 11,000 × g for 3 min on 4 °C. Finally, absorbance was read at 370 nm and results were expressed as nmol carbonyls/mg protein using the molar extinction coefficient of DNPH (0.022 μM−1 cm−1).

2.10. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay The TUNEL assay was performed to detect the presence of apoptotic cells in different brain regions of rats. The assay was performed using In situ BrdU-Red DNA Fragmentation (TUNEL) Assay Kit (Abcam, Cambridge, UK) in accordance to the manufacturer’s procedure. The sections were counterstained with DAPI for 10 min and covered with Fluoromount™ Aqueous Mounting Medium (Sigma, St. Louis, USA). Finally, the TUNEL-positive cells were visualized under a fluorescence microscope (Nikon Eclipse 90i, Tokyo, Japan) and the images were captured. TUNEL-positive cells in five different images were counted by FIJI software (http://fiji.sc/Fiji). The percentage of TUNEL stained cells among total stained and unstained cells was considered the percent TUNEL-positive cells for each sample.

2.8. Assays of cellular antioxidants 2.8.1. SOD activity assay SOD activity was determined as per the procedure described by Marklund and Marklund (1974). The method is based on the competition between pyrogallol oxidation by superoxide radicals and superoxide dismutation by SOD. Briefly, 1.0 ml of 20 mM pyrogallol solution was mixed with 1.0 ml of tris-buffer (50 mM), then, 50 μl of tissues homogenate was added. The absorbance was recorded at 420 nm. The amount of enzyme required for 50% inhibition was considered as 1 U of SOD activity, and results were expressed as U/mg protein.

2.11. Immunofluorescence staining for activated caspase-3 We performed the immunofluorescence staining to check the activated caspase-3 expression level in rats. Tissue sections were treated with 5% Triton-X100 for 10 min followed by blocking in 3% normal goat serum (Abcam, Cambridge, UK) for 1 h. Subsequently, sections were incubated with rabbit polyclonal anti-activated caspase 3 (1:200, Abcam, Cambridge, UK) primary antibody, overnight at 4 °C. After the primary antibody incubation, sections were washed with PBS 3 times for 5 min each and then incubated with TRITC-conjugated secondary antibody (1:5000, Sigma, St. Louis, USA) at room temperature for 2 h. After 3 additional PBS washes, the sections were counterstained with DAPI for 10 min and covered with Fluoromount™ Aqueous Mounting Medium. Images were captured under a fluorescence microscope. Five images were sampled per animal and were analysed by FIJI software. The level of caspase 3 was determined by the formula: caspase-3 stained nuclei/total number of DAPI stained nuclei × 100.

2.8.2. CAT activity assay The enzymatic activity of CAT was assayed as previously described by Prakash et al. (2015). Briefly, 0.2 ml of tissue homogenate was mixed with 0.7 ml of phosphate buffer (50 mM, pH 7.4) containing 0.1 ml H2O2 (100 mM). The rate of H2O2 decomposition was measured by recording the absorbance at 240 nm. The results were expressed as μmol H2O2 oxidized/min/mg protein using molar extinction coefficient (43.1 × 10−9 nM−1 cm−1). 2.8.3. Glutathione peroxidase (GPx) activity assay The activity of GPx was assayed by following the method described by Athar and Iqbal (1998). Total 2.0 ml of reaction mixture containing sodium phosphate buffer (0.1 M, pH 7.4), 1 mM EDTA, 0.2 mM NADPH, 1 mM sodium azide, 1 U/ml glutathione reductase, 0.25 mM H2O2, and 0.2 ml of tissue homogenate was prepared. The change in absorbance was recorded at 340 nm and enzymes activity was calculated as μ mol glutathione (GSH) oxidized/min/mg protein using a molar extinction coefficient (6.22 × 103 M−1 cm−1).

2.12. Histopathological examinations Histopathological studies were carried out in the cortex and hippocampus of the rat brain using cresyl violet (CV) and hematoxylin and eosin (H&E) staining. The brain sections were air dried for a few min, stained with CV and H&E. Next, the sections were dehydrated through a graded series of alcohol and cleared by dipping in xyline twice for 5 min each. Finally, the sections were coverslipped with DPX mounting media and photographed under a light microscope (Motic Instruments Co. Ltd., Chengdu, China).

2.8.4. Total GSH estimation assay Total GSH content was estimated by the method of Ellman (1959). The assay was performed by mixing of tissue homogenate (0.2 ml) with 0.02 M EDTA (4.8 ml), followed by 10 min incubation in ice. After adding distilled water (4.0 ml) and 10% TCA (1.0 ml) mixture was 183

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

treatment for 14 and 21 days showed a significant decrease of LPO both in the cortex and hippocampus, while, 7 days DHEA treatment caused no significant change of LPO in both brain regions. Table 2 also demonstrated the effect of DHEA in the PC of epileptic rats. Similar to LPO, there was a remarkable increase of PC in cortical and hippocampal tissues of epileptic rats. DHEA injection for 14 and 21 days caused a significant decrease of PC as compared to epileptic rats. However, DHEA treatment for 7 days showed a significant decrease only in the hippocampal tissue.

