Delivery of siRNA mediated by histidine-containing reducible polycations

GENE DELIVERY

Journal of Controlled Release 130 (2008) 46–56

Contents lists available at ScienceDirect

Journal of Controlled Release j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j c o n r e l

Delivery of siRNA mediated by histidine-containing reducible polycations Mark Stevenson a,⁎, Victor Ramos-Perez a, Surjeet Singh b, Mahmoud Soliman c, Jon A. Preece d, Simon S. Briggs a, Martin L. Read e, Leonard W. Seymour a a

Department of Clinical Pharmacology, Old Road Campus Research Building, University of Oxford, Old Road Campus, off Roosevelt Drive, Headington, Oxford OX3 7DQ , UK Glide Pharmaceutical Technologies Limited, Abingdon, Oxfordshire OX14 4RU, UK School of Pharmacy, University of Nottingham, University Park, Nottingham NG7 2RD, UK d Department of Chemistry, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK e Division of Medical Sciences, Institute for Biomedical Research, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK b c

A R T I C L E

I N F O

Article history: Received 26 February 2008 Accepted 9 May 2008 Available online 24 May 2008 Keywords: RNAi Plasmodium falciparum circumsporozoite Hepatitis Gene therapy Non-viral delivery

A B S T R A C T Histidine containing reducible polycations based on CH6K3H6C monomers (His6 RPCs), are highly effective DNA transfection agents combining pH buffering endosomal escape mechanisms with rapid unpackaging following reduction in the cytoplasm. We examined their ability to mediate siRNA uptake into cells focusing on hepatocyte delivery. Co-delivery of EGFP siRNA with pEGFP plasmid DNA reduced reporter gene expression by 85%. However while DNA transfection efficiency increased with polymer size, with 162 k His6 RPCs proving the most effective, delivery of siRNA alone to EGFP stably expressing cells was only possible using 36–80 k polymers. Analysis of particle sizes showed that 80 k polymers formed more compact siRNA complexes than 162 k polymers. The reducible nature of the polymer was necessary for siRNA activity, since siRNA combined with non-reducible polylysine showed little activity. Incorporation of a targeting peptide from the Plasmodium falciparum circumsporozoite (CS) protein onto His6 RPCs, significantly improved transfection of plasmid DNA and siRNA activity in hepatocytes, but not in most non-liver cells tested. siRNA targeted to the hepatitis B virus surface antigen delivered by CS-His6 RPC, mediated falls in both mRNA and protein expression, suggesting that this delivery system could be developed for potential therapies for viral hepatitis. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Utilization of RNA interference (RNAi) [1–3] to suppress target gene expression has widespread potential for therapeutic application. Strategies eliciting RNAi involve targeting exogenous disease causing genes such as viral pathogens, or endogenous genes playing a role in the disease process. There are two basic approaches; a drug approach where siRNA is administered in its final form, or a gene therapy approach where precursor hairpin siRNAs, that are subsequently processed, are expressed from viral or synthetic vectors providing longer term suppression. The first strategy is both simpler and avoids such problems as antibody-mediated viral vector neutralization, or restrictive effects of the intact nuclear membrane in non-mitosing cells. Synthetic vectors based on polycations such as polyethylenimine (PEI) and cyclodextrin, commonly used for plasmid DNA delivery, have recently been used to transfer siRNA to cells [4–7]. Although both plasmid DNA and siRNA have anionic phosphodiester backbones, with identical negative charge/nucleotide ratios allowing interactions with cationic polymers, their molecular weight and molecular topology are

⁎ Corresponding author. Tel.: +44 1865 617041; fax: +44 1865 617028. E-mail address: [email protected] (M. Stevenson). 0168-3659/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jconrel.2008.05.014

very different [8]. Consequently it is not a straightforward matter to extrapolate findings from DNA complexation with cationic polymers for siRNA vectors. For example plasmid DNA condenses into small 60–100 nm nanoparticles following neutralization of 70–90% of backbone charges by a cationic agent [9–11]. However there is a minimal size of around 150 bp for plasmid DNA condensation to occur [9,12]. It is not surprising therefore that 21–25 nt siRNA molecules have different condensation properties. Electrostatic interactions between siRNA and cationic molecules are relatively uncontrolled leading to particles of excessive size and poor stability [8]. Plasmid DNA and siRNA particle formation should therefore be regarded as distinct challenges. We have previously developed nucleic acid delivery using synthetic vectors based on reducible polycations (RPCs) prepared by oxidative polycondensation. Our first generation polymers based on CK10C monomeric units, relied on cleavage of the RPC in the intracellular environment, eliminating the toxicity associated with high molecular weight polymers [13]. However these polymers rely on chloroquine or cationic lipids to enhance endosomal escape and mediate transfection. Delivery of nucleic acids with polylysine based polymers, can be improved by the incorporation of histidyl residues that become cationic upon protonation of the imidazole group below pH6 [14,15]. We therefore developed second generation RPCs formed from histidine

