Deletion mapping and paternal origin of a Mexican AMELY negative male

Legal Medicine 13 (2011) 262–264

Contents lists available at ScienceDirect

Legal Medicine journal homepage: www.elsevier.com/locate/legalmed

Case Report

Deletion mapping and paternal origin of a Mexican AMELY negative male J.S. Velarde-Félix a,b, J. Salazar-Flores c, G. Martínez-Cortés c, A. Flores García d, J.F. Muñoz-Valle e, J.J. Ríos-Tostado a,b, R. Rubi-Castellanos c, H. Rangel-Villalobos c,⇑ a

Centro de Medicina Genómica del Hospital General de Culiacán ‘‘Dr. Bernardo J. Gastélum’’, Servicios de Salud de Sinaloa, Culiacán, Sinaloa, Mexico Escuela de Biología, Universidad Autónoma de Sinaloa, Culiacán, Sinaloa, Mexico c Instituto de Investigación en Genética Molecular, Centro Universitario de la Ciénega, Universidad de Guadalajara (CUCiénega-UdeG), Ocotlán, Jalisco, Mexico d Unidad Académica de Medicina, Universidad Autónoma de Nayarit, Tepic, Nayarit, Mexico e Instituto de Enfermedades Reumáticas y del Sistema Músculo-Esquelético, Centro Universitario de Ciencias de la Salud (CUCS-UdeG), Universidad de Guadalajara, Jalisco, Mexico b

a r t i c l e

i n f o

Article history: Received 23 March 2011 Received in revised form 31 May 2011 Accepted 1 June 2011 Available online 6 August 2011 Keywords: AMELY negative Sex-typing Gender-typing Mexican population AMELY deletions

a b s t r a c t The amelogenin represents the gender marker most widely used for human identification and biomedical purposes. However, some failures in sex-typing have been observed globally. In this study, we could approximate the population frequency of AMELY negative males in 1230 individuals from five states of Mexico (0.081%). For the sole AMELY negative male detected, we constructed a deletion map by means of 10 markers (7 STS and 3 Y-STRs). This allowed classifying the case into the most common category (Class I deletion), according to the nomenclature proposed by Jobling et al. (2007). Interestingly, the Mexican sample was R1a1⁄, a Y-chromosome haplogroup non-previously reported for AMELY negative cases. The geographic distribution of R1a1⁄, and the Y-STR haplotype similarity with a reported case from Slovenia, suggests an Eastern-Europe paternal origin for this case from Mexico. To our knowledge, this is the first report in Latin America that implies a low population frequency and European paternal origin of AMELY negative cases. Ó 2011 Elsevier Ireland Ltd. All rights reserved.

1. Introduction The amelogenin probably represents the marker most widely employed for gender determination, human identification and biomedical purposes. Several commercial multiplex PCR kits used in forensic genetics have incorporated this locus to establish the gender of biological samples, which has primary importance during the investigation process. Nevertheless, some failures in gender typing have been observed globally [1–3]. Some authors have argued that this ‘‘sex-typing error’’ is due to a rare mutation in the AMELY gene [2] whose frequency is higher in Indian groups than in other populations [4]. The incorrect sex designation of a male as ‘‘female’’ has serious consequences in prenatal diagnosis of Xlinked diseases, and this represents confusing evidence in forensic cases. Because of the lack of clinical manifestations, we can predict the frequency AMELY negative males is underestimated, and the real impact for human identification purposes is unknown in the majority of populations. Although ideally the information of AMELY negative individuals could be improved including data from paternity and forensic cases without additional cost, probably they are ⇑ Corresponding author. Address: Instituto de Investigación en Genética Molecular, Centro Universitario de la Ciénega, Universidad de Guadalajara (CUCI-UdeG), Av. Universidad # 1115, Col Paso Blanco, CP 47810, Ocotlán, Jal., Mexico. Tel.: +52 392 92 500 26x8363; fax: +52 392 92 57112. E-mail address: [email protected] (H. Rangel-Villalobos). 1344-6223/$ - see front matter Ó 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.legalmed.2011.06.001

not reported because they do not constitute a relevant fact, either for the study’s conclusion or for the laboratory’s interests. This fact justifies carrying out straight analysis concerning the structural variation and population distribution of these cases. Presently, the largest study included 45 AMELY deletion males from 12 Asian and European populations, predominating the Y-chromosome haplogroups J2e1⁄ and R1b3, respectively [5]. Although this effort allowed proposing a nomenclature of five deletion classes (I, I-s, II, III and IV), eventually one AMELY deletion pattern that does not correspond with the cited nomenclature was reported [6]. Respect to AMELY negative males in Latin-America, we did not find previous reports concerning the population frequency and/or structural characterization. This is interesting because admixed individuals, also described as Mestizos, have peculiar genetic admixture patterns including different proportions of European, Amerindian, and African components. Particularly in Mexico, significant differences of these admixture proportions have been inferred by means of autosomal short tandem repeats (STRs) and Y-linked STRs (Y-STRs) commonly employed for human identification purposes [7,8]. In this study we approximate the population frequency of AMELY negative males in a Mexican population sample including five states. Additionally, we described the deletion map and ancestral origin of the unique case detected by means of autosomal STRs, Y-STRs, and Y-linked single nucleotide polymorphisms (Y-SNPs).