2.13. RNA extraction and real time-PCR analysis Total RNA was extracted from the brain tissue of rats (n = 4 in each group) using Tri-Reagent (Sigma-Aldrich, St. Louis, USA). RNA was quantified in NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, USA) by measuring the absorbance at 260 and 280 nm. The absorbance at 260/280 of ≤1.8 was taken as an acceptable value. Extracted RNA was, then reverse transcribed in a total volume of 20 μl using RevertAid™ cDNA synthesis kit (Thermo Fisher Scientific, MA, USA) as per the manufacturer’s protocol. Quantitative RT-PCR analysis of Nrf2, HO-1 and NQO-1 was performed using Maxima SYBR Green qPCR Mater Mix (Thermo Fisher Scientific, MA, USA) and run on the Applied Biosystems 7500 Real-Time PCR (Applied Biosystems, Waltham, USA) with a program that consisted of denaturation at 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. After the last cycle, a melting curve was generated by heating at 95 °C for 1 min, 65 °C for 30 s and 95 °C for 30 s. All cDNA samples were run in triplicate and compared with a no-template control. The mRNA expression was normalized by GAPDH (housekeeping gene) using as an internal control. The fold change of gene expression was calculated using the 2−ΔΔCt method. Primers used for the RT-PCR analysis are given in Table 1.

3.3. Effects of DHEA on antioxidant enzymes and GSH content Cellular antioxidants are known to protect cells from ROS-mediated oxidative damage. Table 3 depicts the effect of DHEA treatment on enzymatic activities of SOD, CAT, and GPx, and GSH content in the cortical and hippocampal regions. The results showed significant decline in the activities of antioxidant enzymes and GSH content in epileptic rats with respect to control group. DHEA treatment for 14 and 21 days effectively enhanced the enzymatic activities of SOD, CAT, and GPx along with GSH content. However, 7 days DHEA treatment showed non-significant increases in the activities of antioxidant enzymes in both the regions, but GSH level was significantly increased only in the cortex.

2.14. Statistical analysis 3.4. Effects of DHEA on apoptotic cell death All the analyses were performed using SigmaStat 3.5 (Systat Software Inc., San Jose, CA, USA). The data were expressed as mean ± SD. Statistical analysis was carried out by one-way analysis of variance (ANOVA) followed by Holm-Sidak post hoc test.

The results shown in Fig. 2 depict the percentage of apoptotic cells in the cortical and hippocampal regions of rats. Photomicrographs demonstrated that the percentage of TUNEL-positive apoptotic cells was significantly increased in epileptic rats. While, rats administered with DHEA for 14 and 21 days were observed with significantly decreased number of apoptotic cells both in the cortex and hippocampus with respect to epileptic rats. While 7 days DHEA treatment have shown significant change in percentage of apoptotic cells in the cortex only.

3. Results 3.1. Effect of DHEA on epileptiform seizures activity We analyzed the effect of DHEA on seizures activity in the cortex and hippocampus of rats. Fig. 1A represents 20 s EEG traces; clearly demonstrating epileptiform electrographic events in the form of single spikes, polyspikes, and spike waves of high frequency and amplitude in epileptic rats. The discrete epileptiform episodes were spontaneous and recurrent. The increases in MUA counts are concurrent with EEG paroxysms. Our results showed concomitant increase in MUA count in epileptic rats reflecting quantitative extent of seizures activity (Fig. 1B). Epileptiform EEG events and MUA counts were reduced in DHEAtreated rats. The comparison of EEG seizure activity suggests that DHEA improves the epileptic seizures in rats. Moreover, significantly decreased MUA counts in DHEA-treated rats, indicates the quantitative extent of improved epileptiform seizures activity.

3.5. Effects of DHEA on the expression of activated caspase-3 The expression of activated caspase-3 in the cortex and hippocampus of rats was checked by immunofluorescence analysis. Photomicrographs reflecting the results of immunofluorescence studies are presented in Fig. 3. We observed significantly enhanced expression of caspase-3 both in cortical and hippocampal regions of epileptic rats. Exogenous administrations of DHEA for 14 and 21 days have significantly reduced the expression in both regions (cortex and hippocampus). However, there was a non-significant decrease of caspase 3 expression in 7 days DHEA-treated rats. 3.6. Effects of DHEA and on histopathology of brain

3.2. Effects of DHEA on oxidative stress markers As shown in Fig. 4A, CV stained photomicrographs demonstrated severe neuronal degeneration, as visible by pyknotic appearance and less visible cells in the cortex and hippocampus of epileptic rats. DHEA treatment for 7, 14 and 21 days have attenuated the decrease in the

The effect of DHEA treatment on LPO in the iron-induced epilepsy model is presented in Table 2. Results showed significant increases of LPO in epileptic rats as compared to controls. Contrary to this, DHEA Table 1 Details of primers used for real time-PCR analysis. Gene

Accession #

Product size

Direction

Sequence

GAPDH

NM_017008.4

191

Nrf2

NM_031789.2

198

HO-1

NM_012580.2

181

NQO-1

NM_017000.3

158

Forward Reverse Forward Reverse Forward Reverse Forward Reverse

AACGACCCCTTCATTGAC TCCACGACATACTCAGCAC GAGACGGCCATGACTGATTT CAGTGAGGGGATCGATGAGT GAAGAAGATTGCGCAGAAGG GAAGGCGGTCTTAGCCTCTT CCAATCAGCGCTTGACACTA ACCACCTCCCATCCTTTCTT