containing monomers (CH6K3H6C) [16]. These vectors provide multiple functions; namely the ability of polycations to condense nucleic acids into tight complexes for efficient cellular uptake, with reducible polymer backbones that can be cleaved in the cytoplasm to promote unpackaging and alleviate toxicity [17,18]. The presence of histidine residues enables endosomal buffering and escape, removing the requirement for endosomolytic agents such as chloroquine. In this report we have examined the ability of histidine containing RPCs to deliver siRNA to cells, focusing on hepatocyte delivery for treating viral hepatitis. Hepatitis B infection affects over 350 million people worldwide [19], with substantial numbers succumbing to chronic liver disease and hepatocellular carcinoma. Immune modulators such as interferon alpha can provide respite but sustained responses are rare. Consequently several groups have investigated the use of siRNA to target and down regulate hepatitis B viral gene expression [20–23]. In contrast to plasmid DNA, where the large molecular weight polymers (162 k) were more efficient vectors, smaller molecular weight His6 RPCs (36 k–80 k) were required for efficient siRNA complexation and delivery. These smaller reducible polymers were capable of releasing biologically active siRNA triggering RNAi in hepatocytes, however the efficiency was generally lower than commercially available lipids. The incorporation of a hepatocyte specific targeting peptide onto the termini of the RPCs, increased delivery and biological activity of plasmid DNA or siRNA, in a tissue specific manner. Delivery of siRNA targeting Hepatitis B virus surface antigen (HBsAg), complexed with His6 RPC, reduced the amount of viral protein shed from Alexander cells, demonstrating the potential of these vectors to down regulate pathogenic gene expression and provide therapies for viral hepatitis. 2. Materials and methods 2.1. Cells The human liver hepatoma line PLC/PRF/5, also known as Alexander (ECACC No. 85061113), prostate lines PC-3 (ECACC No. 90112714), PNT1a and PNT2-C2 [24–26], A549 lung carcinoma (ECACC No. 86012804), MDA-MB-231 breast adenocarcinoma (ATCC No. HTB-26), COS-7 SV40 transformed African green monkey kidney (ECACC No. 87021302), and A9 mouse fibroblast cells (ATCC No. CCL-1.4), were each maintained in Dulbecco's Modified Eagle Medium (DMEM), 4.5 g/l glucose, 2 mM glutamine (PAA Laboratories GmbH, UK), supplemented with 10% foetal calf serum (FCS), 50 U/ml penicillin and 50 μg/ml streptomycin (Invitrogen, UK). HepG2 human hepatocyte carcinoma (ECACC No. 85011430) and SiHa cervical carcinoma cells (ATCC No. HTB-35) were maintained in Minimal Essential Medium with Earle's salts (EMEM), 2 mM glutamine (PAA Laboratories GmbH, UK), supplemented with 10% FCS, 50 U/ml penicillin, 50 μg/ml streptomycin and 0.1 mM non-essential amino-acids. LNCaP human prostate carcinoma (ECACC No. 89110211) and CaSki cervical carcinoma cells (ATCC No. CRL-1550) were maintained in RPMI 1640 medium, 2 mM glutamine (PAA Laboratories GmbH, UK), supplemented with 10% FCS, 50 U/ml penicillin, 50 μg/ml streptomycin (Invitrogen, UK). P4E6 an immortalized human prostate epithelial cell line derived from a well differentiated tumour [27,28], was maintained in Keratinocyte-SFM medium, 10% FCS, 2 mM glutamine, 5 ng/ml EGF human recombinant and 50 μg/ml bovine pituitary extract (Invitrogen, UK). Human umbilical vein endothelial cells (HUVEC) were maintained in endothelial cell growth medium containing 2% serum (Promocell, UK). All cells were maintained at 37 °C in a 5% CO2 humidified environment. 2.2. Nucleic acids pEGFP-C1 expressing green fluorescent protein driven by the CMV immediate early promoter (Clontech, CA, USA) and pcDNA3.1HygroLacZ containing the lacZ gene under the control of the CMV promoter,

