- Email: [email protected]
Delayed elimination of paternal mtDNA in the interspecific hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli during early embryogenesis
Gene 704 (2019) 1–7
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Delayed elimination of paternal mtDNA in the interspecific hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli during early embryogenesis Zhenzhen Chu1, Wenjie Guo1, Weihua Hu, Jie Mei
T
⁎
College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Yellow catfish (Pelteobagrus fulvidraco) Darkbarbel catfish (Pelteobagrus vachelli) Hybrid yellow catfish Paternal mtDNA elimination Embryonic malformation
Mitochondrial homoplasmy is essential for normal development, as its heteroplasmy usually leads to abnormal or diseased phenotypes in mammals. So far, diverse mechanisms have been proposed to play roles in ensuring uniparental inheritance of mitochondria in many organisms. In recent years, hybrid yellow catfish from mating female yellow catfish (Pelteobagrus fulvidraco) with male darkbarbel catfish (Pelteobagrus vachelli) has been widely cultured in China due to its fast-growing. However, a high rate of abnormal and defective embryos was observed in the offsprings of hybrid yellow catfish. In this study, we systematically investigated the elimination process of paternal mitochondrial DNA (mtDNA) in yellow catfish and hybrid yellow catfish. The mtDNA contents significantly decreased in the isolated mature sperm compared with the semen. Different from the elimination of paternal mtDNA after fertilization in yellow catfish, paternal mtDNA was retained in the developmental embryos of hybrid yellow catfish as later as gastrula stage, indicating a delay of elimination for paternal mtDNA and mitochondrial heteroplasmy during embryogenesis in hybrid yellow catfish. Altogether, the present study suggests that mitochondrial heteroplasmy may affect embryonic development of hybrid progeny between catfish species.
1. Introduction Mitochondrion (MT) is a membraned-enclosed organelle present in the cytoplasm of all eukaryotic cells (Kaneda et al., 1995; Won et al., 2013). It is considered as the powerhouses to produce the majority of energy (ATP) for cellular and organismal metabolism through oxidative phosphorylation (Pfeiffer et al., 2001; Tsai et al., 2016). Besides this function, MT is also involved in various biological processes, such as the induction of apoptosis (Panaretakis et al., 2001), innate immunity (Arnoult et al., 2011), and generation of reactive oxygen species (ROS) by respiration (Nohl et al., 2003). As in chloroplasts, another organelles in plant cells, MT also carries its own genomic DNA (Allen, 2003), namely mitochondrial DNA (mtDNA), which maintains multiple copies per cell and is subject to dynamic regulation of their copy number in terms of tissue type. In almost all animal species, mtDNA is a doublestranded circular molecule, and contains a D-loop region and 37 genes including 2 ribosomal RNAs, 22 transfer RNAs, and 13 protein-coding
genes (Zhou et al., 2008; Zhu and Yue, 2008). Unlike the nuclear genome, mtDNA does not follow Mendelian Laws, but is inherited uniparentally from the maternal parent in the great majority of animals (Birky, 2001). Although the maternal inheritance has been universally acceptable, the underlying mechanism is still largely unknown. A possible rational explanation is that sperm mtDNA is more susceptible to oxidative damage than maternal mtDNA during the process of spermatogenesis and fertilization, since mutations were accumulated in the paternal mtDNA (Cummins et al., 1994; Cummins, 1998). Therefore, uniparental inheritance may be a protection strategy to prevent the spread of potentially deleterious mtDNA in the whole population (Sato and Sato, 2013). In recent decades, several potential mechanisms have been put forth for uniparental inheritance of mtDNA, such as the decrease of mtDNA content during spermatogenesis (Nishimura et al., 2006), elimination of mtDNA from mature sperm (DeLuca and O'Farrell, 2012), prevention of the entry of sperm mtDNA into oocyte cytoplasm (Pickworth and Chang, 1969;
Abbreviations: bp, base pair; SD, standard deviation; MT, mitochondrion; ATP, adenosine-triphosphate; ROS, reactive oxygen species; mtDNA, mitochondrial DNA; P. fulvidraco, Pelteobagrus fulvidraco; P. vachelli, Pelteobagrus vachelli; KRB-Hepes, Krebs Ringer bicarbonate medium buffered with Hepes; Long-PCR, the longpolymerase chain reaction; MUI, mitochondria uniparental inheritance; PF, yellow catfish; PV, darkbarbel catfish; PF-PV, hybrid yellow catfish; NF, Normal fish; MF, Malformed fish ⁎ Corresponding author. E-mail address: [email protected] (J. Mei). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.gene.2019.04.022 Received 30 November 2018; Received in revised form 14 March 2019; Accepted 5 April 2019 Available online 07 April 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 704 (2019) 1–7
Z. Chu, et al.
2.3. Preparation of semen and isolation of mature sperm
Yanagimachi et al., 1983), restriction of sperm mtDNA to a region of the embryo (Luo and Sun, 2013), dilution or active degradation of paternal mitochondria in the zygote, through ubiquitin- and lysosomemediated degradation events (Sato and Sato, 2013). Recently, exceptional cases of biparental inheritance of mtDNA were detected in some animals, such as human (Homo sapiens) (Luo et al., 2018) and fruit fly (Drosophila simulans) (Wolff et al., 2013). Meanwhile, comparative analyses have also been carried out between offspring from interspecific hybrid and intraspecific hybrid. In intraspecific hybrids of Mus musculus, paternal mtDNA was detected only through the early pronucleus stage, while in interspecific hybrids between M. musculus and Mus spretus, paternal mtDNA was detected throughout development from pronucleus stage to neonates (Kaneda et al., 1995). Similar result was also detected in a bovine interspecies cross between the domestic cow and the Asian wild gaur, sperm mitochondria from wild gaurs exhibited late elimination beyond the third embryonic division (Sutovsky et al., 2000). These results indicated that paternal mtDNA could be not efficiently eliminated in interspecies hybrids, implying a species-specific mechanism for the recognition of paternal mitochondria (Sutovsky et al., 1999). Yellow catfish (Pelteobagrus fulvidraco) is a teleost fish belonging to the order Siluriformes (Pan et al., 2008). Due to flesh quality, few intermuscle bones, as well as high commercial value, it has become an important economic fish in China (Zhang et al., 2014; Mei and Gui, 2015). All-male yellow catfish has been successfully produced by sex-control method based on its sex-determining type and mechanism, since males exhibit much faster growth rate than females (Li and Gui, 2018). In recent years, hybrid yellow catfish from mating female P. fulvidraco with male darkbarbel catfish (Pelteobagrus vachelli) has been widely cultured due to its fast-growing. However, the offsprings of hybrid yellow catfish have a high rate of abnormal and defective embryos than the offsprings of P. fulvidraco, which directly increases the cost of artificial reproduction. Previous studies have indicated that the occurrence of abnormal or diseased phenotypes during embryogenesis was relevant to the failure of elimination of paternal mtDNA (St John et al., 2000; Hua et al., 2012). In our study, we attempted to investigate whether paternal mitochondria were not efficiently eliminated in hybrid yellow catfish when compared to P. fulvidraco, which may be a factor for a high malformation rate in hybrid yellow catfish.
The mature sperms of P. fulvidraco and P. vachelli were separated by centrifugation on discontinuous Percoll gradient as described previously (Furimsky et al., 2005; Luo et al., 2013). In brief, testes of eight P. fulvidraco and eight P. vachelli were respectively removed by dissection with the aid of scissors, cleared of the adherent connective tissue, and then placed into a mortar. Fresh semen samples were obtained by cutting testis and kept in the KRB-Hepes (Krebs Ringer bicarbonate medium buffered with Hepes) for 30 min. Then, the modified sperm was put onto discontinuous two-layer density gradients of percoll solution (45% and 90% percoll in KRB-Hepes). The gradient was centrifuged at 650g for 30 min. Then, the 90% percoll solution and equal volumes of 0.9% physiological saline solution were added into individual centrifugation tube, and the tube was centrifuged at 430g for 10 min to allow motile sperm to sediment as a pellet. Finally, after carefully removing the percoll solution, the sperm sediment was resuspended by using 0.9% physiological saline solution and centrifuged at 430g for 10 min once. The whole process of Percoll gradient was carried out at 25 °C. The semen and mature sperm were dealt with osmotic shock (200 μL 50 mM Tris-HCl, pH 6.8) at 8 °C for 20 min to avoid the contamination of other cells and then centrifuged at 1000g for 5 min. 2.4. Real-time PCR-based absolute quantification To determinate the changes of mtDNA copies during sperm maturation in yellow catfish and darkbarbel catfish, the nd4 and β-actin were used as reference genes to perform the absolute quantitative realtime PCR assay. The PCR products (primers in Table 1) were inserted into PMD18-T vector (TaKaRa) to construct plasmids as described previously (Chen et al., 2004). The recombinant plasmids were purified with an EZNA™ Plasmid Mini Kit I (100) after sequenced for confirmation and then detected their quality and quantity by NanoDrop 2000 (Thermo Scientific, USA). For all real-time PCR assays, the standard IQTM SYBR Green Supermix Kit (Bio-Rad Laboratories, Hercules, CA, USA) was used in 20 μL reactions, which were run with the following program parameters: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 20 s, 72 °C for 15 s. And the real-time PCR system was performed in triplicate on Bio-Rad CFX96™ (Bio-Rad, Hercules, CA, USA). For each run, a standard curve was generated using five 10-fold serial dilutions (104–108copies) of the external standard. The starting copy number of mtDNA was obtained on the curve. All samples were tested thrice. Meanwhile, we quantified the starting copy number of β-actin gene by the same method to determine the number of sperms in each sample. And the calculation of mtDNA/β-actin ratio was the starting copy number of mtDNA per sperm.