184

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

Fig. 1. EEG and MUA recordings of control, epileptic and DHEA-treated rats. (A) Representative EEG samples of 20 s duration from the cortex and hippocampus of rats, (B) MUA counts of 1 min duration from the cortex and hippocampus of rats. Data for MUA counts are expressed as mean ± SD (n = 5 in each group). ***p ≤ 0.001, significantly different from control group; ##p ≤ 0.01, ###p ≤ 0.001 significantly different from epileptic group. ANOVA F values for MUA counts: cortex 22.331; hippocampus 42.698.

plasticity might be important contributory factors (Pitkänen et al., 2009). In this study, we induced epilepsy in rats by intracortical injection of FeCl3. After iron injection, a spontaneously discharging epileptogenic focus develops, which spreads to the entire cerebral cortex and subcortical structures of the brain (Sharma et al., 2007). It has been reported that generalization of seizures activity recruits to subcortical structures including hippocampus (Bouilleret et al., 2000). Various in vitro and in vivo studies have suggested that DHEA exerts pharmacological properties including neuroprotection (Arbo et al., 2018). Our study indicates that DHEA treatment for 14 and 21 days attenuates epileptiform seizures activity as evident by diminished high amplitude and frequency abnormalities of EEG and appearance of polyspikes, spikes, and paroxysms of spike waves. Accordingly, the significant decrease of corresponding MUA counts indicated the quantitative extent of reduced epileptiform seizures activity by DHEA. Our results are in accordance with the previous studies (Mishra et al., 2010, 2013) where DHEA treatment has shown reduced epileptic events along with reduced MUA counts. Significant antiepileptic effects exert on 14 and 21 days of DHEA treatment might be because of accumulation of DHEA in the brain after long term exposure and is in agreement with previous studies (Mishra et al., 2010, 2013). In recent years, various studies have demonstrated the role of oxidative stress in the onset and progression of epilepsy including PTE (Hunt et al., 2013; Pauletti et al., 2017). We observed a significant increase of LPO and PC in the cortex and hippocampus of epileptic rats. Furthermore, inhibition of cytoprotective enzymes, viz., SOD, CAT, and GPx along with GSH content, suggests disruption of pro/antioxidant ratio. Exogenous administration of DHEA for 14 and 21 days significantly reduced the LPO and PC, aggrandized the SOD, CAT and GPx activities and GSH content. These results are in accordance with earlier findings demonstrating attenuation of oxidative stress and cellular antioxidant in different neuropathological conditions including epilepsy (Aly et al., 2011; Mishra et al., 2010; Aguiar et al., 2013). Thus, we can

number of viable cells of epileptic rats. Furthermore, H&E stained photomicrographs revealed irregular arrangement of neurons as characterized by a darkly stained nucleus and cytoplasm in both brain regions of epileptic rats. However, exogenous administration of DHEA for 7, 14, and 21 days attenuated the neuronal changes with respect to epileptic rats. Both CV and H&E staining showed that DHEA treatment for 14 and 21 days markedly protected and rescued the neurons in cortex and hippocampus regions, and exert comparatively less beneficial effect for 7 days treatment (Fig. 4B). 3.7. Effect of DHEA on the expression of Nrf2, HO-1 and NQO-1 We examined the effect of DHEA on expression for Nrf2, HO-1 and NQO-1 by RT-PCR analysis (Fig. 5). Our data revealed that iron-injected rats showed a significant decrease in Nrf2, HO-1 and NQO-1 expression both in the cortex and hippocampus regions. The expression was markedly countered by DHEA treatment. The results showed significantly increased expression of all these genes following 14 and 21 days DHEA treatment in the cortex, however, except for Nrf2; the increase was non-significant for 7 days DHEA administration. Similarly, in the hippocampus mRNA levels were significantly increased for 14 and 21 days DHEA treatments, except for NQO-1 in 14 days treatment. While, changes for all these genes were non-significant in the hippocampus of 7 days DHEA-treated rats. 4. Discussion At present, PTE estimates approximately 5% of all types of epilepsies and is a common cause of new-onset of epilepsy in young adults (Lamar et al., 2014) for which there are very few effective therapies. The mechanism for development of recurrent seizures following brain trauma is very complex, where cellular and molecular alterations such as oxidative damage, neuronal apoptosis, gliosis, axonal and dendritic 185