263

J.S. Velarde-Félix et al. / Legal Medicine 13 (2011) 262–264

2. Materials and methods DNA was extracted from blood samples obtained of 1230 Mexican-Mestizos from five states located in different geographic regions, as follows: 948 from Sinaloa (Northwest); 14 from Durango (Northwest); 55 from Veracruz (Center); 113 from Oaxaca (South); and 100 from Chiapas (Southeast). All volunteers signed an informed consent to participate in this study approved by the Ethical Committee of the Hospital General de Culiacán ‘‘Dr. Bernardo J. Gastélum’’. The analysis of the AMELY marker in all samples was based on the report of Sullivan et al. [1]; we amplified a 106 bp fragment of the X chromosome, and another fragment of 112 bp representing the Y-homologue. For the sole AMELY negative individual found in this study, the gender was confirmed amplifying the male-specific SRY gene fragment (270 bp) [9], in agreement with his phenotype. In addition, we constructed a deletion map including seven additional sequence-tagged-sites (STS) and three Y-STRs nearby to AMELY. We used three primer sets of STSs described by Jobling et al. [5] to amplify Y-specific sequences in blocks of XY-homology (Y690K, sY874Y, and sY42Y), and four additional Y-linked STS described in Table 1. All these markers were observed in 6% (29:1) polyacrylamide gel electrophoresis followed by silver staining. Positive (male DNA) and two negative controls (female DNA and water) were employed in all PCR assays. In addition, for this sample we obtained the autosomal DNA profile with the commercial kits PowerPlexÒ 16 (Promega, Corp.), and AmpFlSTRÒ Identifiler™ (Applied Biosystems). Similarly, Y-filer™ kit (Applied Biosystems), was employed to obtain the Y-chromosome profile based on 17 Y-STRs. PCR amplifications and capillary electrophoresis were carried out following the manufacturer’s recommendations. Alleles were named according to allelic ladders provided with the kits using the software Genotyper 3.2 in the Genetic Analyzer ABI Prism™ 310 (Applied Biosystems). Additionally, the Y-linked haplogroup of this sample was defined by SNaPshot™ analyzing the following Y-SNPs: M3, P25, M96, M207, M217, M174, M9, M35, M168, M170, M175, M201, M216, M304, M17, M242 and

M45. Primers and conditions for PCR multiplex, SBE reaction, and capillary electrophoresis were based on a previous report [10]; excepting for M242 (forward 50 -cggcatagaaagtttgtgcaa-30 and reverse 50 -ttacctagaacaactctgaagcgg-30 primers [1 lM]), and M3 (forward 50 -gccagggctttcaaataggt-30 and reverse 50 -ggcatctttcattttag gtaccag-30 primers [1 lM]). These two Y-SNPs were specially designed in this work to be included in the SNaPshot™ in order to define the Amerindian origin. We applied the updated nomenclature for haplogroups according to the Y-Chromosome Consortium [11]. 3. Results and discussion A sole male of 1230 individuals presented an AMELY negative result typical of an XX female, which did not match with his phenotype. He was a 33 years-old male who assisted in November 2007 as healthy blood donor to the Hospital General of Culiacan, in the state of Sinaloa, Mexico. He authorized to provide a second blood-sample to corroborate his genotype; unfortunately, paternal relatives were no available to confirm the findings. Based on these data, the approximated population frequency of AMELY negative males in Mexico is relatively low (0.081%). In previous reports from Indian, Austrian, Singapore, and Malaysian populations, the estimated frequency of the AMELY deletion was 3.2–3.6%, 0.6–0.88%, 0.02%, and 2.7%, respectively [4,12–14]. To our knowledge, this estimate from México constitutes the first of Latin American populations. Because a mutation in the annealing region of the reverse amelogenin primer has been reported that causes the ‘‘sex-typing error’’ [2], we tried to amplify another region of the AMELY gene with alternative primers described by Steinlechner et al. [12]. However, this alternative assay failed to amplify the product representing the amelogenin Y-homologue (225 bp), suggesting the existence of a deleted region. Supporting this hypothesis, we observed a negative amplification of DYS458, the nearest Y-STR locus to the AMELY gene, rendering a partial Y-STR haplotype for Y-filer™

