Deletions of mitochondrial DNA in Kearns-Sayre syndrome and ocular myopathies: Genetic, biochemical and morphological studies

3ournal of the Neurological Sciences, 101 ( t 991 ) 168 - 177

168

Elsevier

JNS 03473

Deletions of mitochondrial DNA in Kearns-Sayre syndrome and ocular myopathies: genetic, biochemical and morphological studies F. D e g o u l 1, I. N e l s o n 2, p. L e s t i e n n e 2, D . F r a n c o i s 1, N . R o m e r o 3, D . D u b o c 3, B. E y m a r d 3, M . F a r d e a u 3, G . P o n s o t 4, M . P a t u r n e a u - J o u a s 5, M . C h a u s s a i n 6, J . P . L e r o u x a a n d C. M a r s a c I IINSERM U. 75, 156 rue de Vaugirard, 75015 Paris (France), :INSERM U. 298, 49033 Angers (France), 31NSERM U. 153, 17 rue du Fer-~t-Moulin, 75005 Paris (France), 4Service de P~diatrie, Hrpital Saint-Vincent de Paul, 75674 Paris (France), 51NSERM U. 134, Hrpital de la Salp~tridre, 75651 Paris (France), and 6Exploration fonctionelle respiratoire, Hrpital Saint-Vincent de Paul, 74 avenue Denfert-Rochereau, 75674 Paris (France) (Received 22 May, 1990) (Accepted 9 October, 1990)

Key words: Kearns-Sayre syndrome; Ocular myopathy; Mitochondrial respiration; DNA deletions; Cytochrome c oxidase; Succinate cytochrome c reductase

Summary Genetic, biochemical and morphological investigations were conducted on skeletal muscle mitoehondria from 6 cases of ocular myopathy: 4 cases with Kearns-Sayre syndrome (KSS) and 2 with chronic progressive external ophthalmoplegia. All of these 6 cases showed mitochondrial DNA (mtDNA) deletions in addition to normal sized DNA in the quadriceps muscle.The deletions ranging from 3 to 8 kbp were also mapped between nucleotides 5500 and 16000 by Southern blot. The deleted genes encoded for some subunits of complexes I, IV, V and 5-10 tRNAS. The boundaries of the deletions have been sequenced in three patients. Five patients had mitochondrial respiratory chain deficiency in complex I as shown by the low oxygen consumption in isolated mitochondria using three NAD +-linked substrates. Mitochondria with an abnormal ultrastructure were also observed in 2 cases. A good relationship between the cytochrome c oxidase deficiency and the amount of deleted mtDNA was shown in our present investigations.

Introduction Progress has been made in clinical research following the observation that many patients with ocular myopathies have a defect in mitochondrial function (Morgan-Hughes et al. 1982; Di Mauro et al. 1985). The Luft's syndrome was the first case cited in humans with a mitochondrial defect in uncoupling of oxidative phosphorylation (Luft et al. 1962). Morgan-Hughes et al. (1988) subsequently reported patients with complex I deficiency. The molecular basis of such enzymatic defects was pointed out by the same group showing mtDNA deletions in patients presenting myopathies (Holt et al. 1988). mtDNA deletions in patients with Kearns-Sayre syndrome (KSS) were reported by Lestienne and Ponsot (1988) and subsequently by Zeviani et al. (1988) in a detailed report of 7 cases. These studies were extended by Moraes et al. (1989) in 32 cases, by Nelson et al. (1989) in 22 cases, and also by Johns and Hurko (1989), Shoffner et al. (1989), and Sato et al. (1989). Correspondence to: Dr. Francoise Degoul, INSERM 475, 156 rue de Vaugirard, 75015 Paris, France.

Human mtDNA is a circular double-stranded molecule of 16 569 base pairs in length (Anderson et al. 1981) which is exclusively maternally inherited (Giles et al. 1980). The mitochondrial genome encodes for 2 rRNAs, 22 t R N A s and 13 of the 67 polypeptides of the oxidative phosphorylation system: 7 subunits of complex I (NADH C0Q reductase), one subunit of complex III (apocytochrome b); subunits I, II, III of complex IV (cytochrome c oxidase) and subunits 6 and 8 of ATPase (complex V) (Chomyn et al. 1985). KSS is one of the variable clinical presentations of the mitochondrial myopathies. This multisystem disorder is characterized clinically by chronic progressive external ophthalmoplegia, pigmentary retinopathy and sometimes cardiac conduction block, ataxia, and a high cerebrospinal fluid protein content. Most patients exhibited sporadic ocular myopathies. Many cases have deficiency localized in the complex I, III, IV or V of the mitochondrial respiratory chain. To define the clinical phenotypes associated with mtDNA deletions and respiratory chain defects, we have studied 6 additional cases of ocular myopathies by biochemical and mtDNA analysis. Electron microscopy of

0022-510X/91/$03.50 © 1991 Elsevier Science Publishers B.V. (Biomedical Division)

169 isolated mitochondria was also conducted in conjunction on 5/6 of patients. Our results emphasize the reliability of mtDNA structure in the diagnostic procedure.