DHEA 21 days

4.22 ± 0.54 2.50 ± 0.21

6.54 ± 0.81* 4.37 ± 0.35***

6.05 ± 0.60 4.21 ± 0.48NS

5.82 ± 0.32 3.24 ± 0.25###

4.68 ± 0.85 2.75 ± 0.42###

#

3.82 ± 0.34 2.79 ± 0.24

186 2.52 ± 0.43*** 32.15 ± 6.06*** 0.66 ± 0.08*** 10.52 ± 2.53***

3.81 ± 0.25 52.05 ± 5.11

1.24 ± 0.07 28.55 ± 3.00

3.23 ± 0.40 39.98 ± 5.06# 0.98 ± 0.07### 22.56 ± 3.22###

2.57 ± 0.51 35.12 ± 7.000NS 0.75 ± 0.09NS 15.25 ± 2.40#

1.04 ± 0.08### 23.85 ± 2.88###

3.64 ± 0.57 47.80 ± 7.89##

##

DHEA 21 days

1.15 ± 0.06 23.65 ± 1.84

4.05 ± 0.31 48.23 ± 5.07

0.05 ± 0.09*** 10.50 ± 2.42***

2.52 ± 0.38*** 27.79 ± 6.12***

Epileptic

4.83 ± 0.59 3.17 ± 0.33##

##

DHEA 14 days

0.62 ± 0.06NS 13.25 ± 2.35NS

2.79 ± 0.52 32.08 ± 7.14NS

NS

DHEA 7 days

0.78 ± 0.06## 18.65 ± 1.58###

3.61 ± 0.42 37.04 ± 5.25#

##

DHEA 14 days

non-

0.93 ± 0.10### 19.52 ± 2.60###

3.77 ± 0.54### 45.54 ± 4.75###

DHEA 21 days

NS

4.20 ± 0.43### 3.04 ± 0.35###

DHEA 21 days

p ≤ 0.001 significantly different epileptic group;

###

5.08 ± 0.81 3.54 ± 0.45#

NS

DHEA 7 days

Values are expressed as mean ± S.D. (N = 5) in each group. ***p < 0.001 significantly different from control group; #p ≤ 0.05, ##p ≤ 0.01, ###p ≤ 0.001 significantly different epileptic group; NS non-significant difference. ANOVA F values for SOD: cortex 8.711; hippocampus 11.758, for CAT: cortex 9.020; hippocampus 11.750, for GPx: cortex 37.541; hippocampus 51.848, for GSH: cortex 32.746; hippocampus 28.767.

SOD (U/mg protein) CAT (μmol H2O2 decomposed /min/mg protein) GPx (μmol GSH oxidized/min/ mg protein) GSH content (nmol GSH/ mg protein)

#

DHEA 14 days

Control

NS

DHEA 7 days

Control

Epileptic

Hippocampus

p ≤ 0.01,

5.56 ± 0.52*** 4.21 ± 0.35***

Epileptic

##

Cortex

Table 3 Effect of DHEA administration on SOD, CAT and GPx activities, and total GSH content in cortex and hippocampus of epileptic rats.

Values are expressed as mean ± S.D. (N = 5) in each group. *p ≤ 0.05, ***p < 0.001 significantly different from control group; #p ≤ 0.05, significant difference. ANOVA F values for LPO: cortex 6.917; hippocampus 8.200, for PC: cortex 28.924; hippocampus 12.417.

LPO (nmol MDA/mg protein) PC (nmol carbonyls /mg protein)

#

DHEA 14 days

Control

NS

DHEA 7 days

Control

Epileptic

Hippocampus

Cortex

Table 2 Effect of DHEA administration on LPO and PC in cortex and hippocampus of epileptic rats.

C. Prakash, et al.

Brain Research Bulletin 153 (2019) 181–190

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

Fig. 2. TUNEL positive cells in the cortex and hippocampus regions of control, epileptic and DHEA-treated rats. (A) Representative photomicrographs showing TUNEL-stained neurons (green arrows). (B) Percentage of TUNEL-positive cells among the total number of nuclei. Data are expressed as mean ± SD (n = 3 in each group). ***p ≤ 0.001, significantly different from control group; #p ≤ 0.05, ##p ≤ 0.01, ###p ≤ 0.001 significantly different from epileptic group. ANOVA F values for TUNEL-positive cells: cortex 37.773; hippocampus 72.095.

Fig. 3. Immunofluorescence analysis of activated caspase-3 in the cortex and hippocampus regions of control, epileptic and DHEA-treated rats. (A) Representative photomicrographs showing activated caspase-3 expression (green arrows). (B) Percentage change in the expression level among the groups. Data are expressed as mean ± SD (n = 3 in each group). ***p ≤ 0.001, significantly different from control group; #p ≤ 0.05, ##p ≤ 0.01, ###p ≤ 0.001 significantly different from epileptic group. ANOVA F values for activated caspase 3: cortex 27.522; hippocampus 14.864. 187

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

Fig. 4. Histopathological examinations by CV and H&E in the cortex and hippocampus regions of control, epileptic and DHEA-treated rats. (A) Representative photomicrographs of CV stained brain sections showing viable neurons (green arrow) and pyknotic neuron (black arrows). (B) Representative photomicrographs of H &E stained brain sections showing eosnophilic neurons (blue arrows) and triangular-shaped neurons with the shrinkage of nucleus and cytoplasm (black arrows).