2. Materials and methods 2.1. Ethics statement The present experiments were approved by the institution animal care and use committee of Huazhong Agriculture University.
2.2. Sample preparation and genomic DNA extraction 2.5. Long PCR, mitochondrial DNA sequencing, and genome-wide mitochondrial heteroplasmy in experimental parents
Yellow catfish and hybrid yellow catfish were obtained using artificial insemination from our fish breeding center of Huazhong Agricultural University, China (Fig. S1), and about 1500 embryos were obtained in each group. Embryos were placed in Petri dishes and collected at different stages (20 embryos pooled for each stage). Fresh organs of adult hybrid yellow catfish were also sampled. All the samples were stored at −20 °C before DNA extraction. The genomic DNA was extracted from semen and mature sperms, the caudal fin of each parent, 20 pooled embryos at each stage, and tissue samples by using the traditional phenol-chloroform method as described previously (Zhang et al., 2014). Following isolation, the quantity and quality of DNA was assessed using NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA). Finally, DNA was adjusted to approximately 50 ng/μL with sterile water and stored at −20 °C until used.
The complete mitochondrial genomes of experimental parents were amplified using the long-polymerase chain reaction (long-PCR) technique with two universal primer sets (Table 2) that were always used in vertebrates. PCR reactions were performed as previously described Table 1 The primers for the absolute quantitative real-time PCR.
2
Primers
Sequences (5′-3′)
β-Actin-F β-Actin-R nd4-F nd4-R
CCGTGACATCAAGGAGAAGC TCGGGACACCTGAACCTCT CTTGGTAGCAGGAGGCATTT TGGTTCGGCTGTGGGTT
Size of the products (bp) 150 140
Gene 704 (2019) 1–7
Z. Chu, et al.
Beijing), which include parents, embryos of zygote and 2-cell stage in yellow catfish and the parents, embryos at each stage and organs of hybrid yellow catfish.
Table 2 The primers used to amplify long PCR. Primers
Sequences (5′-3′)
Size of the products (bp)
Genome-1-F Genome-1-R Genome-2-F Genome-2-R
GGTCTTAGGAACCAAAAACTCTTGGTGCAA TGCACCATTAGGATGTCCTGATCCAACATC GATGTTGGATCAGGACATCCTAATGGTGCA TTGCACCAAGAGTTTTTGGTTCCTAAGACC
2.7. Statistical analysis 7178
The analytical method was performed as previously described (Zhang et al., 2018). Data are shown as mean ± SD, and the differences between groups were analyzed using a Student's t-test. Statistical significance was represented by the asterisk (* P < 0.05, ** P < 0.01, *** P < 0.001).
9409
(Kim et al., 2004), and the products were purified with QIAquick PCR Purification Kit (Qiagen). The purified products were then subcloned into pCR2.1 vector (Invitrogen, USA) and sequenced with commercial primers and nested flanking sequencing primers. The whole mtDNA sequences were assembled with Contig Express (Informax Inc., Oxford, United Kingdom), and SNPs between experimental parents were detected by multiple alignment program CLUSTAL W using MEGA6 software (Tamura et al., 2013). The whole mitochondrial genome sequences determined in this study have been deposited in GenBank with the following accession numbers: MK104134 (female yellow catfish 1), MK104135 (male yellow catfish), MK104136 (female yellow catfish 2) and MK104137 (male darkbarbel catfish).
3. Results 3.1. Comparison of mtDNA copies in semen and mature sperm Absolute quantitative real-time PCR assay was established in this study to compare the mtDNA copies in semen and mature sperm, which could be reflected by the ratio of mtDNA/β-actin, suggesting the average copy number per haploid genome or per sperm. The efficiencies of nd4 and β-actin PCR were constant (90%–110%, data not shown) over the concentration range studied (104–108 copies) both in yellow catfish and darkbarbel catfish. The determination of the ratios of mtDNA/β-actin revealed that mtDNA contents were reduced from around 100 copies in the semen to 5.07 and 2.45 copies in the mature sperm of yellow catfish and darkbarbel catfish, respectively (Fig. 1).
2.6. PCR, sequencing, sequence analysis, and restriction enzyme identification For preliminarily diagnose, two primer sets were designed to detect the fate of paternal mtDNA in yellow catfish (PF01, Table 3) and hybrid yellow catfish (PV, Table 3) during embryonic development according to mtDNA sequences of male yellow catfish and male darkbarbel catfish, respectively. Based on the results of diagnosis, the other nine polymorphisms between their parental mtDNA were used for further diagnosis in yellow catfish, primers of which were listed in Table 3, including PF02-PF08. Then, in order to verify the results of sequencing in hybrid yellow catfish, the enzyme digest was carried out on the PCR fragment of amplified with PV, which allowed amplified mtDNA fragment from darkbarbel catfish but not from yellow catfish to be cut by BglII restriction enzyme (NEB #R0144V) due to point mutant in cleavage site and examined by agarose gel electrophoresis. Considering that the oocyte possesses significantly more mtDNA than sperm (at least 103 times as much), template DNA samples were used for PCR and sequencing to detect the sensitivity of primers, which were parents' genome DNA mixtures with different dilutions. Besides, the template DNA samples were also used for PCR and sequencing (TSINGKE,
3.2. Paternal mtDNA diagnosis In this study, we used yellow catfish and hybrid yellow catfish as a model to investigate the fate of paternal mtDNA in their developing embryos. As shown in Fig. 2A, the sequencing results showed that paternal mtDNA did not exist in the embryos of yellow catfish just after fertilization, whereas it was detected in hybrid yellow catfish after fertilization (Fig. 2B). Moreover, the paternal mtDNA could be detected at as later as gastrula stage in hybrid yellow catfish (Fig. 3). To further prove whether paternal mtDNA was immediately eliminated after fertilization in yellow catfish, all the diagnostic polymorphisms between their parental mtDNA were used for checking through direct sequencing (Table 4). Heterozygous double peaks at the same position were not found in all the examined loci, confirming early paternal mtDNA elimination in yellow catfish. In order to further confirm the elimination time of paternal mtDNA in hybrid yellow catfish, PCR products were checked by digestion with BglII. From the sequences of parental mtDNA, BglII digestion product of darkbarbel catfish mtDNA should generate fragments of 141 and 120 bp, whereas the PCR products of yellow catfish should not be digested (Fig. 4A). Consistently, we observed a digestion of PCR products of hybrid yellow catfish mtDNA by BglII, but we observed just a mixed fragment of 141 and 120 bp on agarose gel due to its low-resolution (Fig. 4B). It is clear that paternal mtDNA disappeared after gastrula and had the phenotype of late elimination in hybrid yellow catfish when compared to yellow catfish. To determine whether paternal mtDNA is restrictedly located in a region of the embryo that indicates the possibility that paternal mtDNA existed in certain adult organs, seven adult organs derived from three germ layers were used to detect this possibility in hybrid yellow catfish. The results showed that none of paternal mtDNA was detected in these adult organs, which could rule out the possibility.
Table 3 The primers used for sequencing. Primers
Sequences (5′-3′)
PV-F PV-R PF01-F PF01-R PF02-F PF02-R PF03-F PF03-R PF04-F PF04-R PF05-F PF05-R PF06-F PF06-R PF07-F PF07-R PF08-F PF08-R
ACTGATTGGTTGATGGCACG CCTTCTATGGCGGAGGGTA CATCCGAAAAACACACCCC GCGTGAAGGTTGCGGATAA TGCCCAGCAAGTCCTAAGTT GTGGCTTAGCAAGGCGTCT CCTCTAGCCTACATTGTACCCG TTGAATTGGAAGCTCAGCCT TTCCACTTCCACTCAACAACC AAGTTCTGGCGTGGGAGC CAACCTCCCCAAAATGACTA TGTTGGGATTAGGGTTGCTT AAGCAACCCTAATCCCAACA AATCACAGGTGGATGCCATAT CCCCATCATTCTTCTCATCAC CCATAGCTGCTACTTGGAGTTG ACACTCATTTGACCCCTTATC TTGATCAGGTTACGTATAGGG
Nucleotide position
Size of the products (bp)
12,426–12,445 12,668–12,686 14,366–14,384 14,590–14,608 16,407–16,426 206–224 2882–2903 3223–3242 8892–8912 9108–9125 10,406–10,425 10,727–10,746 10,727–10,746 10,986–11,006 11,685–11,705 11,933–11,954 11,996–12,016 12,237–12,257
261 243 345 361 234 341
3.3. Comparison of embryo and larval development between yellow catfish and hybrid yellow catfish
280 270
The development status of yellow catfish and hybrid yellow catfish were observed. At gastrula stage, 18.7% of hybrid yellow catfish embryos with a major malformation were observed, whereas only 4.5% of yellow catfish embryos displayed embryonic malformation (Fig. 5A–E).