Methods

Case reports The clinical characteristics of 6 patients are summarized in Table 1, with 4 cases (nos. 1, 3, 4, and 6) of KSS. All cases were sporadic. Fresh muscle biopsies Quadriceps muscles (about 1 g) were obtained under local anesthesia and divided for mitochondrial preparation and DNA analysis. Southern blot analysis cf mtDNA DNA from 30-50 mg fresh or frozen muscle was extracted by overnight digestion at 37 °C with proteinase K (100 #g/ml) in 0.5 ml of 40 mM Tris-H CI (pH 8) containing 0.4 M NaCI, 10 mM EDTA and 0.5 °/ SDS. DNA was /o then extracted with pure phenol, phenol/chloroform mixture (1:1, v/v), precipitated with 2 volumes of absolute ethanol and 0. l M NaCI and then dissolved in 25 mM Tris-HCl, 1 mM EDTA buffer, pH 8.0. Samples of DNA (0.5 #g) were subjected to digestion with a 10-fold excess of restriction endonucleases according to the manufacturer's instructions. The reaction products were then separated by electrophoresis on a 0.8% agarose gel and stained with ethidium bromide prior to Southern blotting (Southern 1975). Probe was total mitochondrial DNA purified from human placenta (Drouin 1980). The mapping of the deletions was as reported before (Nelson et al. 1989). Proportion of the deleted molecule was estimated from densitometric scanning (Helena Scanner) of the autoradiogram, after correction by the molecular weight. DNA amp#/ication This was performed using the polymerase chain reaction (Saiki et al. 1988). The DNA fragment encompassing the deletion junction was amplified in vitro in all 6 cases, cloned and sequenced in 2 cases (patients 5 and 6) and directly sequenced in case 2 (Bachmann et al. 1990). One/,g of total DNA was amplified in I00 #1 reaction mixture containing 10 mM Tris-HCl (pH 8.5), 50 mM KC1, 2 mM MgCI 2, 0.01 °,o (w/v) gelatin, 0.2 mM of each dNTP, 10"o DMSO (v/v), 0.13o (v/v)Triton X-100, 30 pmol of each primer and 2.5 U Taq polymerase (Promega). The amplification was performed with 1 cycle of 5 rain denaturation at 90 °C, 2 rain annealing at 55 °C, 4 rain at 70 °C, 34 cycles of 2 rain at 90 °C, 2 rain at 55 °C, 4 rain at 70 °C with 10 rain at 70 °C for elongation in the last cycle.

Preparation of muscle mitochondria Mitochondria were isolated according to MorganHughes et al. (1977), Fresh muscle biopsy (0.7 g) was washed and finely minced with scissors in an ice-cord high EDTA medium (pH 7.4) containing 210 mM mannitol, 70 mM sucrose, 50 mM Tris-HCl and 10 mM dipotassium EDTA. The minced muscle was incubated in ice for 30 rain with trypsin Sigma type Ill (0.5 mg/g muscle) and the reaction was ternqinated with an excess (3:1, w/w) of soybean trypsin inhibitor. The muscle was then homogenized twice for 5 sec duration in the ice-cold medium using a Janke and Kunkel Ultra-Turrax (Model T 25) prior to centrifugation at 1000 x g for 5 rain at 4 °C. The supernatant (S~) was spun at 8000 x g at 4 °C for 10 rain. The crude mitochondrial pellet (C~) was resuspended by muddling in 2 ml of a low EDTA medium (mannitol 225 raM, sucrose 75 raM, Tris-HCl 10 raM, K2 EDTA 0.1 raM, pH 7.2) and centrifuged at 1000 x g, for 5 rain at 4 ° C. The resulting supernatant was centrifuged at 8000 × g for 10 rain and the purified mitochondrial pellet (C4) was suspended in a minimum volume of low EDTA isolation medium at a final concentration of between 20 and 40 mg mitochondrial protein/ml. Protein concentration was determined by the BCA procedure (Smith et al. 1985). Polarographic studies with purified mitochondria Oxygen consumption was measured with a Clark-type oxygen electrode (Morgan-Hughes et al. 1977) in a total volume of 0.5 ml respiratory buffer (mannitol 75 raM, sucrose 25 raM, KC1 100 raM, Trizma-phosphate I0 raM, K 2 EDTA 50/~M, Tris-HCI 10 raM, pH 7.4) at 25 °C using a Gilson oxygraph (Model 5/6). Various substrates donating reducing equivalents to different sites of the respiratory chain system were investigated. The NAD +-linked substrates, pyruvate (5 raM) glutamate (I0 raM) and palmitoyl carnitine (80 #M) each added with malate (2.5 raM), and succinate (10 raM) were used. The state 3 - state 4 transitions for the oxidation of these substrates were induced with small additions (125 nM) of ADP. Oxygen consumption, expressed in ng atoms O. min ~/mg protein, and the values of the respiratory control ratio (RCR) were determined. Enzymes in intact muscle mitochondria Succinate cytochrome c reductase (SCR or complex It +III), cytochrome c oxidase (COX or complex IV) and citrate synthase (CSase) activities were measured on the supernatant (S ~) of the first low centrifugation ( 1000 x g) and on freshly isolated mitochondria (C4) by spectrophotome-

170

tric methods (Cooperstein and Lazarow 1951; MorganHughes et al. 1977) in 25 mM phosphate buffer (pH 7.4). Citrate synthase activity was carried out with and without Triton X-100 to test the integrity of the inner mitochondrial membranes and was used as a matrix control of mitochondrial activity. The cytochrome c oxidase and succinate cytochrome c reductase activities were expressed per mg protein and unit of citrate synthase.