Fig. 5. The mRNA expression of (A) Nrf2, (B) HO-1 and (C) NQO-1 in the cortex and hippocampus regions of control, epileptic and DHEA-treated rats. Data are expressed as mean ± SD (n = 4 in each group). ***p ≤ 0.001, significantly different from control group; #p ≤ 0.05, ##p ≤ 0.01, ###p ≤ 0.001 significantly different from epileptic group. ANOVA F values for Nrf2: cortex 10.146; hippocampus 10.994, for HO-1: cortex 16.757; hippocampus 22.850, for NQO-1: cortex 18.993; hippocampus 12.577. 188

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

alleviates the oxidative stress in cortex and hippocampus of iron-injected epileptic rats. The study further indicates that DHEA reduces the apoptotic cell death by up-regulating the expression of Nrf2, HO-1 and NQO-1. Hence, the study advocates that DHEA might be a potential therapeutic candidate to alleviate neurodegeneration in PTE.

speculate that long term DHEA treatment improves epileptic seizures by contributing towards diminishing oxidative stress. Growing body of evidence suggests that excessive ROS production in brain can induce apoptotic cell death leading to neurodegeneration (Kim et al., 2015). Apoptosis is a complex process of cell death by which cells commit self-destruction (Méndez-Armenta et al., 2014). Caspases, the members of the endoproteases family, are important regulators of inflammation and apoptosis. The activation of caspase-3 by mitochondria-dependent (intrinsic) and independent (extrinsic) pathways is a hallmark of apoptotic cell death (McIlwain et al., 2013). In our study, TUNEL assay results indicate the activation of apoptosis in the cortical and hippocampal regions of epileptic rats. Furthermore, enhanced level of cleaved caspase 3 also validates the conjecture of apoptosis in epileptic rats. These results are in agreement with previous studies (Xie et al., 2014; Méndez-Armenta et al., 2014; Liu et al., 2017), and suggest marked increase of apoptotic cell death in epileptic rats. DHEA treatment for 14 and 21 days significantly reduced the number of apoptotic cells and activated caspase 3 level, clearly demonstrating that long term DHEA treatment exerts protection by reversing caspase-dependent programmed cell death in epilepsy. In the present study, increased cellular apoptosis was further correlated with histopathological changes. CV staining demonstrates decreased neuronal density and deteriorated nuclei in epileptic rats. However, DHEA treatments have increased the neuronal density along with improved morphological appearance in the cortex and hippocampus regions. In addition, H&E staining depicted similar morphological changes. Epileptic rats showed distinct neuropathological changes as depicted with a high number of eosinophilic and triangular-shaped neurons along with darkening, and shrinkage of nucleus and cytoplasm. DHEA-administrations have alleviated neuronal damage as evident from reduced number of eosinophilic and pyknotic neurons. RT-PCR results showed significant decrease in mRNA levels of Nrf2, HO-1 and NQO-1 in cortical and hippocampal regions of epileptic rats, indicating inactivation of Nrf2/ARE signal pathway. These results are in concordance with previous studies where expression of Nrf2 and AREencoded genes was downregulated in different epilepsy models (Liu et al., 2018; Zhang et al., 2018). The transcription factor Nrf2, is a key oxidative stress regulator (Gao et al., 2014). Under normal cellular conditions, Nrf2 remains attached with Keap1 and works as an intracellular redox sensor. In response to oxidative stress, Nrf2 detaches from keap1, migrates inside the nucleus, where it interacts with ARE and activate the expression of a set of genes including HO-1 and NQO-1 (Gao et al., 2014). Nrf2 knock out mice showed increased oxidative stress markers along with deficits in spatial learning and memory (Dinkova‐Kostova et al., 2018). Mazzuferi et al. (2013) observed markedly increased Nrf2 mRNA level in hippocampal tissues of epileptic human. Moreover, mRNA level of Nrf2 was progressively increased in SE mice, till 72 h, and then declined. Similar expression pattern was also observed for Nrf2-regulated genes, HO-1, NQO-1 and mGST (Mazzuferi et al., 2013). Further, our results demonstrated that DHEA administration for 14 and 21 days promotes expression of Nrf2, HO-1 and NQO-1, suggesting that long term DHEA treatment modulates Nrf2/ARE signal pathway. Earlier, a line of reports have demonstrated that antioxidative activity of DHEA might be due to the activation of Nrf2 signal pathway (Jeon et al., 2015; Vegliante et al., 2016). Therefore, our findings implied that oxidative stress-mediated apoptotic cell death in iron-induced epilepsy might have been suppressed by DHEA through activation of Nrf2/ARE signal pathway. Earlier, overexpression of Nrf2 in animal models of Alzheimer’s, Parkinson’s and Amyotropic Lateral Sclerosis has been shown to present the neuroprotective effects (Chen et al., 2009; Vargas et al., 2008). Beside this, mice injected with virus-mediated Nrf2 transgene displayed reduction of generalized seizures and protected hippocampal neurons and ascrocytes (Mazzuferi et al., 2013). In conclusion, the outcome of present study demonstrates that long term DHEA treatment reduces the epileptic seizures activity, and

Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgements This study was supported by Department of Biotechnology, New Delhi. Authors also acknowledge Indian Council of Medical Research, New Delhi and Department of Science and Technology, New Delhi (DST-PURSE grant) for providing financial assistance. References Agoston, D.V., 2017. How to translate time? The temporal aspect of human and rodent biology. Front. Neurol. 8, 92. https://doi.org/10.3389/fneur.2017.00092. Aguiar, C.C., Almeida, A.B., Araújo, P.V., Vasconcelos, G.S., Chaves, E.M., do Vale, O.C., Macêdo, D.S., Leal, L.K., de Barros Viana, G.S., Vasconcelos, S.M., 2013. Effects of agomelatine on oxidative stress in the brain of mice after chemically induced seizures. Cell. Mol. Neurobiol. 33, 825–835. https://doi.org/10.1007/s10571-0139949-0. Allen, C.L., Bayraktutan, U., 2009. Oxidative stress and its role in the pathogenesis of ischaemic stroke. Int. J. Stroke 4, 461–470. https://doi.org/10.1111/j.1747-4949. 2009.00387.x. Aly, H.F., Metwally, F.M., Ahmed, H.H., 2011. Neuroprotective effects of dehydroepiandrosterone (DHEA) in rat model of Alzheimer’s disease. Acta Biochim. Pol. 58, 513–520. Arbo, B.D., Ribeiro, F.S., Ribeiro, M.F., 2018. Astrocyte neuroprotection and dehydroepiandrosterone. In: Litwack, G. (Ed.), Vitamins and Hormones. Elsevier Inc., Amsterdam, Netherlands, pp. 175–203. https://doi.org/10.1016/bs.vh.2018.01.004. Athar, M.O., Iqbal, M.O., 1998. Ferric nitrilotriacetate promotes N-diethylnitrosamineinduced renal tumorigenesis in the rat: implications for the involvement of oxidative stress. Carcinogenesis 19, 1133–1139. https://doi.org/10.1093/carcin/19.6.1133. Baulieu, E.E., 1999. Neuroactive neurosteroids: dehydroepiandrosterone and dehydroepiandrosterone sulfate. Acta Paediatr. 433, S78–80. https://doi.org/10.1111/j. 1651-2227.1999.tb14408.x. Bouilleret, V., Boyet, S., Marescaux, C., Nehlig, A., 2000. Mapping of the progressive metabolic changes occurring during the development of hippocampal sclerosis in a model of mesial temporal lobe epilepsy. Brain Res. 852, 255–262. https://doi.org/10. 1016/S0006-8993(99)02092-2. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. https://doi.org/10.1016/0003-2697(76)90527-3. Chen, P.C., Vargas, M.R., Pani, A.K., Smeyne, R.J., Johnson, D.A., Kan, Y.W., Johnson, J.A., 2009. Nrf2-mediated neuroprotection in the MPTP mouse model of Parkinson’s disease: critical role for the astrocyte. Proc. Natl. Acad. Sci. U. S. A. 106, 2933–2938. https://doi.org/10.1073/pnas.0813361106. Cheng, Y., Luo, F., Zhang, Q., Sang, Y., Chen, X., Zhang, L., Liu, Y., Li, X., Li, J., Ding, H., et al., 2018. α-Lipoic acid alleviates pentetrazol-induced neurological deficits and behavioral dysfunction in rats with seizures via an Nrf2 pathway. RSC Adv. 8, 4084–4092. https://doi.org/10.1039/C7RA11491E. Dai, H., Wang, P., Mao, H., Mao, X., Tan, S., Chen, Z., 2018. Dynorphin activation of kappa opioid receptor protects against epilepsy and seizure-induced brain injury via PI3K/Akt/Nrf2/HO-1 pathway. Cell Cycle 18, 226–237. https://doi.org/10.1080/ 15384101.2018.1562286. Das, J., Singh, R., Sharma, D., 2017. Antiepileptic effect of fisetin in iron-induced experimental model of traumatic epilepsy in rats in the light of electrophysiological, biochemical, and behavioral observations. Nutr. Neurosci. 20, 255–264. https://doi. org/10.1080/1028415X.2016.1183342. D’Astous, M., Morissette, M., Tanguay, B., Callier, S., Di Paolo, T., 2003. Dehydroepiandrosterone (DHEA) such as 17β‐estradiol prevents MPTP‐induced dopamine depletion in mice. Synapse 47, 10–14. https://doi.org/10.1002/syn.10145. Dinkova‐Kostova, A.T., Kostov, R.V., Kazantsev, A.G., 2018. The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J. 285, 3576–3590. https://doi.org/ 10.1111/febs.14379. Ellman, G.L., 1959. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82, 70–77. https:// doi.org/10.1016/0003-9861(59)90090-6. Evans, J.G., Malouf, R., Huppert, F.A., Van Niekerk, J.K., 2006. Dehydroepiandrosterone (DHEA) supplementation for cognitive function in healthy elderly people. Cochrane Database Syst. Rev., CD006221. https://doi.org/10.1002/14651858.CD006221. Gao, B., Doan, A., Hybertson, B.M., 2014. The clinical potential of influencing Nrf2 signaling in degenerative and immunological disorders. Clin. Pharmacol. 6, 19–34. https://doi.org/10.2147/CPAA.S35078. Hunt III, R.F., Boychuk, J.A., Smith, B.N., 2013. Neural circuit mechanisms of posttraumatic epilepsy. Front. Cell. Neurosci. 7, 89. https://doi.org/10.3389/fncel.2013.