47

were grown in Escherichia coli and purified using Qiagen Gigaprep kits. The concentration and purity of plasmid DNA was checked by spectrophotometer at A260 and A280 absorbance wavelengths. siRNA targeting GFP (siGFP) (target sequence CGGCAAGCTGACCCTGAAGTTCAT) and luciferase (siLUC) (target sequence AACTTACGCTGAGTACTTCGA) were purchased from Qiagen, UK. siRNAs targeting Hepatitis B surface antigen were designed using the Dharmacon guidelines based on Reynolds et al. [29]. Three siRNAs; siHBsAg-1 targeting AACATCACATCAGGATTCCTA, siHBsAg-2 targeting AATCACTCACCAACCTCTTGT and siHBsAg-3 targeting CTATATGGATGATGTGGTA, were synthesised by Qiagen, UK. siGFP was labelled with the fluorescent dye Cy3, using the Label IT siRNA Tracker Cy3 labelling kit according to the manufacturer's instructions (Mirus, Wi, USA). 2.3. Generation of EGFP stably expressing cell lines Alexander and HepG2 cells stably expressing EGFP were generated by liposomal transfection followed by antibiotic selection. Briefly 3 × 105 Alexander or HepG2 cells were added to the wells of a 6-well dish. pEGFP-C1 was mixed with DOTAP (Roche) at a w/w ratio of 5:1 according to the manufacturer's instructions. Liposomes were added to cells at 2.5 μg DNA per well in 1.2 ml serum free medium. After 4 h the medium was removed and replaced with 3 ml of DMEM containing 10% FCS. Twenty four hours later, the medium was replaced with selection medium (DMEM, 10% FCS, 400 μg/ml G418-sulfate (Invitrogen, UK)) to kill off untransfected cells. Cells were cultured replacing the selection medium every 3 d until EGFP expressing colonies appeared. Well established colonies containing approximately 100 cells were isolated by trypsinization using cloning cylinders (Sigma-Aldrich, UK) and transferred to the wells of a 96-well plate. The individual clones were subsequently analysed by flow cytometry to determine levels of EGFP expression. 2.4. Synthesis of reducible polycations CK10C monomers were synthesised as previously described [13,16] and CH6K3H6C (His6) monomers were synthesised by the Advanced Biotechnology Centre (Imperial College School of Medicine, London, UK). Reducible polycations were generated by oxidative polycondensation as previously described [13,16]. Reactions were terminated at various time points by the addition of 8 mol% 2-aminoethanethiol. The molecular weight of the polymer was determined by gel permeation chromatography using commercially available polylysine standards (Sigma-Aldrich, UK) to calibrate the column. The standards and RPCs were injected onto a CATSEC 300 GPC column (5 U, 25 cm× 4.6 mm ID) (Eprogen, IL, USA) and eluted in 300 mM NaCl + 0.1% TFA (trifluoroacetic acid). Unreacted monomer and DMSO were removed by purification using centrifugal filters with a molecular weight cut off of 10,000. Concentration of RPCs was determined by 2,4,6-trinitrobenzenesulfonic acid (TNBS) assay using polylysine calibration. The polydispersity of each RPC was calculated by Mw/Mn (Mw = ΣM2i Ni/ΣMiNi and Mn = ΣMiNi/ΣNi where Ni is the number of molecules of molecular weight Mi) [30]. A targeting peptide derived from the Plasmodium falciparum circumsporozoite (CS) protein (HNMPNDPNRNVDENANANSAYC) and a scrambled version (HNMPANRDNAPNNDNENVSAYC), were synthesised by the Advanced Biotechnology Centre (Imperial College School of Medicine, London, UK). These peptides were attached to His6 RPCs, formed during a 24 h oxidative polycondensation reaction, by resuspension at 2 mg/ml in 0.5× PBS, 50 mM HEPES pH 7.4, and addition at a final concentration of 1 mg/ml to the polymerisation reaction. Additional DMSO was employed to maintain 30 vol.% and the reaction incubated at room temperature for a further 24 h. Centrifugal filters were used to remove DMSO and unattached CS or scrambled CS peptide. The CS content of the targeted-RPCs was determined by amino acid analysis following hydrolysis in 6 M HCl at 100 °C for 16 h and

GENE DELIVERY

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENE DELIVERY

48

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

neutralisation with 10 M NaOH. Briefly the samples were derivatised with OPT reagent, (27 mg O-phthaldialdehyde, 500 μl ethanol, 20 μl 2-mercaptoethanol, 4.5 ml 400 mM borate buffer pH 9.3,) prior to analysis using a Shimadzu HPLC equipped with a Luna 5 um, C18(2) column, 2 × 150 mm (Phenomenex, UK), and eluted with an acetonitrile; phosphate buffer (10 mM, pH 5.5) gradient. Amino acid standard curves were generated from derivatised amino-acids using the method above. Polydispersity of the retargeted polymers was determined from each GPC trace as described for the untargeted polymers. 2.5. Formation of polyplexes Plasmid DNA or siRNA was diluted, in a polypropylene microcentrifuge tube, to 100 ng/μl with either, 20 mM HEPES-NaOH buffer pH 7.4 or HBS (20 mM HEPES-NaOH, 150 mM NaCl pH 7.4). Polycation was added to a second polypropylene tube in a two-fold volume of appropriate buffer, such that following the addition of nucleic acid the desired w/w (or N:P) ratio was generated. The nucleic acid was added to the RPC and mixed by vortexing, and polyplexes allowed to form by incubation at room temperature for 20–30 min. DOTAP/siRNA liposomes were formed at a w/w ratio of 5:1 and JetPEI/siRNA polyplexes formed at N:P 5:1, according to the manufacturer's instructions (Roche, UK and Polyplus, France respectively). Polyplexes comprising both plasmid DNA and siRNA together were formed by prior mixing of DNA and siRNA at a 13:1 w/w ratio.