Electron microscopic observations of isolated mitochondria As soon as isolated, mitochondria (0.075-0.15 mg protein) were fixed in suspension in 500/~1 of 2.5 ~o glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.4) at 0 ° C. After 10 min they were centrifuged and the mitochondrial pellets were allowed to fix for 2 h at 0 ° C. After fixation, the mitochondria were washed in the same buffer containing 0.25 M sucrose at 4 °C, post-fixed in 2~o OsO4 in 0.1 M sodium cacodylate buffer (pH 7.4) for 1 h at 4 °C, rinsed in distilled water, and dehydrated in a series of graded ethanol before embedding in Spurr's resin either in situ or in a flat mould. Polymerization was carried out for 12 h at 70 °C. Ultrathin sections were cut on a Reichert ultramicrotome equipped with a diamond knife. They were stained in a saturated aqueous solution of uranyl acetate diluted 1 : 1 in acetone for 30 rain at 37 °C followed by lead citrate for 3 min at room temperature before examination in a Philips EM-300 electron microscope at an accelerating voltage of 60 kV.

TABLE 1 CLINICAL AND BIOLOGICAL CHARACTERISTICS O F 0 PATIENTS WITH KEARNS-SAYRE SYNDROME OR OPHTHALMOPLEGIA N, n o r m a l : D, decrease; - , absent; -~, present. Patients:

1

2

:

4

5

6

Sex

M

F

~rI

M

~

~-

Age (yrs) at onset at biopsy

7 27

3t 51

IX 25

10 ~1

28 45

4 31

None

None

None

None

None

None

F a m i l y history P i g m e n t a r y retinal degeneration Ptosis and ophthalmoplegia H e a r t block Muscular weakness Cerebellar dysfunction Carnitine muscle serum

M

1

+

-

~

~

+ + +

~-

~

+

~

+ * +

÷

.

D D

N N

23

.

.

. N N

456

.

.

.

+ + .

.

N D

. N N

+ . N N

c

Results 21.~

Clinical and biological characteristics Six adult cases (3 males, 3 females) with ptosis, ophthalmoplegia and muscular weakness were investigated (Table 1). None of these patients has familial history of these disorders. KSS patients, 3 males (cases 1, 3 and 4) and 1 female (case 6), had heart block, and the onset of the defect occurred at an earlier age than patients (cases 2 and 5) affected with ocular myopathy. Three KSS patients (1, 3, 4) have also developed pigmentary retinal degeneration but only the severely affected KSS patient (case 1) showed cerebellar dysfunction and carnitine deficiency in serum and muscle. Cases 1 and 4 were the most affected clinically. Southern blot analysis of mtDNA Figure 1 illustrates the Southern blot analysis ofmtDNA in all the 6 patients investigated. In the muscle samples, a shorter mtDNA molecule was found to hybridize with purified mtDNA from human placenta in addition to the normal sized 16 569 bp species. They correspond to a deleted molecule which was subsequently mapped by analyzing the

5.1 4.2 3.5

2D 1.9

Fig. 1 S o u t h e r n blot analysis of m t D N A from 6 patients. Total D N A was digested by P v u l I and p r o b e d with h u m a n m i t o c h o n d r i a l DNA. In all cases, an a d d i t i o n a l molecule to the n o r m a l one c a n be seen. Size of deletion and p r o p o r t i o n of deleted m t D N A were variable. N u m b e r s indicate patients, respectively: lane C shows n o r m a l p a t t e r n of mtDNA

171 ( a s e 2 deletion = 3512 bp GCTG GTTTCAAGCCAAC(CCCATGGCCTCCA .... CATGGCAAGCCAAC)GCCACTTATCCA GTG tRNA.ser 7491 11004 ND4 Case 5 deletion = 8136 bp TTGA AGCTGCTT(CTTCGAATTTGCA ATTCa~....TACTCGGATTCTA)CCCTAGCATCACCACG tRNA cyst 5786 13923 ND5 Case 6 deletion = 4977 bp

CI ACCTCCCFCACCA(AAGCCCATAAAAATA....CAACCTCCCTCACCA)TTGGCAGCCTAGCT AYPase 8

8482

13460

ND5

Fig. 2. Boundaries sequences in mutant gem)me.