262
3
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 1. Comparison of copy number of mtDNA between semen and mature sperm in both yellow catfish and darkbarbel catfish. PF: yellow catfish; PV: darkbarbel catfish.
4. Discussion and conclusion
At the post-hatching stage, the percentages of embryonic malformation were 29.8% and 4.8% in hybrid yellow catfish and yellow catfish, respectively (Fig. 5F–J). Several abnormal phenotypes, such as body curvature, pericardial edema, body curvature and pericardial edema were observed.
Although mitochondria uniparental inheritance (MUI) is nearly universal in many sexually reproducing species, its dynamic process is still mysterious (Birky, 1995; Sreedharan and Shpak, 2010). Several Fig. 2. Partial sequence analysis of mtDNA from parents, zygote and 2-cell progenies. (A). Sequence analysis in yellow catfish. And the heteroplasmy is not detected from embryos at the zygote and 2-cell stage. (B). Sequence analysis in hybrid yellow catfish. The female parent is yellow catfish and the male parent is darkbarbel catfish. And the heteroplasmy is easily detected from embryos at the zygote and 2-cell stage. M denotes A or C; R denotes A or G.
4
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 3. Alignment analysis of sequences from parents of hybrid yellow catfish and their embryos at each stage. 1‰ and 0.1‰ represent male: female DNA ratio. Y denotes T or C; M denotes C or A; R denotes A or G; W denotes T or A.
proteolysis, specific nuclease-dependent systems (Endo G) and autophagy have been shown to eliminate the paternal mtDNA in the cytoplasm of gametes or zygotes so as to prevent the transmission of paternal mtDNA (Sato and Sato, 2013). In our study, paternal mtDNA in yellow catfish degrade quickly after fertilization, while paternal mtDNA from darkbarbel catfish remained detectable up to gastrula stage in hybrid yellow catfish, suggesting that paternal mtDNA is not efficiently eliminated in interspecies hybrids. Similar events have also been reported in some hybrids to date, not only in mammals (Kaneda et al., 1995; Sutovsky et al., 2000), but also in fish species (Wen et al., 2016). The delayed elimination of paternal mitochondria in the interspecies hybrid suggests that a species-specific molecule mechanism in the recognition and elimination of sperm mtDNA.
possible mechanisms described in the Introduction section have been proposed to account for uniparental inheritance of mitochondria. In this study, we examined the elimination process of paternal mitochondria in yellow catfish and hybrid yellow catfish, starting from the unfertilized sperms to the embryonic stage when paternal mitochondria are eliminated. Our study demonstrated that MUI is a conserved process in fish species. Before fertilization, mtDNA contents were few in mature sperm compared to semen (Fig. 1) both in yellow catfish and darkbarbel catfish. However, after fertilization paternal mtDNA immediately disappeared in the embryos of yellow catfish, while it was still detected in hybrid yellow catfish up to gastrula stage (Figs. 3 and 4), indicating a delayed elimination of paternal mitochondria in hybrid yellow catfish. So far, three main mechanisms, including ubiquitin-mediated Table 4 Paternal mtDNA detection in yellow catfish. Nucleotide position
Female Male 1‰ 0.1‰ Zygote 2-Cell
105
2986
8927
10,500
10,675
10,843
10,855
11,876
12,038
14,466
A G R A A A
A G R A A A
A C M A A A
T G K T T T
C T Y C C C
G A R G G G
T C Y T T T
G T K G G G
C A M C C C
C T Y C C C
All different sites were detected and labelled in this table. 1‰ and 0.1‰ represent male: female DNA ratio. R denotes A or G; Y denotes C or T; M denotes A or C; K denotes C or G. 5
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 4. Enzyme digestion of fragments from parents of hybrid yellow catfish and their embryos at each stage. (A). Schematic for digestion by BglII restriction enzyme. A 261-bp region was amplified by PCR using genomic DNA as a template. Besides, amplified fragment from the male parent (darkbarbel catfish) contains a BglII-sensitive site, digestion of the PCR product produces two fragments (141 bp and 120 bp), whereas amplified fragment from the female parent (yellow catfish) is BglII-resistant. (B). Amplified fragment from paternal mtDNA could be selectively digested and distinguished from the amplified fragment from maternal mtDNA (yellow catfish). Lane 1, PCR product of maternal mtDNA could not be digested with BglII restriction enzyme and was 261 bp; lane 2, PCR product of paternal mtDNA was digested to 141- and 120bp segments (their sizes were too small to be seperated on agarose gel) by BglII restriction enzyme; lane 3–10, the maternal mtDNA signal was always detected at each stage, whereas the paternal mtDNA signal was detected until gastrula stage. PF: yellow catfish; PV: darkbarbel catfish.
and female blunt-snout bream (Megalobrama amblycephala) underwent abnormal development and perinatal death, and showed late elimination of paternal mtDNA. Thus, we supposed that high malformation rate in hybrid yellow catfish may be associated with late elimination of paternal mtDNA. Further studies are necessary to reveal the potential mechanism of recognition and elimination of sperm mtDNA in yellow catfish and hybrid yellow catfish, which may provide some clues to decrease the abnormality rate in hybrid yellow catfish, and also in other interspecies hybrids. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.04.022.
Hybrid incompatibility or abnormal numbers of chromosomes is one of the main causes for embryo malformation and death of the hybrid offsprings (Fujiwara et al., 1997; Blum and Bonaccorsi, 2017). However, yellow catfish and darkbarbel catfish belong to the Pelteobagrus genus and have the same chromosome number (2N = 52) (Zhang et al., 2017). In mammals, many studies have demonstrated that mitochondrial heteroplasmy is usually associated with abnormal embryogenesis and diseased phenotypes in a variety of organisms (Lightowlers et al., 1997; Mishra and Chan, 2014; Carelli, 2015). Zhou et al. (2016) reported that delayed removal of paternal mitochondria increased embryonic lethality and cell division durations. Wen et al. (2016) revealed that the embryos produced by male goldfish (Carassius auratus red var.)
Fig. 5. The hybrids had a high malformation rate at gastrula (A–E) and post-hatching (F–J) stage. (A). normal embryo in yellow catfish. (B–D). The abnormal embryo development in hybrid yellow catfish. (E). Comparison of malformation rate at gastrula stage. PF: 4.5%, PF-PV: 18.67%. (F). Normal larval of yellow catfish. (G). Notochordal abnormality (body curvature). (H). Pericardial edema (I). Body curvature and pericardial edema. (J). Comparison of malformation rate at posthatching stage. PF: 4.83%, PF-PV: 29.83%. NF: Normal fish; MF: Malformed fish; PF: yellow catfish; PF-PV: hybrid yellow catfish.