expression. EGFP expression was examined after 48 h by flow cytometry using a Becton Dickinson FACSCaliber; analysis performed using CellQuestPro software. For DNA/siRNA co-delivery assays, complexes were added to cells such that each well received 0.2 μg pEGFP and 10 nM siRNA, reporter gene activity determined after 48 h. For siRNA delivery alone 3 × 104 Alexander EGFP or HepG2 EGFP cells were plated out in 24 or 48-well dishes. Polyplexes were prepared and added to cells such that each well received 25–100 nM siRNA. EGFP expression was examined after 48–72 h. Uptake of siRNA was assessed by adding Cy3-siGFP/CS-His6 RPC complexes to 4 × 104 Alexander cells, plated into 8-well chamber slides, for 6 h prior to visualization by fluorescence microscopy. 2.8. Cytotoxicity 104 Alexander cells were seeded into a 96-well plate and incubated overnight. siRNA complexes formulated with 36 k His6 RPC (w/w 40:1, N:P 15:1), 114 k His6 RPC (w/w 40:1, N:P 15:1) or DOTAP (w/w 5:1) were added to cells at a final siRNA concentration of 100 nM (62.6 ng per well) in 40 μl of serum free DMEM. After 4 h 220 μl of DMEM containing 10% fcs was added and cells incubated for a further 20 h. The cell number was determined using CellTitre96Aqueous One Solution (Promega, UK) according to the manufacturer's instructions. The absorbance at 490 nm was determined using a Wallac Victor2 Platereader.

2.6. Characterization of polyplexes

2.9. HBsAg ELISA

The formation of polyplexes containing plasmid DNA, siRNA or both, were analysed by agarose gel electrophoresis. Complexes containing 100 ng of nucleic acid prepared at various w/w ratios ranging from 1–20, were added to wells of a 0.8% (plasmid DNA), 2.5% (siRNA) or 1.0% (plasmid DNA and siRNA) agarose gel containing 500 ng/ml ethidium bromide. Samples were run at 5 V/cm to resolve nucleic acid mobility and visualised by UV illumination. To simulate reduction mediated destabilisation within the cells, polyplexes were incubated with 8 mM glutathione (Sigma-Aldrich, UK) for 1 h at 37 °C prior to analysis by gel electrophoresis. To assess serum stability, uncomplexed nucleic acid or nucleic acid CS-His6 RPC complexes at w/w 15:1 (N:P 5.6:1) were exposed to 75% foetal calf serum (16.67 ng/μl nucleic acid final concentration) for 16 h. Fifty nanograms of uncomplexed or complexed nucleic acid was added to water, buffer (50 mM Tris HCl pH 7.8, 2.5 mM EDTA, 2.5% SDS) or 4 mg/ml proteinase K in buffer, incubated for 1 min and loaded onto an agarose gel. Condensation of plasmid DNA and siRNA by 162 k His6 RPC was also determined using an ethidium bromide exclusion assay measured with an LS-50B fluorimeter (Perkin-Elmer, UK) at 520 nm excitation and 590 nm emission wavelengths. The physical size and polydispersity of siRNA or DNA/siRNA polyplexes was measured by dynamic light scattering using a Zetasizer 3000 (Malvern Instruments, UK) equipped with a 50 MW internal laser. At least 10 measurements were obtained for each sample at 25 °C in 20 mM HEPES-NaOH pH 7.4 at a scattering angle of 90° and analyzed by monomodal analysis. The machine was calibrated using 199 nm (+/−6 nm) polymer beads (Duke Scientific Corp., CA, USA).

Following delivery of siHBsAg-1, siHBsAg-2 or siHBsAg-3 to Alexander cells, the amount of surface antigen shed into the medium was determined using an HBsAg ELISA kit according to the manufacturer's instructions (Abazyme, MA, USA). The optical density was determined at a wavelength of 450 nm using a Wallac microtiter plate reader. 2.10. Quantitative RT-PCR Total RNA was extracted from cells using the Qiagen RNeasy Mini kit according to the manufacturer's instructions. cDNA was generated from the RNA samples following elimination of genomic DNA, using QuantiTect Reverse Transcription kit (Qiagen, UK) according to manufacturer's instructions. The cDNA was analysed for purity and concentration using a spectrophotometer at 260 nm and 280 nm wavelengths. Quantitative PCR was performed using the QuantiTect Probe PCR kit (Qiagen, UK) using HBsAg forward primer 5′ CAACCTCTTGTCCTCCAACTTGT 3′, reverse primer 5′ AGGCATAGCAGCAGGATGAAG 3′ and probe 5′ CTGGATGTGTCTGCGGCGTTTTATCATATT 3′ labeled with FAM and TAMRA. Endogenous reference gene GAPDH was detected using forward primer 5′ GAAGGTGAAGGTCGGAGTC 3′, reverse primer 5′ GAAGATGGTGATGGGATTTC 3′ and probe 5′ CAAGCTTCCCGTTCTCAGCC 3′ labeled with FAM and TAMRA. In each case 100 ng of sample cDNA was added to the reaction. DNA was amplified using the thermal cycling conditions, 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min, generated in an Applied Biosystems 7000 Sequence Detection System. Subsequent analysis was performed using ABI Prism 7000 SDS Software. A standard curve of Ct value vs. log amount of standard was generated for HBsAg and GAPDH using 5-fold dilutions of cDNA prepared from total RNA extracted from mock treated control cells.