deleted genome for the presence or the absence of known restriction sites on the mtDNA molecule (Table 5). These data lead us to conclude that the clinical features do not rely simply on the genetic defects at the position of the mtDNA deletions, though heteroplasmic deletion appears to be the common feature. Deletion boundaries (Fi,gs. 2 and 3)

The regions containing the deletion junctions were amplified by PCR using selected oligonueleotides primers for the 6 deleted mtDNA. Three cases present the same amplification products

using the same olignonucleotides (cases 1, 4, 6). However, the amplified fragment was cloned and sequenced for patient 6. The breakpoint occurred at position 8470-13 447 or 8482-13459 {Fig. 4) with a direct repeat of 13 nucleotides in the flanking sequences of the deletion (4977 bp). We speculate that for the two other patients (cases 1 and 4), the deletion occurred at the same nucleotide level since amplification products and their restriction products gave the same pattern. For patient 2, a deletion of 3512 bp occurred at nucleotidic position 7483-10996 or 7491-11004 showing a direct repeat of 8 bp. In patient 5, a deletion of 8136 bp occurred at nucleotide position 5786-13923 without

@ )

Fig. 3. Isolated skeletal muscle mitochondria from case 3, fixed as in Fig. 5. A predominant proportion of normal organelles exhibiting well differentiated and organized cristae is seen. Bar 0.5 #m.

172

ADP (i.e., state 3 respiration) were Lower than in the controls for the NAD + -linked substrates tested for cases 1, 2, 4, 5 and 6. These results showed that complexes I were abnormal because they were very' instable in all these 5 cases. The state 3 rates for succinate oxidation were lower than controls in cases 2, 4, 5 and 6. In the most severely affected KSS patient (case 1), the values for the RCR for the oxidation of glutamate + malate, and of succinate were lower than normal.

Enzymatic assays

G A

T

Enzymatic studies of the respiratory chain complexes (complexes II, III and IV) were performed on the fresh supernatant of the first centrifugation ($1) and on fresh isolated mitochondria from muscles o f 6 patients with KS S or ophthalmoplegia. Results are shown in Table 3. Complex I activity is more difficult and less sensitive to study by spectrophotometric methods than by polarographic methods. Results are not expressed here. Succinate cytochrome c reductase activity (complexes II + l I I ) was normal in all cases. Cytochrome c oxidase activity (complex IV) was below the normal value in 3 (cases 1, 2 and 4) out of 6 patients, suggesting a partial defect of this enzyme. This defect is confirmed when the COX activities are expressed per unit of CSase as illustrated in Table 4. The SCR

C

Fig. 4. Sequence ofa deletionjunction zone (patient 6). Deleted molecule was amplified with oligonucleotides: PLI (5'GGATCCATGCCCATCGTCCTAGAATT3') and PLI 7(5' CTGCAGGCGATC,-GCTATT G A G G A G T A 3 ' ) cloned in M 13 and the single template was sequenced by the dideoxy-termination chain using the sequenase kit (USB). Arrows indicate the 13 nucleotides repeat which are at position 8470-8482 or 13447-13459 in the normal molecule. The deletion junction sequence is:

ATPase8

8470 8482 ACCACCTACCTCCCTCACCATTGGC 13447 13459

ND5

TABLE 2 POLAROGRAPHIC STUDIES Results are expressed in ngatoms O/min/mg protein at 25 ~C and refer to respiration in the presence of A D P (state 3 rate). The values in parentheses indicate the respiratory control ratio (RCR) for the various substrates. Each determination has been performed in Separate polarographic assays. Patient

Polarographic studies of purified mitochondria Polarographic results of isolated mitochondria from skeletal muscle of the 6 patients with KSS and chronic progressive ophthalmoplegia are shown in Table 2. The maximum rates of oxygen uptake in the presence of

Pyruvatc + malatc

PalmCarn + malate -

Rotenone + succinatc

102

57*

(2.5)

(3.8)

45* (2.0) 137 (6.2) 109 (4,6) 81 (3.5) 78 (4.4)

41" (1,9) 89 (8) 67* (4.1) 60* (2.5) 20* (l.0l

52* (2.3) 76 (2.5) 32* (3.3) 82 (2.7) 38* (2.3)

55* ( 1,0} 88 (1,6) 64* (2.0) 50* (,!,3) 29* (1.0)

Controls Mean + SD RCR

114+39 (5.1 _+ 1.6)

115 + _ 4 2 (4.9 + 2.1)

109+_31 (3.6 + 1.3)

109,+32 (2.2 + 0,7)

n

15

14

S

16

1

repeated sequence. The deleted genes encoded for subunits of complex I (all cases), complex III (case 3) and complex IV and V (cases I, 2, 4, 5 and 6) (Table 5). Deletions also include 5 to 10 tRNA genes. The ratios of deleted mtDNA to normal mtDNA varied from 25 to 80~o for the muscle mtDNAs. Patients (cases 2, 3, 5 and 6) had less deleted mtDNA than normal, but the 2 severely affected KSS patients (cases 1 and 4) showed more deleted mtDNA than normal mtDNA.