6
Gene 704 (2019) 1–7
Z. Chu, et al.
Competing interest
Mei, J., Gui, J.F., 2015. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. Sci. China Life Sci. 58, 124–136. Mishra, P., Chan, D.C., 2014. Mitochondrial dynamics and inheritance during cell division, development and disease. Nat. Rev. Mol. Cell Biol. 15, 634–646. Nishimura, Y., Yoshinari, T., Naruse, K., Yamada, T., Sumi, K., Mitani, H., Higashiyama, T., Kuroiwa, T., 2006. Active digestion of sperm mitochondrial DNA in single living sperm revealed by optical tweezers. Proc. Natl. Acad. Sci. U. S. A. 103, 1382–1387. Nohl, H., Kozlov, A.V., Gille, L., Staniek, K., 2003. Cell respiration and formation of reactive oxygen species: facts and artefacts. Biochem. Soc. Trans. 31, 1308–1311. Pan, J.L., Ding, S.Y., Ge, J.C., Yan, W.H., Hao, C., Chen, J.X., Huang, Y.H., 2008. Development of cryopreservation for maintaining yellow catfish Pelteolbagrus fulvidraco sperm. Aquaculture 279, 173–176. Panaretakis, T., Shabalina, I.G., Grander, D., Shoshan, M.C., DePierre, J.W., 2001. Reactive oxygen species and mitochondria mediate the induction of apoptosis in human hepatoma HepG2 cells by the rodent peroxisome proliferator and hepatocarcinogen, perfluorooctanoic acid. Toxicol. Appl. Pharmacol. 173, 56–64. Pfeiffer, T., Schuster, S., Bonhoeffer, S., 2001. Cooperation and competition in the evolution of ATP-producing pathways. Science 292, 504–507. Pickworth, S., Chang, M.C., 1969. Fertilization of Chinese hamster eggs in vitro. J. Reprod. Fertil. 19, 371–374. Sato, M., Sato, K., 2013. Maternal inheritance of mitochondrial DNA by diverse mechanisms to eliminate paternal mitochondrial DNA. BBA-Mol. Cell. Res. 1833, 1979–1984. Sreedharan, V., Shpak, M., 2010. Selection for male-enforced uniparental cytoplasmic inheritance. Theory Biosci. 129, 295–306. St John, J., Sakkas, D., Dimitriadi, K., Barnes, A., Maclin, V., Ramey, J., Barratt, C., De Jonge, C., 2000. Failure of elimination of paternal mitochondrial DNA in abnormal embryos. Lancet 355, 200. Sutovsky, P., Moreno, R.D., Ramalho-Santos, J., Dominko, T., Simerly, C., Schatten, G., 1999. Development - ubiquitin tag for sperm mitochondria. Nature 402, 371–372. Sutovsky, P., Moreno, R.D., Ramalho-Santos, J., Dominko, T., Simerly, C., Schatten, G., 2000. Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos. Biol. Reprod. 63, 582–590. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tsai, T.S., Rajasekar, S., St John, J.C., 2016. The relationship between mitochondrial DNA haplotype and the reproductive capacity of domestic pigs (Sus scrofa domesticus). BMC Genet. 17, 67. Wen, M., Peng, L.Y., Hu, X.J., Zhao, Y.L., Liu, S.J., Hong, Y.H., 2016. Transcriptional quiescence of paternal mtDNA in cyprinid fish embryos. Sci. Rep. 6, 28571. Wolff, J.N., Nafisinia, M., Sutovsky, P., Ballard, J.W., 2013. Paternal transmission of mitochondrial DNA as an integral part of mitochondrial inheritance in metapopulations of Drosophila simulans. Heredity 110, 57–62. Won, E.J., Kim, H.R., Kim, H.Y., Kook, H., Kim, H.J., Shin, J.H., Suh, S.P., Ryang, D.W., Shin, M.G., 2013. Diagnostic and prognostic value of mitochondrial DNA minisatellites after stem cell transplantation. Biol. Blood Marrow Transplant. 19, 918–924. Yanagimachi, R., Kamiguchi, Y., Sugawara, S., Mikamo, K., 1983. Gametes and fertilization in the Chinese-hamster. Gamete Res. 8, 97–117. Zhang, J., Ma, W., Song, X., Lin, Q., Gui, J.F., Mei, J., 2014. Characterization and development of EST-SSR markers derived from transcriptome of yellow catfish. Molecules 19, 16402–16415. Zhang, J.J., Zhang, G.S., Zhang, H.Y., Wang, D., Zhu, W.X., Yin, S.W., 2017. Comparative analysis of the karyotype and nutritional ingredient for the hybrids of Pelteobagrus fulvidraco(♀) × P. vachelli(♂) and their parental fish. Marine Fisheries 02, 0149–0161. Zhang, X., Lin, Q., Ren, F., Zhang, J., Dawar, F.U., Mei, J., 2018. The dysregulated autophagy signaling is partially responsible for defective podocyte development in wt1a mutant zebrafish. Aquaculture & Fisheries 3, 99–105. Zhou, Z.J., Shi, F.M., Huang, Y., 2008. The complete mitogenome of the Chinese bush cricket, Gampsocleis gratiosa (Orthoptera: Tettigonioidea). J. Genet. Genomics 35, 341–348. Zhou, Q., Li, H., Li, H., Nakagawa, A., Lin, J.L., Lee, E.S., Harry, B.L., Skeen-Gaar, R.R., Suehiro, Y., William, D., Mitani, S., Yuan, H.S., Kang, B.H., Xue, D., 2016. Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 353, 394–399. Zhu, Z.Y., Yue, G.H., 2008. The complete mitochondrial genome of red grouper Plectropomus leopardus and its applications in identification of grouper species. Aquaculture 276, 44–49.
The authors declare that they have no competing interests. Acknowledgments This work was supported by China Agriculture Research System (CARS-46) and National Natural Science Foundation of China (31502158). References Allen, J.F., 2003. Why chloroplasts and mitochondria contain genomes. Comp. Funct. Genomics 4, 31–36. Arnoult, D., Soares, F., Tattoli, I., Girardin, S.E., 2011. Mitochondria in innate immunity. EMBO Rep. 12, 901–910. Birky, C.W., 1995. Uniparental inheritance of mitochondrial and chloroplast genes mechanisms and evolution. Proc. Natl. Acad. Sci. U. S. A. 92, 11331–11338. Birky, C.W., 2001. The inheritance of genes in mitochondria and chloroplasts: laws, mechanisms, and models. Annu. Rev. Genet. 35, 125–148. Blum, J.A., Bonaccorsi, S., 2017. The hybrid incompatibility genes Lhr and Hmr are required for sister chromatid detachment during anaphase but not for centromere function. Genetics 207, 1457–1472. Carelli, V., 2015. Keeping in shape the dogma of mitochondrial DNA maternal inheritance. PLoS Genet. 11, e1005179. Chen, S.L., Xu, M.Y., Ji, X.S., Yu, G.C., 2004. Cloning and characterisation of natural resistance associated macrophage protein (Nramp) cDNA from red sea bream (Pagrus major). Fish Shellfish Immunol. 17, 305–313. Cummins, J., 1998. Mitochondrial DNA in mammalian reproduction. Rev. Reprod. 3, 172–182. Cummins, J.M., Jequier, A.M., Kan, R., 1994. Molecular-biology of human male-infertility - links with aging, mitochondrial genetics, and oxidative stress. Mol. Reprod. Dev. 37, 345–362. DeLuca, S.Z., O'Farrell, P.H., 2012. Barriers to male transmission of mitochondrial DNA in sperm development. Dev. Cell 22, 660–668. Fujiwara, A., Abe, S., Yamaha, E., Yamazaki, F., Yoshida, M.C., 1997. Uniparental chromosome elimination in the early embryogenesis of the inviable salmonid hybrids between masu salmon female and rainbow trout male. Chromosoma 106, 44–52. Furimsky, A., Vuong, N., Xu, H.B., Kumarathasan, P., Xu, M., Weerachatyanukul, W., Khalil, M.B., Kates, M., Tanphaichitr, N., 2005. Percoll gradient-centrifuged capacitated mouse sperm have increased fertilizing ability and higher contents of sulfogalactosylglycerolipid and docosahexaenoic acid-containing phosphatidylcholine compared to washed capacitated mouse sperm. Biol. Reprod. 72, 574–583. Hua, S., Lu, C.L., Song, Y.K., Li, R.Z., Liu, X., Quan, F.S., Wang, Y.S., Liu, J., Su, F., Zhang, Y., 2012. High levels of mitochondrial heteroplasmy modify the development of ovine-bovine interspecies nuclear transferred embryos. Reprod. Fertil. Dev. 24, 501–509. Kaneda, H., Hayashi, J.I., Takahama, S., Taya, C., Lindahl, K.F., Yonekawa, H., 1995. Elimination of paternal mitochondrial-DNA in intraspecific crosses during early mouse embryogenesis. Proc. Natl. Acad. Sci. U. S. A. 92, 4542–4546. Kim, I.C., Kweon, H.S., Kim, Y.J., Kim, C.B., Gye, M.C., Lee, W.O., Lee, Y.S., Lee, J.S., 2004. The complete mitochondrial genome of the javeline goby Acanthogobius hasta (Perciformes, Gobiidae) and phylogenetic considerations. Gene 336, 147–153. Li, X.Y., Gui, J.F., 2018. Diverse and variable sex determination mechanisms in vertebrates. Sci. China Life Sci. 61, 1503–1514. Lightowlers, R.N., Chinnery, P.F., Turnbull, D.M., Howell, N., 1997. Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet. 13, 450–455. Luo, S.M., Sun, Q.Y., 2013. Autophagy is not involved in the degradation of sperm mitochondria after fertilization in mice. Autophagy 9, 2156–2157. Luo, S.M., Ge, Z.J., Wang, Z.W., Jiang, Z.Z., Wang, Z.B., Ouyang, Y.C., Hou, Y., Schatten, H., Sun, Q.Y., 2013. Unique insights into maternal mitochondrial inheritance in mice. Proc. Natl. Acad. Sci. U. S. A. 110, 13038–13043. Luo, S., Valencia, C.A., Zhang, J., Lee, N.C., Slone, J., Gui, B., Wang, X., Li, Z., Dell, S., Brown, J., Chen, S.M., Chien, Y.H., Hwu, W.L., Fan, P.C., Wong, L.J., Atwal, P.S., Huang, T., 2018. Biparental inheritance of mitochondrial DNA in humans. Proc. Natl. Acad. Sci. U. S. A. 115, 13039–13044.