2.7. Transfection and siRNA efficacy studies 3. Results For DNA transfection studies 4–5 × 104 cells were plated into 24 or 48-well dishes 24 h prior to delivery. Liposomes and polyplexes were prepared and added to cells in either 125 μl (0.5 μg pEGFP-C1/well of 24-well plate) or 100 μl (0.2 μg pEGFP-C1/well of 48-well plate) serum free medium. After 4 h medium containing 10% FCS was added and cells cultured for a further 20 h prior to analysing reporter gene

3.1. Histidine containing reducible polycations are excellent DNA transfection agents Histidine containing reducible polycations (His6 RPC), based on repeating CH6K3H6C monomers, were produced by oxidative

49

Table 1 Characterisation of polymers illustrating number average molecular weight (Mn), weight average molecular weight (Mw) and polydispersity (Mw/Mn), following GPC Polymer

Mn (g/mol)

Mw (g/mol)

Mw/Mn

36 k 38 k 44 k 114 k 162 k 40 k CS 53 k CS 89 k CS 40 k CS Scr

21,600 28,600 31,500 27,000 44,400 23,700 27,600 33,400 21,600

33,500 34,600 39,100 54,000 86,600 32,200 43,900 82,400 29,400

1.55 1.21 1.24 2.00 1.95 1.36 1.59 2.47 1.36

Weight average molecular weight (Mw) = ΣM2i Ni/ΣMiNi and number average molecular weight (Mn) = ΣMiNi/ΣNi where Ni is the number of molecules of molecular weight Mi. The descriptive term for each polymer e.g. 36 k, indicates the molecular weight inferred from the retention time at the height of the peak generated by GPC. Since the larger polymers tended to have a right skewed distribution, there is a discrepancy in weight average molecular weight (Mw) and molecular weight at the peak height. The 36 k, 38 k, 44 k, 114 k and 162 k polymers are His6 RPCs; 40 k CS, 53 k CS and 89 k CS are CSlabelled His6 RPCs, and 40 k Scr indicates His6 RPC terminated with the scrambled version of the CS peptide.

polycondensation; the reaction being terminated at various time points to generate polymers of different length (Table 1). The descriptive term for each polymer e.g. 36 k, indicates the molecular weight inferred from the retention time at the height of the peak generated by GPC. Since the larger polymers tended to have a right skewed distribution, there is a discrepancy in weight average molecular weight (Mw) and molecular weight at the peak height. Previously we have shown that His6 RPCs can mediate highly efficient transfection of plasmid DNA in a range of cell lines [16]. We demonstrate here that the higher the molecular weight of His6 RPC, the greater the transfection efficiency (Fig. 1). For example EGFP expression in PC-3 cells was 3-fold higher (in terms of total transgene expression) using the 162 k polymer than the 114 k polymer, and 23-fold higher than the 38 k polymer. Indeed transgene expression was higher using 162 k His6 RPC to deliver plasmid than both a commercially available lipid (DOTAP) and linear polyethylenimine (JetPEI). 3.2. His6 RPC can deliver combined siRNA/DNA payloads to mediate RNAi Having demonstrated efficient DNA transfection we wished to determine whether His6 RPCs could deliver siRNA to cells in a biologically active form. The biological activity of siRNA in liver cells was initially tested using a transient reporter system, comprising co-delivery of an EGFP reporter gene together with siRNA recognising EGFP mRNA (siGFP) or luciferase (siLUC). Condensation of these mixed polyplexes (w/w 13:1, DNA:siRNA), was confirmed by gel retardation, which showed that the

Fig. 2. His6 RPCs can deliver biologically active siRNA in combination with plasmid DNA. (a) DNA/siRNA (w/w 13:1) or DNA only polyplexes formed using 114 k His6 RPC (w/w ratio 2:1 or 5:1 (nucleic acid: RPC)) analysed by agarose gel electrophoresis. (b) Size (Z Ave) and polydispersity of DNA/114 k His6 RPC complexes (white bars) and DNA/siRNA/114 k His6 RPC complexes (black bars) determined by photon correlation spectroscopy. (c) Alexander cells and HepG2 cells transfected with pEGFP combined with siRNA targeting EGFP (black bars) or luciferase (striped bars), condensed by 114 k His6 RPC (w/w 40:1; N:P 15:1 in HEPES buffered saline pH 7.4). EGFP expression was determined after 48 h by flow cytometry and shown as the percentage number of positive cells multiplied by the mean fluorescence of the positive population. Mock treated cells are shown as white bars. Results are shown as mean and standard deviation for b) and mean and SEM from three samples for c) (⁎ p b 0.05, ⁎⁎ p b 0.01, ⁎⁎⁎ p b 0.001, ns = p N 0.05).