Glutamate + malate

2 3 4 5 6

* Lower than normal values. SD = Standard deviation.

110

(~.2!

173 activities were however normal in all of the 6 patients investigated as shown by the values SCR/CSase (Table 4). Table 5 summarizes the respiratory chain complex deficiencies and characteristics of mtDNA deletions in the 6 patients investigated. Three out of 4 KSS patients (cases 1, 4 and 6) with similar deletions displayed complex I deficiency. Two out of three patients (cases 1 and 4) also had complex IV deficiency. The percentage of deleted mtDNA was higher in patients 1 and 4 than in patient 6. These patients have deleted genes coding for subunits of complexes I, IV and V. The lack of complex IV defect in patient 6 may thus be explained by the higher proportion of the normal sized mtDNA. Surprisingly, patient 3 who displayed a 4 kb deletion of mtDNA did not present any detectable enzymatic defect. However it is worthwhile to O/ note that the proportion of the deleted genome was 30/o, an amount which may not be sufficient to induce detectable enzymatic defects. In the ocular myopathy patient (case 2) with a deletion (3512 bp) of 401'o mtDNA which encompasses genes encoding for subunits of complexes I, IV and V, deficiency in complexes I and IV was observed. In the second ocular myopathy patient (case 5), with 25 ~; deleted mtDNA, only complex I deficiency was observed. This patient however, showed a 8136 bp deletion encompassing genes coding for complexes I, IV and V subunits,

TABLE 3 SPECTROPHOTOMETRIC ASSAYS This table summarizes the mitochondrial activity ofcytochrome c oxidase (COX), succinate cytochrome c reductase (SCR) and citrate synthase in supernatant ($1) of the first centrifugation (1000 x g) and in mitochondrial pellet (C4) expressed per mg proteins, investigated in the 6 cases and control patients. Patient

COX (complex IV)

SCR (complexes II + l l l )

CSase

S I

C4

S1

C4

S I

C4

117" 271" 948 389 485 358

2297 1268" 2582 1653" 3841 2455

46 37 68 115 36 31

327 270 288 809 401 325

137 312 523 625 433 207

3548 1449 1665 3499 2280 2718

464 131 9

2582 626 14

59 18 9

534 206 14

242 66 9

2153 402 13

These data lead us to conclude that no direct correlation may be found between the location (size and site) of the deletion and all the enzymatic activities of the respiratory chain. In opposite, these results suggest a positive correlation between the amount of deleted mtDNA, the severity of the cytochrome c oxidase deficiency and the gravity of the clinical features. But we have not enough cases to confirm this result by a statistical test.

Electron microscopy o["isolated mitochondria Several types of abnormal mitochondria were observed particularly in patients 2 and 4 with up to 800o deleted mtDNA (Fig. 5 a and b). They were frequently enlarged and contained little or no cristae. Some contained voluminous osmiophilic inclusions or concentric quadrilamellar structures. However, the most striking feature was the presence of a large vacuolar lattice which decreased the matrix compartment. This abnormal feature affected up to 30°; of the isolated organelles in the most severely affected case (case 4). In these patients, the respiratory chain activity was no longer normal (complexes I and IV deficient: Table 5). In 2 other patients (cases 3 and 6) a variable proportion of the isolated mitochondria showed normal configuration.

Discussion

The present investigation extends earlier studies showing mtDNA deletions and defects in the mitochondrial respiratory chain system in KSS and ocular myopathy in humans (Lestienne and Ponsot 1988; Romero et al. 1989; Zeviani et al. 1989; Moares et al. 1989: Nelson et al. 1989).

TABLE 4 M I T O C H O N D R I A L ACTIVITIES OF CYTOCHROME C OXIDASE (COX) AND SUCCINATE CYTOCHROME C REDUCTASE (SCR) Results are expressed per unit of citrate synthase (CSase), in supernatant (S ~) of the first centrifugation ( 1000 x g) and in mitochondrial pellet (C4). Patient

I 2 3 4 5 6 Controls Mean SD n

All assays were performed at 2 different protein concentrations and values are the mean of the 2 determinations. n = number of determinations. * Defect in complex activity.

COX/CSase St 0.55* 0.73* 1.50 0.62* 2.50 1.72

1

2 3 4 5 6 Controls Mean SD tl

* Defect.