7
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Delayed elimination of paternal mtDNA in the interspecific hybrid of Pelteobagrus fulvidraco and Pelteobagrus vachelli during early embryogenesis Zhenzhen Chu1, Wenjie Guo1, Weihua Hu, Jie Mei
T
⁎
College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Yellow catfish (Pelteobagrus fulvidraco) Darkbarbel catfish (Pelteobagrus vachelli) Hybrid yellow catfish Paternal mtDNA elimination Embryonic malformation
Mitochondrial homoplasmy is essential for normal development, as its heteroplasmy usually leads to abnormal or diseased phenotypes in mammals. So far, diverse mechanisms have been proposed to play roles in ensuring uniparental inheritance of mitochondria in many organisms. In recent years, hybrid yellow catfish from mating female yellow catfish (Pelteobagrus fulvidraco) with male darkbarbel catfish (Pelteobagrus vachelli) has been widely cultured in China due to its fast-growing. However, a high rate of abnormal and defective embryos was observed in the offsprings of hybrid yellow catfish. In this study, we systematically investigated the elimination process of paternal mitochondrial DNA (mtDNA) in yellow catfish and hybrid yellow catfish. The mtDNA contents significantly decreased in the isolated mature sperm compared with the semen. Different from the elimination of paternal mtDNA after fertilization in yellow catfish, paternal mtDNA was retained in the developmental embryos of hybrid yellow catfish as later as gastrula stage, indicating a delay of elimination for paternal mtDNA and mitochondrial heteroplasmy during embryogenesis in hybrid yellow catfish. Altogether, the present study suggests that mitochondrial heteroplasmy may affect embryonic development of hybrid progeny between catfish species.
1. Introduction Mitochondrion (MT) is a membraned-enclosed organelle present in the cytoplasm of all eukaryotic cells (Kaneda et al., 1995; Won et al., 2013). It is considered as the powerhouses to produce the majority of energy (ATP) for cellular and organismal metabolism through oxidative phosphorylation (Pfeiffer et al., 2001; Tsai et al., 2016). Besides this function, MT is also involved in various biological processes, such as the induction of apoptosis (Panaretakis et al., 2001), innate immunity (Arnoult et al., 2011), and generation of reactive oxygen species (ROS) by respiration (Nohl et al., 2003). As in chloroplasts, another organelles in plant cells, MT also carries its own genomic DNA (Allen, 2003), namely mitochondrial DNA (mtDNA), which maintains multiple copies per cell and is subject to dynamic regulation of their copy number in terms of tissue type. In almost all animal species, mtDNA is a doublestranded circular molecule, and contains a D-loop region and 37 genes including 2 ribosomal RNAs, 22 transfer RNAs, and 13 protein-coding
genes (Zhou et al., 2008; Zhu and Yue, 2008). Unlike the nuclear genome, mtDNA does not follow Mendelian Laws, but is inherited uniparentally from the maternal parent in the great majority of animals (Birky, 2001). Although the maternal inheritance has been universally acceptable, the underlying mechanism is still largely unknown. A possible rational explanation is that sperm mtDNA is more susceptible to oxidative damage than maternal mtDNA during the process of spermatogenesis and fertilization, since mutations were accumulated in the paternal mtDNA (Cummins et al., 1994; Cummins, 1998). Therefore, uniparental inheritance may be a protection strategy to prevent the spread of potentially deleterious mtDNA in the whole population (Sato and Sato, 2013). In recent decades, several potential mechanisms have been put forth for uniparental inheritance of mtDNA, such as the decrease of mtDNA content during spermatogenesis (Nishimura et al., 2006), elimination of mtDNA from mature sperm (DeLuca and O'Farrell, 2012), prevention of the entry of sperm mtDNA into oocyte cytoplasm (Pickworth and Chang, 1969;
Abbreviations: bp, base pair; SD, standard deviation; MT, mitochondrion; ATP, adenosine-triphosphate; ROS, reactive oxygen species; mtDNA, mitochondrial DNA; P. fulvidraco, Pelteobagrus fulvidraco; P. vachelli, Pelteobagrus vachelli; KRB-Hepes, Krebs Ringer bicarbonate medium buffered with Hepes; Long-PCR, the longpolymerase chain reaction; MUI, mitochondria uniparental inheritance; PF, yellow catfish; PV, darkbarbel catfish; PF-PV, hybrid yellow catfish; NF, Normal fish; MF, Malformed fish ⁎ Corresponding author. E-mail address: [email protected] (J. Mei). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.gene.2019.04.022 Received 30 November 2018; Received in revised form 14 March 2019; Accepted 5 April 2019 Available online 07 April 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 704 (2019) 1–7
Z. Chu, et al.
2.3. Preparation of semen and isolation of mature sperm
Yanagimachi et al., 1983), restriction of sperm mtDNA to a region of the embryo (Luo and Sun, 2013), dilution or active degradation of paternal mitochondria in the zygote, through ubiquitin- and lysosomemediated degradation events (Sato and Sato, 2013). Recently, exceptional cases of biparental inheritance of mtDNA were detected in some animals, such as human (Homo sapiens) (Luo et al., 2018) and fruit fly (Drosophila simulans) (Wolff et al., 2013). Meanwhile, comparative analyses have also been carried out between offspring from interspecific hybrid and intraspecific hybrid. In intraspecific hybrids of Mus musculus, paternal mtDNA was detected only through the early pronucleus stage, while in interspecific hybrids between M. musculus and Mus spretus, paternal mtDNA was detected throughout development from pronucleus stage to neonates (Kaneda et al., 1995). Similar result was also detected in a bovine interspecies cross between the domestic cow and the Asian wild gaur, sperm mitochondria from wild gaurs exhibited late elimination beyond the third embryonic division (Sutovsky et al., 2000). These results indicated that paternal mtDNA could be not efficiently eliminated in interspecies hybrids, implying a species-specific mechanism for the recognition of paternal mitochondria (Sutovsky et al., 1999). Yellow catfish (Pelteobagrus fulvidraco) is a teleost fish belonging to the order Siluriformes (Pan et al., 2008). Due to flesh quality, few intermuscle bones, as well as high commercial value, it has become an important economic fish in China (Zhang et al., 2014; Mei and Gui, 2015). All-male yellow catfish has been successfully produced by sex-control method based on its sex-determining type and mechanism, since males exhibit much faster growth rate than females (Li and Gui, 2018). In recent years, hybrid yellow catfish from mating female P. fulvidraco with male darkbarbel catfish (Pelteobagrus vachelli) has been widely cultured due to its fast-growing. However, the offsprings of hybrid yellow catfish have a high rate of abnormal and defective embryos than the offsprings of P. fulvidraco, which directly increases the cost of artificial reproduction. Previous studies have indicated that the occurrence of abnormal or diseased phenotypes during embryogenesis was relevant to the failure of elimination of paternal mtDNA (St John et al., 2000; Hua et al., 2012). In our study, we attempted to investigate whether paternal mitochondria were not efficiently eliminated in hybrid yellow catfish when compared to P. fulvidraco, which may be a factor for a high malformation rate in hybrid yellow catfish.
The mature sperms of P. fulvidraco and P. vachelli were separated by centrifugation on discontinuous Percoll gradient as described previously (Furimsky et al., 2005; Luo et al., 2013). In brief, testes of eight P. fulvidraco and eight P. vachelli were respectively removed by dissection with the aid of scissors, cleared of the adherent connective tissue, and then placed into a mortar. Fresh semen samples were obtained by cutting testis and kept in the KRB-Hepes (Krebs Ringer bicarbonate medium buffered with Hepes) for 30 min. Then, the modified sperm was put onto discontinuous two-layer density gradients of percoll solution (45% and 90% percoll in KRB-Hepes). The gradient was centrifuged at 650g for 30 min. Then, the 90% percoll solution and equal volumes of 0.9% physiological saline solution were added into individual centrifugation tube, and the tube was centrifuged at 430g for 10 min to allow motile sperm to sediment as a pellet. Finally, after carefully removing the percoll solution, the sperm sediment was resuspended by using 0.9% physiological saline solution and centrifuged at 430g for 10 min once. The whole process of Percoll gradient was carried out at 25 °C. The semen and mature sperm were dealt with osmotic shock (200 μL 50 mM Tris-HCl, pH 6.8) at 8 °C for 20 min to avoid the contamination of other cells and then centrifuged at 1000g for 5 min. 2.4. Real-time PCR-based absolute quantification To determinate the changes of mtDNA copies during sperm maturation in yellow catfish and darkbarbel catfish, the nd4 and β-actin were used as reference genes to perform the absolute quantitative realtime PCR assay. The PCR products (primers in Table 1) were inserted into PMD18-T vector (TaKaRa) to construct plasmids as described previously (Chen et al., 2004). The recombinant plasmids were purified with an EZNA™ Plasmid Mini Kit I (100) after sequenced for confirmation and then detected their quality and quantity by NanoDrop 2000 (Thermo Scientific, USA). For all real-time PCR assays, the standard IQTM SYBR Green Supermix Kit (Bio-Rad Laboratories, Hercules, CA, USA) was used in 20 μL reactions, which were run with the following program parameters: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 20 s, 72 °C for 15 s. And the real-time PCR system was performed in triplicate on Bio-Rad CFX96™ (Bio-Rad, Hercules, CA, USA). For each run, a standard curve was generated using five 10-fold serial dilutions (104–108copies) of the external standard. The starting copy number of mtDNA was obtained on the curve. All samples were tested thrice. Meanwhile, we quantified the starting copy number of β-actin gene by the same method to determine the number of sperms in each sample. And the calculation of mtDNA/β-actin ratio was the starting copy number of mtDNA per sperm.