189

Brain Research Bulletin 153 (2019) 181–190

C. Prakash, et al.

Environ. Chem. 97, 1408–1421. https://doi.org/10.1080/02772248.2015.1102425. Puttachary, S., Sharma, S., Stark, S., Thippeswamy, T., 2015. Seizure-induced oxidative stress in temporal lobe epilepsy. Biomed Res. Int. 2015, 745613. https://doi.org/10. 1155/2015/745613. Rodriguez-Rodriguez, A., Jose, Egea-Guerrero J., Murillo-Cabezas, F., Carrillo-Vico, A., 2014. Oxidative stress in traumatic brain injury. Curr. Med. Chem. 21, 1201–1211. https://doi.org/10.2174/0929867321666131217153310. Rupprecht, R., Holsboer, F., 1999. Neuroactive steroids: mechanisms of action and neuropsychopharmacological perspectives. Trends Neurosci. 22, 410–416. https://doi. org/10.1016/S0166-2236(99)01399-5. Sharma, V., Babu, P.P., Singh, A., Singh, S., Singh, R., 2007. Iron-induced experimental cortical seizures: electroencephalographic mapping of seizure spread in the subcortical brain areas. Seizure 16, 680–690. https://doi.org/10.1016/j.seizure.2007. 05.012. Shin, E.J., Jeong, J.H., Chung, Y.H., Kim, W.K., Ko, K.H., Bach, J.H., Hong, J.S., Yoneda, Y., Kim, H.C., 2011. Role of oxidative stress in epileptic seizures. Neurochem. Int. 59, 122–137. https://doi.org/10.1016/j.neuint.2011.03.025. Soni, M., Prakash, C., Dabur, R., Kumar, V., 2018. Protective effect of hydroxytyrosol against oxidative stress mediated by arsenic-induced neurotoxicity in rats. Appl. Biochem. Biotechnol. 186, 27–39. https://doi.org/10.1007/s12010-018-2723-5. Srivastava, N.K., Mukherjee, S., Sharma, R., Das, J., Sharma, R., Kumar, V., Sinha, N., Sharma, D., 2019. Altered lipid metabolism in post-traumatic epileptic rat model: one proposed pathway. Mol. Biol. Rep. 46, 1757–1773. https://doi.org/10.1007/s11033019-04626-9. Sun, J., Gao, X., Meng, D., Xu, Y., Wang, X., Gu, X., Guo, M., Shao, X., Yan, H., Jiang, C., et al., 2017. Antagomirs targeting miroRNA-134 attenuates epilepsy in rats through regulation of oxidative stress, mitochondrial functions and autophagy. Front. Pharmacol. 8, 524. https://doi.org/10.3389/fphar.2017.00524. Vargas, M.R., Johnson, D.A., Sirkis, D.W., Messing, A., Johnson, J.A., 2008. Nrf2 activation in astrocytes protects against neurodegeneration in mouse models of familial amyotrophic lateral sclerosis. J. Neurosci. 28, 13574–13581. https://doi.org/10. 1523/JNEUROSCI.4099-08.2008. Vegliante, R., Desideri, E., Di Leo, L., Ciriolo, M.R., 2016. Dehydroepiandrosterone triggers autophagic cell death in human hepatoma cell line HepG2 via JNK-mediated p62/SQSTM1 expression. Carcinogenesis 37, 233–244. https://doi.org/10.1093/ carcin/bgw003. Wang, W., Wu, Y., Zhang, G., Fang, H., Wang, H., Zang, H., Xie, T., Wang, W., 2014. Activation of Nrf2-ARE signal pathway protects the brain from damage induced by epileptic seizure. Brain Res. 1544, 54–61. https://doi.org/10.1016/j.brainres.2013. 12.004. Willmore, L.J., Sypert, G.W., Munson, J.B., 1978. Recurrent seizures induced by cortical iron injection: a model of posttraumatic epilepsy. Ann. Neurol. 4, 329–336. https:// doi.org/10.1002/ana.410040408. Xie, N., Wang, C., Lian, Y., Wu, C., Zhang, H., Zhang, Q., 2014. Puerarin protects hippocampal neurons against cell death in pilocarpine-induced seizures through antioxidant and anti-apoptotic mechanisms. Cell. Mol. Neurobiol. 34, 1175–1182. https://doi.org/10.1007/s10571-014-0093-2. Yabuki, Y., Shinoda, Y., Izumi, H., Ikuno, T., Shioda, N., Fukunag, K., 2015. Dehydroepiandrosterone administration improves memory deficits following transient brain ischemia through sigma-1 receptor stimulation. Brain Res. 1622, 102–113. https://doi.org/10.1016/j.brainres.2015.05.006. Zhang, Y.N., Dong, H.T., Yang, F.B., Wang, Z.Q., Ma, Z.H., Ma, S.Z., Ma, X.D., Duan, L., 2018. Nrf2-ARE signaling pathway regulates the expressions of A1R and ENT1 in the brain of epileptic rats. Eur. Rev. Med. Pharmacol. Sci. 22, 6896–6904. https://doi. org/10.26355/eurrev_201810_16159. Zou, X., Jiang, S., Wu, Z., Shi, Y., Cai, S., Zhu, R., Chen, L., 2017. Effectiveness of deferoxamine on ferric chloride-induced epilepsy in rats. Brain Res. 1658, 25–30. https://doi.org/10.1016/j.brainres.2017.01.001.