1.9 0.4 9

SCR/CSase C4 0.65' 0.68* 1.55 0.47* 1.68 1.44

1.3 0.3 10

S1 0.21 0.20 0.18 0.20 0.19 0.22

0.3 0.1 10

C4 (;.19 0.20 0.17 0.23 0.17 0.19

0.3 0. I 10

174

IABLE 5 SUMMARY OF RESPIRATORY CHAIN COMPLEX DEFICIENCY AND CHARACTERISTICS OF mtDNA DELETIONS

KSS(M ) OM(F) KSS(M) KSS(M ) OM(F) KSS(F)

Patient

Affected complex

Length (kb)

Location of deletion

Deleted mtDNA ( 0',,)

1 2 3 4 5 6

I,IV 1,IV Nonc I,IV I I

5* 3.512 4.5 5* 8.136 4.977*

ATPase8-ND5 tRNA ser-ND4 ND4-Cyt.b ATPase8-ND5 tRNA cyst-ND5 ATPase8-ND5

68 40 30 80 25 34

Abbreviations: KSS, Kearns-Sayre syndrome; OM, ocular myopathy; F, female; M, male. * Common mtDNA deletion. Our data present sequences of three deletion junctions, two obtained by cloning and the last by direct sequencing. Patient 6 presented the common deletion identical to those described by others (Schon et at. 1988; Rotig et at. 1989; Holt et at. 1989; Shoffner et al. 1989) whereas the 2 others (cases 2 and 5) were not described until now. In 2 out of 3 patients, repeated sequences were found at the edges of the deletion boundaries supporting the hypothesis of recombination as a major cause of deletions in human mitochondrial DNA (Mita et at. 1990). Proteins arising from junction zones of the mtDNA deleted molecules would be truncated or would form a hybrid protein. Neither hybrid protein nor truncated translation product from mutant genome have so far been detected. Two patients with ocular myopathy (cases 2 and 5) could correspond to the mild form of KSS described by Schon et al. (1989) since the onset was observed in adults (i.e., 28 (case 5) and 31 (case 2) years of age). We show an association of complex I and IV defects in patients with KSS and with ocular myopathy as previously described by other workers (Sherratt 1984; Mizuzawa et al. 1988; Bleistein and Zerz 1989). Polarographic studies (Table 2) have shown a defect in complexes I, II and III in 3 KSS patients (cases 1, 4 and 6) and 2 patients (cases 2 and 5) with ocular myopathy. The succinate oxidase system (complexes II and III) was, however, found to be normal by enzymatic studies (Table 4). This discrepancy could also be attributed to the instability of the isolated organelles, since the first polarographic study conducted for the oxidation of glutamate + malate was normal in 5 out of the 6 cases. For this reason, the quantitative analysis of the complex I deficiencies have not been performed. Nevertheless, complex IV deficiencies seem to be well correlated with the severity of the clinical features (the 2 most affected patients had the most severe defects) and with the percentage of the deleted mtDNA. The activities of the mitochondrial respiratory chain complexes have been reported in preparations from frozen

(TurnbuU and Sherrat 1987) or fresh muscle biopsy sample (Morgan-Hughes et al. 1982), Results obtained from frozen muscles are probably not ideal as compared with those from fresh muscles, particularly to identify complex I deficiency. Mitochondria isolated from frozen muscle might give rise to artefacts in complex I activity which is the less stable complex in the respiratory chain system (Cheah and Cheah 1974). In cases 2 and 4 numerous isolated mitochondria exhibited abnormal ultrastructural configurations. The formation of similar mitochondriaI inclusions has been induced both in situ and in vitro by prolonged aging (24 h or more at 0 ° C, Cheah and Cheah 1977), or by a number of drugs such as clofibrate (Bardoni et al, 1985) or uncouplers or oxidative phosphorylation (Byrne et al. t985). Although these abnormal mitochondria are likely implicated in the functional defects observed, they should not be considered as primary or specific lesions for a particular disease (Fardeau 1970). However, in the reported patients, the functional integrity of the respiratory chain was related with the morphological integrity of the mitochondria. Nuclear and mitochondrial DNA gene products contribute to the correct complexes. However. as shown in the present study, important structural mtDNA variauons may be hidden at the enzymatic level by the presence of the normal mtDNA molecule which is able to complement to a certain extent the mt genomtc defect (heteroplasmic genomes). Furthermore the spontaneous occurrence of KSS excludes any maternal inheritance characteristic of the mitochondrial genome (Giles et al. 1980). Hence the present study demonstrates the unususal advantage of performing mitochondrial DNA structure analysis with enzymatic data on fresh muscle as diagnostic procedures of KSS and CPEO. Enzymatic defects of the respiratory chain complexes are the frequent but not constant traces of the mtDNA genetic disorder as shown in this study. Five out of 6 patients have complex I deficiency and a threshold of 40~o deletion in mtDNA is suggested to be essential for the expression of COX deficiency in KS S and

175

Fig. 5. lsolated skeletal muscle mitochondria from cases 2 and 4, respectively, fixed in glutaraldehyde and osmic acid. Numerous abnormal organelles are seen (arrow heads), especially in b (case 4) showing dilated intracristal space, disappearance of cristae, and a densified matrix compartment. Bar = 0 5 ~m.

ocular myopathy as shown by our study (Table 5). However, the threshold might be different when studies are performed with more biopsy samples per patient and in different skeletal muscles or in other tissues. Acknowledgements We thank Professor J. Clark (Department of Biochemistry, University of London, England) and B. Kadenbach (Biochemie, University of Marburg, FRG) for helpful discussions. The Association Fran~aise contre les Myopathies (AFM) is gratefully acknowledged for supporting fellowship to F. Degoul, I. Nelson and N. Romero and grants to Drs. Marsac and P. Lestienne.