Table 1 Primer sets and GenBank accession number of the additional STS loci employed for deletion mapping of the Mexican AMELY negative male.

a

STS name

Forward

Reverse

Size (bp)

GenBank

sY1241 sY1079a sY1219 sY59

aggctactgtgaatcacgcc ggaaaattttgatatgcccaa ccagacgttctaccctttcg aaatctgtacattcctaacagcg

gtgcatgtgttccctttgtg ctgcagaaatcacatggacag ctcccttggttcatgccatt tgcaaaggatggatttttgt

508 246/295 298 267

G75487 G66115 G75484 G11990

A duplicated locus, the 246 bp fragment is the one nearby to AMELY gene.

Table 2 DNA Profile of the AMELY negative sample from Mexico, based on Y-SNPs, Y-STRs and autosomal STRs.

a b c

Y-SNPa

M174

M242

M217

M3

M207

P25

M96

M45

M170

Allele

0 M304 0

0 M35 0

0 M216 0

0 M17 1

1 M175 0

0 M201 0

0 M168 1

1 M9 1

0 HGPO R1a1⁄

Y-STRb

DYS456

DYS389I

DYS390

DYS389II

DYS458

DYS19

DYS385

DYS393

Allele

15 DYS391 10

14 DYS439 12

24 DYS635 23

32 DYS392 12

– H4 12

16 DYS437 14

12–13 DYS438 11

13 DYS448 20

Autosomal STRc

D8S1179

D21S11

D7S820

CSF1PO

D3S1358

TH01

D13S317

D16S539

D2S1338

Genotype

10/13 D19S433 11.2/15.2

30 vWA 14/16

9/11 TPOX 8

11 D18S51 12/14

15 D5S818 9/11

6/9.3 FGA 20/21

11/12 Penta D 12/13

11/13 Penta E 10/14

16/17 AMELY X

Derived (1), Ancestral (0). Based on the kit Y-filer (Applied Biosystems). Based on the kit Identifiler (Applied Biosystems) and Powerplex 16 (Promega, Corp.).

264

J.S. Velarde-Félix et al. / Legal Medicine 13 (2011) 262–264

are helpful to evaluate the impact of this deletion for biomedical and human identification purposes. In brief, we approximated the population frequency of AMELY negative males in Mexico (0.081%). The unique case here described presented the most common deletion map (Class I), but a distinctive Eastern European paternal origin (R1a1⁄). Acknowledgments

Fig. 1. Deletion mapping data based on the STS and Y-STRs employed in this study. Class I–IV describe the AMELY deletions nomenclature proposed by Jobling et al. [5].

kit (Table 2), as has been previously described [15]. For this reason, we constructed a deletion map including seven additional STS (Fig. 1); thus, we were able to classify the deletion map of the Mexican AMELY negative male as Class I, according to the nomenclature proposed by Jobling et al. [5]. In order to investigate the ancestral origin of the AMELY deletion case, we obtained his DNA profile based on two commercially available human identification kits based on autosomal STRs (Table 2). In both cases, the Y-chromosome fragment of AMELY marker was not observed; in agreement with the genotype previously established. Furthermore, we could infer his Euroasian origin by means of PopAffiliator (http://cracs.fc.up.pt/~nf/str/), an online calculator for the individual assignment to a major population group [16]. Subsequently, we confirmed a paternal European origin of the AMELY deletion male from Mexico, based on the derived state of the Y-SNP M17 that defines the haplogroup R1a1⁄ (Table 2). Considering the well-known Spanish ancestry of the Mexican population [7], this result is slightly unexpected because R1a1⁄ is mainly observed in Eastern Europe and is (almost) absent in the rest of Europe [17]; especially in Spain where R1b⁄ is the most frequent haplogroup [10]. In addition, the Y-STR haplotype of the Mexican sample was very similar to one from Ljubljana, Slovenia (matching for 8 of 14 alleles). Although the haplogroup was not reported for that sample, all the allele differences involve one-step mutations, suggesting a common paternal origin of the Slovenian and Mexican AMELY negative samples. In agreement with this hypothesis, the higher frequency of R1a1⁄ is observed in Eastern Europe [17], where Slovenia is located (>30%). Nevertheless, based on historical records [7], the AMELY deletion sample probably arrived to Mexico via Spaniards, in agreement with the Spanish-derived last name of the individual. Interestingly, in the paper of Jobling et al. [5], and in the AMELY deletion database (http://www.yhrd.org/Research/Amelogenin+Y+ deletions), the haplogroup R1a1⁄ had not been reported. In fact, J2e1⁄ and R1b3 are the most common haplogroups of the Class I, the deletion pattern found in the Mexican sample. However, this not surprising taking into account the significant levels of structural variants reported for the TSPY1 region that involves the AMELY gene [18], which explains the variation of deletions that has been observed in different studies [5,6]. It is of particular note that, to our knowledge, there has not been reported a single AMELY negative individual of Native American origin, which could have been observed in this study because of the elevated Amerindian component of the Mexican population [7,8]. In general, these data