Fig. 1. Increasing molecular weight of His6 RPC improves gene transfer. PC-3 or Alexander cells transfected with pEGFP condensed by His6 RPC at indicated molecular weight (w/w ratio 15:1 His6 RPC:DNA; N:P 5.6:1 in HEPES buffered saline pH 7.4) (white bars), DOTAP (w/w ratio 5:1) (striped bars), or JetPEI (N:P 5:1) (hatched bars). EGFP expression after 24 h shown as percentage number of expressing cells multiplied by the mean fluorescence of the positive population (total transgene expression). Percentage number of EGFP positive cells is indicated above each bar. Results are shown as mean and SEM values from three samples.

GENE DELIVERY

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENE DELIVERY

50

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

presence of siRNA reduced the amount of free DNA at low weight to weight ratios (w/w 2:1, nucleic acid:RPC), while at weight/weight 5:1 both DNA and siRNA were fully retained in the well (Fig. 2a). Assessment by photon correlation spectroscopy showed that the inclusion of siRNA resulted in a minor decrease in particle size (N:P 15:1) (Fig. 2b). RNAi activity was assessed 48 h after co-transfection, with EGFP expression (total transgene expression) in cells receiving siGFP being 13% (HepG2) and 15% (Alexander) of the level in controls (Fig. 2c). The percentage number of EGFP positive cells fell from 5.2 to 2.5% for HepG2 cells and from 3.9 to 2.6% for Alexander cells in the presence of siGFP. This result confirms that His6 RPC is capable of delivering siRNA to cells in a biologically active form and that the RNAi machinery is functional in these cells. However this system is artificial since DNA and siRNA will be delivered to the same cells due to complexation with the same vector. Secondly the siGFP will be present in the cytoplasm prior to generation of EGFP mRNA, providing an advantage to eliminate mRNA as it is transcribed. For siRNA to be effective as a therapy there is a requirement to silence pre-existing target mRNA. 3.3. Complexation of nucleic acids by His6 RPCs The complexation of a 21 nt siRNA alone, by various molecular weight His6 RPCs (38–162 k), was assessed using agarose gel electrophoresis, ethidium bromide exclusion and photon correlation spectroscopy. Complexation of the high molecular weight 162 k His6

RPC with an 8.6 kb DNA plasmid at a weight/weight (w/w) ratio of 1 or 2, allowed substantial free DNA to enter the gel, while a ratio of 5:1 (N:P 1.9:1) resulted in complete retention in the well (Fig. 3a, left panel). In contrast when complexed with siRNA, w/w ratios up to 20 (N:P 7.5:1) were insufficient to fully abrogate mobility (Fig. 3a, middle panel). It was observed that siRNA was retained in the well at w/w 20 if unbuffered water was used to prepare complexes (Fig. 3a, right panel). This could be due to the lower ionic strength resulting in greater attraction between siRNA and polycation, or solute acidification resulting in protonation of histidines and thus a decreased weight/charge ratio. Previous analysis has shown that His6 RPC has a buffering capacity with a pKa in the region of 5–6 corresponding to the pKa of the imidazole group [16]. Ethidium bromide exclusion assays for DNA revealed a sharp decrease in fluorescence to 40% at w/w ratio 2:1 (N:P 0.75:1), in contrast with the gradual decrease of siRNA fluorescence to 50% as the w/w ratio was increased to 20 (N:P 7.5:1) (Fig. 3b). Interestingly siRNA complexes formed using lower molecular weight His6 RPCs, namely 38 k, 44 k, 80 k and 114 k, showed cessation of siRNA mobility at a w/w ratio around 10:1 (N:P 3.8) (Fig. 3c). This apparent ability of lower weight polymers to form more condensed siRNA polyplexes was also demonstrated by photon correlation spectroscopy, since 80 k His6 RPC was able to form 86–92 nm particles (at w/w 8:1 (N:P 3:1), lower ratios unable to form condensed structures), that were approximately half the diameter of those formed with 162 k His6 RPC (Fig. 3d).

Fig. 3. Greater condensation of siRNA polyplexes is achieved using lower molecular weight His6 RPCs. (a) DNA or siRNA polyplexes formed using 162 k His6 RPC (at indicated w/w ratios in 20 mM HEPES buffer pH 7.4 or water) and loaded onto an agarose gel to assess mobility by electrophoresis. (b) Ethidium bromide exclusion assay for complexes comprising 162 k His6 RPC and DNA (circles) or siRNA (squares); fluorescence measured using a fluorimeter (Ex 520 nm, Em 590 nm), each reading expressed relative to the fluorescence from uncomplexed nucleic acid. (c) siRNA polyplexes formed using 38 k, 44 k, 80 k or 114 k His6 RPC (at indicated w/w ratios in 20 mM HEPES buffer pH 7.4) and mobility assessed by electrophoresis. (d) Size (Z Ave) and polydispersity of siRNA polyplexes condensed with 80 k His6 RPC (w/w 8:1; N:P 3:1) (black bars), 162 k His6 RPC (w/w 10:1; N:P 3.8:1) (striped bars) or 162 k His6 RPC (w/w 15:1; N:P 5.6:1) (hatched bars), analysed by photon correlation spectroscopy. Results are shown as mean and standard deviation (⁎ p b 0.05, ⁎⁎ p b 0.01, ⁎⁎⁎ p b 0.001, ns = p N 0.05). (e) Polyplexes formed between siRNA and polylysine (pKK) (w/w 3.2:1; N:P 5:1), CK10C RPC (w/w 3.9:1; (N:P 4.8:1) and 80 k His6 RPC (w/w 12.2:1; N:P 4.6:1) in water. Polyplexes were incubated with 8 mM glutathione (GSH) for 1 h to reduce disulphide bonds in the RPCs and siRNA mobility examined by electrophoresis.