References Anderson, S., A.T. Bankier, B.G. Barrel, M.H.L. De bruijn, A.R. Coulson, J. Drouin, I.C. Eperon, D.P, Nierlich, B.A. Roe, F. Sanger, P.H. Schreier, A.J.H. Smith, R. Staden and I.G. Young (1981) Sequence and organization of the human rnitochondrial genome. Nature, 290: 457-465. B achmann, B., W. Luke and G. Hunsmann (1990) Improvement of PCR amplified DNA sequencing with the aid of detergents. Nucleic Acid Res., 18: 1309. Bardoni, A., P. Scheidt and H.I~,. Goebel (1985) Mitochondrial myopathy: a result of clofibrate/etofibrate treatment. Acta Neuropathol. 229: 101-108. Bleistein, J. and S. Zierz (1989) Partial defects of complexes 1 and IV of the mitochondrial respiratory chain in skeletal muscle of two patients with mitochondrial myopathy. J. Neurol., 236: 218-222. Byrne, E.D., J. Hayes, E.A. Shoubridge, J.A. Morgan-Hughes and J.B. Clark (1985) Experimentally induced defects of mitochondrial metabolism in rat skeletal muscle, Biological effects of the mitochondriat uncoupling agent 2,4-dinitrophenol. Biochem. J., 229: t01-108. Cheah, K.S. and A.M. Cheah (1974) Properties of mitochondria from ox-neck muscle after prolonged ageing in situ. Int. J. Biochem., 5: 753-760. Cheah, K.S. and A.M. Cheah (1977) Inclusions in aged rnitochondria. J. Bioenerg. Biomembr., 9:105-115. Chomyn, A., P. Marriotini, M.W,J. Cleeter, C.I. Ragan, A. Matsunoyagi, Y. Hatefi, R.F. Doolittle and G. Attardi (1985) Functional assigment of the product of the unidentified reading frames of the human mitochondrial DNA. In: Achievements and Perspectives in Mitochondrial Research, Vol. 2, Biogenesis. E. Quagliarello, E.C. Slater, F: Palmieri, C. Saccone, and A.M. Kroon (Eds.), Elsevier, New York, Amsterdam. 259-276. Cooperstein, S. J. and A. Lazarow (1951) A microspectrophotometric method for the determination of cytochrome oxidase. J. Biol. Chem., 189: 665-670. Di Mauro, S., E. Bonilla,, M. Zeviani, M. Nakagawa and D.C. De vivo (1985) Mitochondrial myopathies. Ann. Neurol., 17: 521-538. Drouin, I. (1980) Cloning of human mitochondrial DNA in Escherichia coll. J. Mol. Biol.., 140: 15-34. Fardeau, M. (1970) Ultrastructural lesion in progressive muscular dystrophy: a critical study of their specificity. Proc. Int. Congr. Muscle Dis. Milan, 1969, Excerpta Medica, Amsterdam: 98-108. Giles, R.E., H.M. Blanc, H.M. Cann and D.C. Wallace (1980) Maternal inheritance of human mitochondrial DNA. Proe. Natl. Acad. Sci. USA, 77: 6715-6719. Holt, I.J., A.E. Harding and J.A. Morgan-Hughes (1988) Deletions of mitoehondrial DNA in patients with mitochondrial myopathies. Nature, 331: 717-719.