We are grateful with all the participants, especially with the AMELY negative individual for his kind cooperation to confirm his genotype. This project was partially supported by the CECyT (Sinaloa state, Mexico) to J.S.V.F., and by the project CONACyT to H.R.V. (Grant 129693). We thank for facilities to PROFAPI of the Universidad Autónoma de Sinaloa (UAS). References [1] Sullivan KM, Mannucci A, Kimpton CP, Gill P. A rapid and quantitative DNA sex test-fluorescence-based PCR analysis of X-Y homologous gene amelogenin. Biotechniques 1993;15:636–42. [2] Shadrach B, Commane M, Hren C, Warshawsky I. A rare mutation in the primer binding region of the amelogenin gene can interfere with gender identification. J Mol Diag 2004;6:401–5. [3] Brinkmann B. Is the amelogenin sex test valid? Int J Legal Med 2002;116:63. [4] Thangaraj K, Reddy AG, Singh L. Is the amelogenin gene reliable for gender identification in forensic casework and prenatal diagnosis? Int J Legal Med 2002;116:121–3. [5] Jobling MA, Lo I, Turner DJ, Bowden GR, Lee AC, Xue Y, et al. Structural variation on the short arm of the human Y-chromosome: recurrent multigene deletions encompassing Amelogenin Y. Hum Mol Genet 2007;16:307–16. [6] Takayama T, Takada N, Suzuki R, Nagaoka S, Watanabe Y, Kumagai R, et al. Determination of deleted regions from Yp11.2 of an amelogenin negative male. Leg Med 2009;11(1):S578–80. [7] Rubi-Castellanos R, Martínez-Cortés G, Muñoz-Valle JF, González-Martín A, Cerda-Flores RM, Rangel-Villalobos H. Pre-Hispanic Mesoamerican demography approximates the present-day ancestry of Mestizos throughout the Territory of México. Am J Phys Anthrop 2009;139:284–94. [8] Salazar-Flores J, Dondiego-Aldape R, Rubi-Castellanos R, Anaya-Palafox M, Nuño-Arana I, Canseco-Ávila LM, et al. Population structure and paternal admixture landscape on present-day Mexican-Mestizos revealed by Y-STR haplotypes. Am J Hum Biol 2010;22:401–9. [9] Nakagome Y, Seki S, Fukutani K, Nakahori Y, Tamura T. PCR detection of distal Yp sequences in an XX true hermaphrodite. Am J Med Genet 1991;41:112–4. [10] Brion M, Sanchez JJ, Balogh K, Thacker C, Blanco-Verea A, Børsting C, et al. Introduction of an single nucleotide polymorphism-based ‘‘Major Ychromosome haplogroup typing kit’’ suitable for predicting the geographical origin of male lineages. Electrophoresis 2005;26:4411–20. [11] Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Res 2008;18:830–8. [12] Steinlechner M, Berger B, Niederstatter H, Parson W. Rare failure in the amelogenin sex test. Int J Legal Med 2002;116:117–20. [13] Yong RY, Gan LS, Chang YM, Yap EP. Molecular characterization of a polymorphic 3-Mb deletion at chromosome Yp11.2 containing the AMELY locus in Singapore and Malaysia populations. Hum Genet 2007;122:237–49. [14] Chang YM, Burgoyne LA, Both K. Higher failures of amelogenin sex test in an Indian population group. J Forensic Sci 2003;48:1309–13. [15] Drobnic K. A new primer set in a SRY gene for sex identification progress in for gen 11. Amsterdam: Elsevier; 2006. 268–270. [16] Pereira L, Alshamali F, Andreassen R, Ballard R, Chantratita W, Soo Cho N, et al. Online calculator for individual affiliation to a major population group based on 17 autosomal STR genotype profile. Int J Leg Med 2010. doi:10.1007/ s00414-010-0472-2. [17] Underhill PA, Myres NM, Rootsi S, Metspalu M, Zhivotovsky LA, King RJ, et al. Separating the post-Glacial coancestry of European and Asian Y chromosomes within haplogroup R1a. Eur J Hum Genet 2009;18:479–84. [18] Tyler-Smith C. An evolutionary perspective on Y-chromosomal variation and male infertility. Int J Androl 2008;31:376–82.