2. Materials and methods 2.1. Ethics statement The present experiments were approved by the institution animal care and use committee of Huazhong Agriculture University.
2.2. Sample preparation and genomic DNA extraction 2.5. Long PCR, mitochondrial DNA sequencing, and genome-wide mitochondrial heteroplasmy in experimental parents
Yellow catfish and hybrid yellow catfish were obtained using artificial insemination from our fish breeding center of Huazhong Agricultural University, China (Fig. S1), and about 1500 embryos were obtained in each group. Embryos were placed in Petri dishes and collected at different stages (20 embryos pooled for each stage). Fresh organs of adult hybrid yellow catfish were also sampled. All the samples were stored at −20 °C before DNA extraction. The genomic DNA was extracted from semen and mature sperms, the caudal fin of each parent, 20 pooled embryos at each stage, and tissue samples by using the traditional phenol-chloroform method as described previously (Zhang et al., 2014). Following isolation, the quantity and quality of DNA was assessed using NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA). Finally, DNA was adjusted to approximately 50 ng/μL with sterile water and stored at −20 °C until used.
The complete mitochondrial genomes of experimental parents were amplified using the long-polymerase chain reaction (long-PCR) technique with two universal primer sets (Table 2) that were always used in vertebrates. PCR reactions were performed as previously described Table 1 The primers for the absolute quantitative real-time PCR.
2
Primers
Sequences (5′-3′)
β-Actin-F β-Actin-R nd4-F nd4-R
CCGTGACATCAAGGAGAAGC TCGGGACACCTGAACCTCT CTTGGTAGCAGGAGGCATTT TGGTTCGGCTGTGGGTT
Size of the products (bp) 150 140
Gene 704 (2019) 1–7
Z. Chu, et al.
Beijing), which include parents, embryos of zygote and 2-cell stage in yellow catfish and the parents, embryos at each stage and organs of hybrid yellow catfish.
Table 2 The primers used to amplify long PCR. Primers
Sequences (5′-3′)
Size of the products (bp)
Genome-1-F Genome-1-R Genome-2-F Genome-2-R
GGTCTTAGGAACCAAAAACTCTTGGTGCAA TGCACCATTAGGATGTCCTGATCCAACATC GATGTTGGATCAGGACATCCTAATGGTGCA TTGCACCAAGAGTTTTTGGTTCCTAAGACC
2.7. Statistical analysis 7178
The analytical method was performed as previously described (Zhang et al., 2018). Data are shown as mean ± SD, and the differences between groups were analyzed using a Student's t-test. Statistical significance was represented by the asterisk (* P < 0.05, ** P < 0.01, *** P < 0.001).
9409
(Kim et al., 2004), and the products were purified with QIAquick PCR Purification Kit (Qiagen). The purified products were then subcloned into pCR2.1 vector (Invitrogen, USA) and sequenced with commercial primers and nested flanking sequencing primers. The whole mtDNA sequences were assembled with Contig Express (Informax Inc., Oxford, United Kingdom), and SNPs between experimental parents were detected by multiple alignment program CLUSTAL W using MEGA6 software (Tamura et al., 2013). The whole mitochondrial genome sequences determined in this study have been deposited in GenBank with the following accession numbers: MK104134 (female yellow catfish 1), MK104135 (male yellow catfish), MK104136 (female yellow catfish 2) and MK104137 (male darkbarbel catfish).
3. Results 3.1. Comparison of mtDNA copies in semen and mature sperm Absolute quantitative real-time PCR assay was established in this study to compare the mtDNA copies in semen and mature sperm, which could be reflected by the ratio of mtDNA/β-actin, suggesting the average copy number per haploid genome or per sperm. The efficiencies of nd4 and β-actin PCR were constant (90%–110%, data not shown) over the concentration range studied (104–108 copies) both in yellow catfish and darkbarbel catfish. The determination of the ratios of mtDNA/β-actin revealed that mtDNA contents were reduced from around 100 copies in the semen to 5.07 and 2.45 copies in the mature sperm of yellow catfish and darkbarbel catfish, respectively (Fig. 1).
2.6. PCR, sequencing, sequence analysis, and restriction enzyme identification For preliminarily diagnose, two primer sets were designed to detect the fate of paternal mtDNA in yellow catfish (PF01, Table 3) and hybrid yellow catfish (PV, Table 3) during embryonic development according to mtDNA sequences of male yellow catfish and male darkbarbel catfish, respectively. Based on the results of diagnosis, the other nine polymorphisms between their parental mtDNA were used for further diagnosis in yellow catfish, primers of which were listed in Table 3, including PF02-PF08. Then, in order to verify the results of sequencing in hybrid yellow catfish, the enzyme digest was carried out on the PCR fragment of amplified with PV, which allowed amplified mtDNA fragment from darkbarbel catfish but not from yellow catfish to be cut by BglII restriction enzyme (NEB #R0144V) due to point mutant in cleavage site and examined by agarose gel electrophoresis. Considering that the oocyte possesses significantly more mtDNA than sperm (at least 103 times as much), template DNA samples were used for PCR and sequencing to detect the sensitivity of primers, which were parents' genome DNA mixtures with different dilutions. Besides, the template DNA samples were also used for PCR and sequencing (TSINGKE,
3.2. Paternal mtDNA diagnosis In this study, we used yellow catfish and hybrid yellow catfish as a model to investigate the fate of paternal mtDNA in their developing embryos. As shown in Fig. 2A, the sequencing results showed that paternal mtDNA did not exist in the embryos of yellow catfish just after fertilization, whereas it was detected in hybrid yellow catfish after fertilization (Fig. 2B). Moreover, the paternal mtDNA could be detected at as later as gastrula stage in hybrid yellow catfish (Fig. 3). To further prove whether paternal mtDNA was immediately eliminated after fertilization in yellow catfish, all the diagnostic polymorphisms between their parental mtDNA were used for checking through direct sequencing (Table 4). Heterozygous double peaks at the same position were not found in all the examined loci, confirming early paternal mtDNA elimination in yellow catfish. In order to further confirm the elimination time of paternal mtDNA in hybrid yellow catfish, PCR products were checked by digestion with BglII. From the sequences of parental mtDNA, BglII digestion product of darkbarbel catfish mtDNA should generate fragments of 141 and 120 bp, whereas the PCR products of yellow catfish should not be digested (Fig. 4A). Consistently, we observed a digestion of PCR products of hybrid yellow catfish mtDNA by BglII, but we observed just a mixed fragment of 141 and 120 bp on agarose gel due to its low-resolution (Fig. 4B). It is clear that paternal mtDNA disappeared after gastrula and had the phenotype of late elimination in hybrid yellow catfish when compared to yellow catfish. To determine whether paternal mtDNA is restrictedly located in a region of the embryo that indicates the possibility that paternal mtDNA existed in certain adult organs, seven adult organs derived from three germ layers were used to detect this possibility in hybrid yellow catfish. The results showed that none of paternal mtDNA was detected in these adult organs, which could rule out the possibility.
Table 3 The primers used for sequencing. Primers
Sequences (5′-3′)
PV-F PV-R PF01-F PF01-R PF02-F PF02-R PF03-F PF03-R PF04-F PF04-R PF05-F PF05-R PF06-F PF06-R PF07-F PF07-R PF08-F PF08-R
ACTGATTGGTTGATGGCACG CCTTCTATGGCGGAGGGTA CATCCGAAAAACACACCCC GCGTGAAGGTTGCGGATAA TGCCCAGCAAGTCCTAAGTT GTGGCTTAGCAAGGCGTCT CCTCTAGCCTACATTGTACCCG TTGAATTGGAAGCTCAGCCT TTCCACTTCCACTCAACAACC AAGTTCTGGCGTGGGAGC CAACCTCCCCAAAATGACTA TGTTGGGATTAGGGTTGCTT AAGCAACCCTAATCCCAACA AATCACAGGTGGATGCCATAT CCCCATCATTCTTCTCATCAC CCATAGCTGCTACTTGGAGTTG ACACTCATTTGACCCCTTATC TTGATCAGGTTACGTATAGGG
Nucleotide position
Size of the products (bp)
12,426–12,445 12,668–12,686 14,366–14,384 14,590–14,608 16,407–16,426 206–224 2882–2903 3223–3242 8892–8912 9108–9125 10,406–10,425 10,727–10,746 10,727–10,746 10,986–11,006 11,685–11,705 11,933–11,954 11,996–12,016 12,237–12,257
261 243 345 361 234 341
3.3. Comparison of embryo and larval development between yellow catfish and hybrid yellow catfish
280 270
The development status of yellow catfish and hybrid yellow catfish were observed. At gastrula stage, 18.7% of hybrid yellow catfish embryos with a major malformation were observed, whereas only 4.5% of yellow catfish embryos displayed embryonic malformation (Fig. 5A–E).