Holt. l.J., A.E. Harding and J.A. Morgan-Hughes (1989) Deletions of muscle mitochondrial DNA in mitochondrial myopathies: sequence analysis and possible mechanisms, Nucleic Acids Res.. 17: 4465-4469. Johns, D.R. and O. Hurko (1989) Preferential amplification and molecular characterization of junction sequences of a pathological deletion in human mitochondrial D N A Genomics. 5: 623-628. Lestienne. P. and G. Ponsot (1988) Kearns-Sayre syndrome with muscle mitochondrial DNA deletion. Lancet. i: 885. Luft, R., D. lkkos, and G. Palmieri (1962) A case of severe hypermetabolism of non-thyroid origin with a defect in the maintenance of the mltochondrial respiratory control: a correlated clinical biochemical and morphological study. J. Clin. Invest., 41: 1776-1804. Mira, S., R. Rizzuto. C. Moraes. S. Shanske, E. Arnaudo, G.M. Fabrizi. Y. Koba. S. Di Manro, and E. Schon (1990) Recombination via flanking direct repeats is a major cause of large-scale deletion of human mitochondrial DNA. Nucleic Acids Res.. 18:561-567 Mizusawa, H.. M. Watanabe, J. Kanazawa, T. Nakanishi, M. Kolayashi. M. Tanaka, H. Suzuki, N. Nishikimi, And T. Ozawa(1988) Familial mitoehondrial myopathy associated with peripheral neuropathy: partial deficiencies of complex I and IV. J. Neurol. Sci., 86:171-184. Moraes, C.T., S. Di Mauro, M. Zeviani. A. Lombes. S. Shanske. A.F. Miranda. H. Nakase, E. Bonilla. L.C. Werneck. S. Servidei. I. Nonaka, Y. Koga, A.J. Spiro, A.K.W. Brownetl, B. Schmidt. D.L. Schotland, M. Zupane, D.C. De Vivo. E.A. Schon and L.P. Rowland (1989/Mitochondrial DNA deletions in progressive external ophtalmoplegia and Kearns-Sayre syndrome. N. Engl. J. Med.. 320: 1284-1299. Morgan-Hughes, J.A., P. Darveniza, S.N. Khan, D.N. Landon. R.M. Sherratt, J.M. Land and J.B. clark (1977) a mitochondrial myopathy characterized by a deficiency in reducible cytochrome b. Brain. 100: 617-640. Morgan-Hughes, J.A., D.J. Hayes, J.B. Clark, D.N. Landon, M. Swash, R.J. Stark and P.Rudge (1982) Mitochondrial eneephatomyopathies: biochemical studies in two cases revealing defects in the respiratory chain. Brain. 105: 553-582. Morgan-Hughes, J.A.. A,H. Schapira, J.M. Cooper and J.B. Clark (1988) Molecular defects ofNADH ubiquinone oxidoreductase (complex I) in mitochondrial diseases. J. Bioenerg. Biomembr. 20:365-381 Nelson,I.. F. Degoul, B. Obermaier-kusser. N. Romero. C. Marsac. J.l_ Vayssiere, K. Gerbitz~ M. Fardeau. G. Ponsot and P. Lestienne (1989) Mapping of heteroplasmic mitochondrial DNA deletions in Kearns-Sayre syndrome. Nucleic Acids Res.. 17: 8117-8124. Romero, N.B., P. Lestienne. C. Marsac, M. Paturneau-Jouas. I. Nelson D. Francois, B. Eymard and M. Fardeau (1989)Immunocytological and histochemical correlation in Kearns-Sayre with mtDNA deletion and partial cytochrome c deficiency in skeletal muscle. J. Neurol. Sci.. 93: 297-309. Rotig, A.. M. Colonna, J.P. Bonnefont. S. Blanche, A. Fisher. J.M. Saudubray and A. Munnich (1988) Mitochondrial DNA deletion in Pearson's marrow/pancreas syndrome. Lancet, i: 902-903. Saiki. R.K., D.H. Gelfand. S. Stoffel, S.J. Seharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A. Erlich (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239: 487-491. Sato, W., M. Tanaka. K. Ohno. T. Yamamoto, G. Takada~ and T. Ozawa (1989) Multiple populations of deleted mitochondrial DNA detected by a novel gene amplification method. Biochem. Biophys. Res. Commun.. 162: 664-672. Schon, E.A.. C.T. Moraes, S. Mira, H. Nakase, A. Lombes. S. Shanske. E. Arnaudo. M. Zeviani. R. Rizzuto. A.F. Miranda. E. Bonilla and S. di Mauro (1989) Analysis of giant deletions of human mitochondrial in progresswe externe ophtalmoplegia. Int. Symp. Molecular Basis Neurol. Disord. Treatments, Fasano. Italy.

177 Schon, E.A., R. Rizzuto, C.T. Moraes, H. Nakase, M. Zeviani and S. Di Mauro (1989) A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science, 244: 346-349. Sherrat, H.S.A., N.E.F. Cartlidge, M.A. Johnson and M. Turnbull (1984) Mitochondrial myopathy with partial cytochrome oxidase deficiency and impaired oxidation of NADH-linked substrates. J. Inherit. Metab. Dis., 7 (Suppl. 2): 107-108. Shoflhcr, M.T., A.S. Lott, S.A. Voljavec, D.A. Soueidan, D.A. Costigan and D.C. Wallace (1989) Spontaneous Kearns-Sayre/chronic external ophthalmoplegia plus syndrome associated with a mitochondrial DNA deletion: a slip- replication model and metabolic therapy. Proc. Natl. Acad. Sci., USA, 86: 7952-7956.

Smith, P.K., R.I. Krohn, G.T. Hermanson. A.K. Mallia, F.H. Gartner, H. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson and D.C, Klenk (1985) Measurement of protein using bicinchoninic acid. Arch. Biochem., 150: 76-85. Southern, E. (1975)Detection of specific sequences among DNA fragments by gel electrophoresis. J. Mol. Biol., 98: 503-517. Turnbull, D.M. and H.S.A. Sherratt (1987) Metabolic studies using isolated skeletal Muscle: investigation of metabolic myopathies. Bailliere's Clin. Endocrinol. Metab., 1/4: 967-997. Zeviani, M., C.T. Moraes, S. Di Mauro, H. Nakase, E. Bonilla, E.A. Schon and L.P. Rowland (1988) Deletions of mitochondrial DNA in Kearns-Sayre Syndrome. Neurology, 38:1339-1346.