In order for siRNA to be biologically active it is important that release from the delivery vector is efficient. We therefore examined the destabilisation of siRNA/polycation complexes under reducing conditions, simulating the environment found in the cytoplasm. Following complexation with either polylysine (Fig. 3e, lane 2), CK10C RPC (lane 3) or His6 RPC (80 k) (lane 10), siRNA was retained within the electrophoresis well. Treatment of non-reducible polylysine/siRNA complexes with 8 mM glutathione (GSH) for 1 h did not release siRNA from retention in the well (lane 6) as expected. In contrast treatment of CK10C RPC/siRNA or His6 RPC/siRNA complexes with GSH restored siRNA mobility (lanes 7 and 12); the resultant band appearing a little diffuse compared with uncomplexed siRNA, similar to the effect observed when siRNA was mixed with CK10C monomer (molecular weight 1506) (lane 4). This would indicate that glutathione successfully cleaved the disulphide bonds within the RPC causing destabilisation of the complex. 3.4. His6 RPC can deliver siRNA alone Two stably expressing EGFP liver cell lines, Alexander EGFP and HepG2 EGFP, were generated in order to evaluate the activity of siGFP in His6 RPC/siRNA polyplexes. While siGFP formulated with 162 k His6 RPC had no silencing activity at any weight:weight ratio examined (Fig. 4a, data shown for w:w 26:1 (N:P 10:1)), the use of 80 k His6 RPCs mediated a fall in EGFP expression after 48 h, down to 70% (100 nM siRNA) of that in the mock treated control (Fig. 4b). This was attributable to the fall in fluorescence per cell since the percentage number of EGFP expressing cells was unaffected. This decrease in expression was less than the silencing generated when DOTAP was employed as a carrier but greater than that achieved using non-reducible polylysine to deliver siGFP (Fig. 4b). Delivery of siLUC had no effect on EGFP expression with any vector. For smaller RPCs (36 k) excess polymer was required for siRNA activity, since only complexes prepared at w/w 40 (N:P 15) led to a reduction in EGFP expression (Fig. 4c). This is consistent with excess polymer providing additional buffering capacity and hence endosomal escape. The use of HEPES buffered saline pH 7.4 (HBS) to prepare complexes resulted in extensive aggregation as determined by PCS analysis (data not shown). However polyplexes formed using HBS had no greater silencing effect than complexes formed in HEPES buffer (Fig. 4c), suggesting that aggregation does not mediate greater delivery of active siRNA. 3.5. Addition of a targeting moiety improves nucleic acid delivery to liver cells Although DOTAP mediated siRNA delivery gave greater levels of silencing than His6 RPC, DOTAP is not amenable to further chemical modification and has greater cytotoxicity (Fig. 4d and Liu, personal communication). To improve His6 RPC mediated siRNA delivery, we modified the end of the polymer with a peptide taken from the circumsporozoite (CS) protein of the malaria parasite Plasmodium falciparum. This protein is known to aid invasion into hepatocytes

Fig. 4. His6 RPC can deliver biologically active siRNA to silence endogenous EGFP expression. siGFP (black bars) or siLUC (striped bars) delivered to HepG2 EGFP cells and EGFP expression determined by flow cytometry after 48 h. The percentage number of EGFP positive cells is indicated above each bar. Mock treated controls included parental HepG2 cells (grey bar) and HepG2 EGFP cells (white bar). (a) siRNA was combined with 162 k His6 RPC (w/w 26:1; N:P 10:1) or JetPEI (N:P 5) in HEPES buffered saline. (b) siRNA was combined with DOTAP (w/w 5:1) in water, 80 k His6 RPC (w/w 12.5; N:P 4.6) in 20 mM HEPES pH7.4 or polylysine (pKK) at N:P 5 in 20 mM HEPES pH 7.4 and added to cells at the final concentrations indicated. (c) siRNA/36 k His6 RPC polyplexes were prepared at w/w 10:1 or 40:1 (N:P 3.8 or 15 respectively) in either 20 mM HEPES or HBS. (d) The percentage number of cells 24 h after delivery of siGFP complexed with DOTAP (w/w 5:1) or His6 RPC (N:P 15:1) was assessed by MTS assay. (Statistical analysis was performed by ANOVA with Bonferroni post hoc analysis ⁎ p b 0.05, ns = p N 0.05)

51

during the parasite life cycle [31–33]. The peptide (HNMPNDPNRNVDNANANSAYC) previously shown to have high hepatocyte binding properties [34], was linked onto His6 RPCs by oxidative polycondensation (CS-His6 RPC) (Table 1). Characterization of CS-His6 RPC by

GENE DELIVERY

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENE DELIVERY

52

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

amino acid analysis revealed a 3.35:1 molar ratio of CS peptide:RPC. Since each RPC can carry two CS peptides, one at each termini, this would indicate a 67.5% excess of free CS peptide remained in the preparation after centrifugation.