00089. Jeon, S., Hur, J., Kim, J., 2015. DHEA Alleviates oxidative stress of muscle cells via activation of Nrf2 pathway. Appl. Biochem. Biotechnol. 176, 22–32. https://doi.org/10. 1007/s12010-015-1500-y. Kang, Y., Yan, W., Fang, H., Zhang, G., Du, Y., Wang, L., Cui, H., Shi, G., 2017. Alleviation of oxidative damage and involvement of Nrf2-ARE pathway in mesodopaminergic system and hippocampus of status epilepticus rats pretreated by intranasal pentoxifylline. Oxid. Med. Cell. Longev. 2017, 7908072. https://doi.org/10.1155/2017/ 7908072. Kim, G.H., Kim, J.E., Rhie, S.J., Yoon, S., 2015. The role of oxidative stress in neurodegenerative diseases. Exp. Neurobiol. 24, 325–340. https://doi.org/10.5607/en.2015. 24.4.325. Lamar, C.D., Hurley, R.A., Rowland, J.A., Taber, K.H., 2014. Post-traumatic epilepsy: review of risks, pathophysiology, and potential biomarkers. J. Neuropsychiatry Clin. Neurosci. 26, iv-113. https://doi.org/10.1176/appi.neuropsych.260201. Levine, R.L., 1994. Carbonyl assay for determination of oxidatively modified proteins. Methods Enzymol. 233, 346–357. https://doi.org/10.1016/S0076-6879(94)33040-9. Liu, G., Wang, J., Deng, X.H., Ma, P.S., Li, F.M., Peng, X.D., Niu, Y., Sun, T., Li, Y.X., Yu, J.Q., 2017. The anticonvulsant and neuroprotective effects of oxysophocarpine on pilocarpine-induced convulsions in adult male mice. Cell. Mol. Neurobiol. 37, 339–349. https://doi.org/10.1007/s10571-016-0411-y. Liu, Z., Yang, C., Meng, X., Li, Z., Lv, C., Cao, P., 2018. Neuroprotection of edaravone on the hippocampus of kainate-induced epilepsy rats through Nrf2/HO-1 pathway. Neurochem. Int. 112, 159–165. https://doi.org/10.1016/j.neuint.2017.07.001. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. https://doi.org/10.1111/j.1432-1033.1974.tb03714.x. Mazzuferi, M., Kumar, G., van, Eyll, J., Danis, B., Foerch, P., Kaminski, R.M., 2013. Nrf2 defense pathway: experimental evidence for its protective role in epilepsy. Ann. Neurol. 74, 560–568. https://doi.org/10.1002/ana.23940. McIlwain, D.R., Berger, T., Mak, T.W., 2013. Caspase functions in cell death and disease. Cold Spring Harb. Perspect. Biol. 5, a008656 https://dx.doi.org/ 10.1101%2Fcshperspect.a026716. Megiddo, I., Colson, A., Chisholm, D., Dua, T., Nandi, A., Laxminarayan, R., 2016. Health and economic benefits of public financing of epilepsy treatment in India: an agent‐based simulation model. Epilepsia 57, 464–474. https://doi.org/10.1111/epi.13294. Méndez-Armenta, M., Nava-Ruíz, C., Juárez-Rebollar, D., Rodríguez-Martínez, E., Yescas Gómez, P., 2014. Oxidative stress associated with neuronal apoptosis in experimental models of epilepsy. Oxid. Med. Cell. Longev., 293689. https://doi.org/10.1155/ 2014/293689. 2014. Mishra, M., Singh, R., Sharma, D., 2010. Antiepileptic action of exogenous dehydroepiandrosterone in iron-induced epilepsy in rat brain. Epil. Behav. 19, 264–271. https://doi.org/10.1016/j.yebeh.2010.06.048. Mishra, M., Singh, R., Mukherjee, S., Sharma, D., 2013. Dehydroepiandrosterone’s antiepileptic action in FeCl3-induced epileptogenesis involves upregulation of glutamate transporters. Epilepsy Res. 106, 83–91. https://doi.org/10.1016/j.eplepsyres.2013. 06.008. Pauletti, A., Terrone, G., Shekh-Ahmad, T., Salamone, A., Ravizza, T., Rizzi, M., Pastore, A., Pascente, R., Liang, L.P., Villa, B.R., et al., 2017. Targeting oxidative stress improves disease outcomes in a rat model of acquired epilepsy. Brain 140, 1885–1899 https://dx.doi.org/10.1093%2Fbrain%2Fawx117. Pearson-Smith, J., Patel, M., 2017. Metabolic dysfunction and oxidative stress in epilepsy. Int. J. Mol. Sci. 18, E2365. https://doi.org/10.3390/ijms18112365. Pitkänen, A., Immonen, R.J., Gröhn, O.H., Kharatishvili, I., 2009. From traumatic brain injury to posttraumatic epilepsy: what animal models tell us about the process and treatment options. Epilepsia 50, 21–29. https://doi.org/10.1111/j.1528-1167.2008. 02007.x. Prakash, C., Kamboj, V.K., Ahlawat, P., Kumar, V., 2015. Structural and molecular alterations in arsenic-induced hepatic oxidative stress in rats: a FTIR study. Toxicol.

190