262
3
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 1. Comparison of copy number of mtDNA between semen and mature sperm in both yellow catfish and darkbarbel catfish. PF: yellow catfish; PV: darkbarbel catfish.
4. Discussion and conclusion
At the post-hatching stage, the percentages of embryonic malformation were 29.8% and 4.8% in hybrid yellow catfish and yellow catfish, respectively (Fig. 5F–J). Several abnormal phenotypes, such as body curvature, pericardial edema, body curvature and pericardial edema were observed.
Although mitochondria uniparental inheritance (MUI) is nearly universal in many sexually reproducing species, its dynamic process is still mysterious (Birky, 1995; Sreedharan and Shpak, 2010). Several Fig. 2. Partial sequence analysis of mtDNA from parents, zygote and 2-cell progenies. (A). Sequence analysis in yellow catfish. And the heteroplasmy is not detected from embryos at the zygote and 2-cell stage. (B). Sequence analysis in hybrid yellow catfish. The female parent is yellow catfish and the male parent is darkbarbel catfish. And the heteroplasmy is easily detected from embryos at the zygote and 2-cell stage. M denotes A or C; R denotes A or G.
4
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 3. Alignment analysis of sequences from parents of hybrid yellow catfish and their embryos at each stage. 1‰ and 0.1‰ represent male: female DNA ratio. Y denotes T or C; M denotes C or A; R denotes A or G; W denotes T or A.
proteolysis, specific nuclease-dependent systems (Endo G) and autophagy have been shown to eliminate the paternal mtDNA in the cytoplasm of gametes or zygotes so as to prevent the transmission of paternal mtDNA (Sato and Sato, 2013). In our study, paternal mtDNA in yellow catfish degrade quickly after fertilization, while paternal mtDNA from darkbarbel catfish remained detectable up to gastrula stage in hybrid yellow catfish, suggesting that paternal mtDNA is not efficiently eliminated in interspecies hybrids. Similar events have also been reported in some hybrids to date, not only in mammals (Kaneda et al., 1995; Sutovsky et al., 2000), but also in fish species (Wen et al., 2016). The delayed elimination of paternal mitochondria in the interspecies hybrid suggests that a species-specific molecule mechanism in the recognition and elimination of sperm mtDNA.
possible mechanisms described in the Introduction section have been proposed to account for uniparental inheritance of mitochondria. In this study, we examined the elimination process of paternal mitochondria in yellow catfish and hybrid yellow catfish, starting from the unfertilized sperms to the embryonic stage when paternal mitochondria are eliminated. Our study demonstrated that MUI is a conserved process in fish species. Before fertilization, mtDNA contents were few in mature sperm compared to semen (Fig. 1) both in yellow catfish and darkbarbel catfish. However, after fertilization paternal mtDNA immediately disappeared in the embryos of yellow catfish, while it was still detected in hybrid yellow catfish up to gastrula stage (Figs. 3 and 4), indicating a delayed elimination of paternal mitochondria in hybrid yellow catfish. So far, three main mechanisms, including ubiquitin-mediated Table 4 Paternal mtDNA detection in yellow catfish. Nucleotide position
Female Male 1‰ 0.1‰ Zygote 2-Cell
105
2986
8927
10,500
10,675
10,843
10,855
11,876
12,038
14,466
A G R A A A
A G R A A A
A C M A A A
T G K T T T
C T Y C C C
G A R G G G
T C Y T T T
G T K G G G
C A M C C C
C T Y C C C
All different sites were detected and labelled in this table. 1‰ and 0.1‰ represent male: female DNA ratio. R denotes A or G; Y denotes C or T; M denotes A or C; K denotes C or G. 5
Gene 704 (2019) 1–7
Z. Chu, et al.
Fig. 4. Enzyme digestion of fragments from parents of hybrid yellow catfish and their embryos at each stage. (A). Schematic for digestion by BglII restriction enzyme. A 261-bp region was amplified by PCR using genomic DNA as a template. Besides, amplified fragment from the male parent (darkbarbel catfish) contains a BglII-sensitive site, digestion of the PCR product produces two fragments (141 bp and 120 bp), whereas amplified fragment from the female parent (yellow catfish) is BglII-resistant. (B). Amplified fragment from paternal mtDNA could be selectively digested and distinguished from the amplified fragment from maternal mtDNA (yellow catfish). Lane 1, PCR product of maternal mtDNA could not be digested with BglII restriction enzyme and was 261 bp; lane 2, PCR product of paternal mtDNA was digested to 141- and 120bp segments (their sizes were too small to be seperated on agarose gel) by BglII restriction enzyme; lane 3–10, the maternal mtDNA signal was always detected at each stage, whereas the paternal mtDNA signal was detected until gastrula stage. PF: yellow catfish; PV: darkbarbel catfish.
and female blunt-snout bream (Megalobrama amblycephala) underwent abnormal development and perinatal death, and showed late elimination of paternal mtDNA. Thus, we supposed that high malformation rate in hybrid yellow catfish may be associated with late elimination of paternal mtDNA. Further studies are necessary to reveal the potential mechanism of recognition and elimination of sperm mtDNA in yellow catfish and hybrid yellow catfish, which may provide some clues to decrease the abnormality rate in hybrid yellow catfish, and also in other interspecies hybrids. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.04.022.
Hybrid incompatibility or abnormal numbers of chromosomes is one of the main causes for embryo malformation and death of the hybrid offsprings (Fujiwara et al., 1997; Blum and Bonaccorsi, 2017). However, yellow catfish and darkbarbel catfish belong to the Pelteobagrus genus and have the same chromosome number (2N = 52) (Zhang et al., 2017). In mammals, many studies have demonstrated that mitochondrial heteroplasmy is usually associated with abnormal embryogenesis and diseased phenotypes in a variety of organisms (Lightowlers et al., 1997; Mishra and Chan, 2014; Carelli, 2015). Zhou et al. (2016) reported that delayed removal of paternal mitochondria increased embryonic lethality and cell division durations. Wen et al. (2016) revealed that the embryos produced by male goldfish (Carassius auratus red var.)
Fig. 5. The hybrids had a high malformation rate at gastrula (A–E) and post-hatching (F–J) stage. (A). normal embryo in yellow catfish. (B–D). The abnormal embryo development in hybrid yellow catfish. (E). Comparison of malformation rate at gastrula stage. PF: 4.5%, PF-PV: 18.67%. (F). Normal larval of yellow catfish. (G). Notochordal abnormality (body curvature). (H). Pericardial edema (I). Body curvature and pericardial edema. (J). Comparison of malformation rate at posthatching stage. PF: 4.83%, PF-PV: 29.83%. NF: Normal fish; MF: Malformed fish; PF: yellow catfish; PF-PV: hybrid yellow catfish.
6
Gene 704 (2019) 1–7
Z. Chu, et al.
Competing interest
Mei, J., Gui, J.F., 2015. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. Sci. China Life Sci. 58, 124–136. Mishra, P., Chan, D.C., 2014. Mitochondrial dynamics and inheritance during cell division, development and disease. Nat. Rev. Mol. Cell Biol. 15, 634–646. Nishimura, Y., Yoshinari, T., Naruse, K., Yamada, T., Sumi, K., Mitani, H., Higashiyama, T., Kuroiwa, T., 2006. Active digestion of sperm mitochondrial DNA in single living sperm revealed by optical tweezers. Proc. Natl. Acad. Sci. U. S. A. 103, 1382–1387. Nohl, H., Kozlov, A.V., Gille, L., Staniek, K., 2003. Cell respiration and formation of reactive oxygen species: facts and artefacts. Biochem. Soc. Trans. 31, 1308–1311. Pan, J.L., Ding, S.Y., Ge, J.C., Yan, W.H., Hao, C., Chen, J.X., Huang, Y.H., 2008. Development of cryopreservation for maintaining yellow catfish Pelteolbagrus fulvidraco sperm. Aquaculture 279, 173–176. Panaretakis, T., Shabalina, I.G., Grander, D., Shoshan, M.C., DePierre, J.W., 2001. Reactive oxygen species and mitochondria mediate the induction of apoptosis in human hepatoma HepG2 cells by the rodent peroxisome proliferator and hepatocarcinogen, perfluorooctanoic acid. Toxicol. Appl. Pharmacol. 173, 56–64. Pfeiffer, T., Schuster, S., Bonhoeffer, S., 2001. Cooperation and competition in the evolution of ATP-producing pathways. Science 292, 504–507. Pickworth, S., Chang, M.C., 1969. Fertilization of Chinese hamster eggs in vitro. J. Reprod. Fertil. 19, 371–374. Sato, M., Sato, K., 2013. Maternal inheritance of mitochondrial DNA by diverse mechanisms to eliminate paternal mitochondrial DNA. BBA-Mol. Cell. Res. 1833, 1979–1984. Sreedharan, V., Shpak, M., 2010. Selection for male-enforced uniparental cytoplasmic inheritance. Theory Biosci. 129, 295–306. St John, J., Sakkas, D., Dimitriadi, K., Barnes, A., Maclin, V., Ramey, J., Barratt, C., De Jonge, C., 2000. Failure of elimination of paternal mitochondrial DNA in abnormal embryos. Lancet 355, 200. Sutovsky, P., Moreno, R.D., Ramalho-Santos, J., Dominko, T., Simerly, C., Schatten, G., 1999. Development - ubiquitin tag for sperm mitochondria. Nature 402, 371–372. Sutovsky, P., Moreno, R.D., Ramalho-Santos, J., Dominko, T., Simerly, C., Schatten, G., 2000. Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos. Biol. Reprod. 63, 582–590. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tsai, T.S., Rajasekar, S., St John, J.C., 2016. The relationship between mitochondrial DNA haplotype and the reproductive capacity of domestic pigs (Sus scrofa domesticus). BMC Genet. 17, 67. Wen, M., Peng, L.Y., Hu, X.J., Zhao, Y.L., Liu, S.J., Hong, Y.H., 2016. Transcriptional quiescence of paternal mtDNA in cyprinid fish embryos. Sci. Rep. 6, 28571. Wolff, J.N., Nafisinia, M., Sutovsky, P., Ballard, J.W., 2013. Paternal transmission of mitochondrial DNA as an integral part of mitochondrial inheritance in metapopulations of Drosophila simulans. Heredity 110, 57–62. Won, E.J., Kim, H.R., Kim, H.Y., Kook, H., Kim, H.J., Shin, J.H., Suh, S.P., Ryang, D.W., Shin, M.G., 2013. Diagnostic and prognostic value of mitochondrial DNA minisatellites after stem cell transplantation. Biol. Blood Marrow Transplant. 19, 918–924. Yanagimachi, R., Kamiguchi, Y., Sugawara, S., Mikamo, K., 1983. Gametes and fertilization in the Chinese-hamster. Gamete Res. 8, 97–117. Zhang, J., Ma, W., Song, X., Lin, Q., Gui, J.F., Mei, J., 2014. Characterization and development of EST-SSR markers derived from transcriptome of yellow catfish. Molecules 19, 16402–16415. Zhang, J.J., Zhang, G.S., Zhang, H.Y., Wang, D., Zhu, W.X., Yin, S.W., 2017. Comparative analysis of the karyotype and nutritional ingredient for the hybrids of Pelteobagrus fulvidraco(♀) × P. vachelli(♂) and their parental fish. Marine Fisheries 02, 0149–0161. Zhang, X., Lin, Q., Ren, F., Zhang, J., Dawar, F.U., Mei, J., 2018. The dysregulated autophagy signaling is partially responsible for defective podocyte development in wt1a mutant zebrafish. Aquaculture & Fisheries 3, 99–105. Zhou, Z.J., Shi, F.M., Huang, Y., 2008. The complete mitogenome of the Chinese bush cricket, Gampsocleis gratiosa (Orthoptera: Tettigonioidea). J. Genet. Genomics 35, 341–348. Zhou, Q., Li, H., Li, H., Nakagawa, A., Lin, J.L., Lee, E.S., Harry, B.L., Skeen-Gaar, R.R., Suehiro, Y., William, D., Mitani, S., Yuan, H.S., Kang, B.H., Xue, D., 2016. Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 353, 394–399. Zhu, Z.Y., Yue, G.H., 2008. The complete mitochondrial genome of red grouper Plectropomus leopardus and its applications in identification of grouper species. Aquaculture 276, 44–49.
The authors declare that they have no competing interests. Acknowledgments This work was supported by China Agriculture Research System (CARS-46) and National Natural Science Foundation of China (31502158). References Allen, J.F., 2003. Why chloroplasts and mitochondria contain genomes. Comp. Funct. Genomics 4, 31–36. Arnoult, D., Soares, F., Tattoli, I., Girardin, S.E., 2011. Mitochondria in innate immunity. EMBO Rep. 12, 901–910. Birky, C.W., 1995. Uniparental inheritance of mitochondrial and chloroplast genes mechanisms and evolution. Proc. Natl. Acad. Sci. U. S. A. 92, 11331–11338. Birky, C.W., 2001. The inheritance of genes in mitochondria and chloroplasts: laws, mechanisms, and models. Annu. Rev. Genet. 35, 125–148. Blum, J.A., Bonaccorsi, S., 2017. The hybrid incompatibility genes Lhr and Hmr are required for sister chromatid detachment during anaphase but not for centromere function. Genetics 207, 1457–1472. Carelli, V., 2015. Keeping in shape the dogma of mitochondrial DNA maternal inheritance. PLoS Genet. 11, e1005179. Chen, S.L., Xu, M.Y., Ji, X.S., Yu, G.C., 2004. Cloning and characterisation of natural resistance associated macrophage protein (Nramp) cDNA from red sea bream (Pagrus major). Fish Shellfish Immunol. 17, 305–313. Cummins, J., 1998. Mitochondrial DNA in mammalian reproduction. Rev. Reprod. 3, 172–182. Cummins, J.M., Jequier, A.M., Kan, R., 1994. Molecular-biology of human male-infertility - links with aging, mitochondrial genetics, and oxidative stress. Mol. Reprod. Dev. 37, 345–362. DeLuca, S.Z., O'Farrell, P.H., 2012. Barriers to male transmission of mitochondrial DNA in sperm development. Dev. Cell 22, 660–668. Fujiwara, A., Abe, S., Yamaha, E., Yamazaki, F., Yoshida, M.C., 1997. Uniparental chromosome elimination in the early embryogenesis of the inviable salmonid hybrids between masu salmon female and rainbow trout male. Chromosoma 106, 44–52. Furimsky, A., Vuong, N., Xu, H.B., Kumarathasan, P., Xu, M., Weerachatyanukul, W., Khalil, M.B., Kates, M., Tanphaichitr, N., 2005. Percoll gradient-centrifuged capacitated mouse sperm have increased fertilizing ability and higher contents of sulfogalactosylglycerolipid and docosahexaenoic acid-containing phosphatidylcholine compared to washed capacitated mouse sperm. Biol. Reprod. 72, 574–583. Hua, S., Lu, C.L., Song, Y.K., Li, R.Z., Liu, X., Quan, F.S., Wang, Y.S., Liu, J., Su, F., Zhang, Y., 2012. High levels of mitochondrial heteroplasmy modify the development of ovine-bovine interspecies nuclear transferred embryos. Reprod. Fertil. Dev. 24, 501–509. Kaneda, H., Hayashi, J.I., Takahama, S., Taya, C., Lindahl, K.F., Yonekawa, H., 1995. Elimination of paternal mitochondrial-DNA in intraspecific crosses during early mouse embryogenesis. Proc. Natl. Acad. Sci. U. S. A. 92, 4542–4546. Kim, I.C., Kweon, H.S., Kim, Y.J., Kim, C.B., Gye, M.C., Lee, W.O., Lee, Y.S., Lee, J.S., 2004. The complete mitochondrial genome of the javeline goby Acanthogobius hasta (Perciformes, Gobiidae) and phylogenetic considerations. Gene 336, 147–153. Li, X.Y., Gui, J.F., 2018. Diverse and variable sex determination mechanisms in vertebrates. Sci. China Life Sci. 61, 1503–1514. Lightowlers, R.N., Chinnery, P.F., Turnbull, D.M., Howell, N., 1997. Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet. 13, 450–455. Luo, S.M., Sun, Q.Y., 2013. Autophagy is not involved in the degradation of sperm mitochondria after fertilization in mice. Autophagy 9, 2156–2157. Luo, S.M., Ge, Z.J., Wang, Z.W., Jiang, Z.Z., Wang, Z.B., Ouyang, Y.C., Hou, Y., Schatten, H., Sun, Q.Y., 2013. Unique insights into maternal mitochondrial inheritance in mice. Proc. Natl. Acad. Sci. U. S. A. 110, 13038–13043. Luo, S., Valencia, C.A., Zhang, J., Lee, N.C., Slone, J., Gui, B., Wang, X., Li, Z., Dell, S., Brown, J., Chen, S.M., Chien, Y.H., Hwu, W.L., Fan, P.C., Wong, L.J., Atwal, P.S., Huang, T., 2018. Biparental inheritance of mitochondrial DNA in humans. Proc. Natl. Acad. Sci. U. S. A. 115, 13039–13044.
7