We analyzed the transfection of plasmid DNA (pEGFP) complexed with CS-His6 RPC in a panel of 13 cell lines and HUVEC. Compared with untargeted His6 RPC, EGFP expression increased 15-fold in Alexander cells and 1.8-fold in HepG2 cells (Fig. 5a), while ten of the twelve

Fig. 5. Linkage of a peptide from Plasmodium falciparum CS protein to His6 RPC improves transfection of liver cells. (a) Fourteen cell types transfected with pEGFP condensed by 36 k His6 RPC (white bars) or 53 k CS-His6 RPC (w/w 15:1; N:P 5.6:1) (black bars). EGFP expression shown as the percentage number of expressing cells multiplied by the mean fluorescence of the positive population determined by flow cytometry after 24 h. (b) Transfection of liver cells with pEGFP condensed with 40 k CS-His6 RPC (black bars) or 40 k scrambled CS-His6 RPC (white bars) (w/w 5:1; N:P 1.9:1); EGFP expression was measured after 24 h. (c) Transfection of liver cells with pEGFP (hatched bars), pEGFP and siGFP (black bars) or pEGFP and siLUC (striped bars), condensed by CS-His6 RPC (w/w 5:1; N:P 1.9:1); mock treated cells are shown by white bars. (d) siGFP (black bars) or siLUC (striped bars) were condensed with 36 k His6 RPC or 89 k CS-His6 RPC (w/w 40:1; N:P 15:1) in 20 mM HEPES pH 7.4 and added to Alexander EGFP cells. Mock treated controls included parental Alexander cells (grey bar) and Alexander EGFP cells (white bar); EGFP expression was measured after 72 h. For graphs a–d) the percentage number of EGFP positive cells is indicated above each bar. (e) Uptake of Cy3 labelled siGFP complexed with His6 RPC, CS-His6 RPC, DOTAP or JetPEI into Alexander cells after 6 h. Arrows indicate punctuate signals in cytoplasm of transfected cells indicative of internalised Cy3-siRNA.

53

non-liver cells showed no increased expression. Surprisingly prostate PC-3 cells showed a 2.8-fold increase and breast MDA231 cells a 1.9-fold increase in expression. Alexander and HepG2 cells transfected with plasmid DNA using a scrambled version of the CS peptide linked to His6 RPC, had significantly lower EGFP expression compared with CS-His6 RPC (Fig. 5b). This result was not attributable to differential condensation, since both formed similar sized particles (118 nm for CS-His6 RPC/ DNA and 125 nm for scrambled CS-His6 RPC/DNA). The data indicates that this CS peptide binds to receptors or sites expressed on liver cells that are absent from most but not all other tissue. The ability of CS-His6 RPC to deliver biologically active siRNA was then assessed. Initially the co-delivery of plasmid DNA together with siGFP, resulted in a mean fluorescence per cell 35% (Alexander) and 21% (HepG2) of that in cells receiving plasmid alone (Fig. 5c). More importantly siGFP alone complexed with CS-His6 RPC, reduced EGFP expression to 53% of the level in mock treated Alexander EGFP cells (Fig. 5d); a significant increase in activity compared with delivery by the untargeted vector (Figs. 5d and 4b). The loss of EGFP expression was manifested as both a fall in mean fluorescence per cell and a reduction in the number of EGFP positive cells. The complexation of siRNA with ‘stuffer DNA’, comprising irrelevant plasmid DNA, using CS-His6 RPC, did not increase the amount of silencing following addition to Alexander EGFP cells (data not shown). Fluorescence microscopy confirmed the uptake of Cy3-siGFP/ CS-His6 RPC complexes in Alexander cells, signals appearing as punctuate spots within the cytoplasm of cells (Fig. 5e arrows). The CS targeted polymer also appeared to result in greater accumulation of labelled siRNA at the cellular surface than the untargeted polymer (Fig. 5e). 3.6. Assessment of serum stability The serum stability of siRNA/CS-His6 RPC complexes was examined by exposing complexes to 75% foetal calf serum for 16 h prior to electrophoretic analysis. Uncomplexed DNA or siRNA was undetectable following exposure to serum (Fig. 6 compare lane 1 with lane 4; DNA left panel, siRNA right panel), only a serum signal being present. Digestion with proteinase K failed to restore the band (lane 5), suggesting the nucleic acid had been degraded and not simply bound to serum proteins. In contrast DNA condensed with CS-His6 RPC prior to serum exposure was detectable in the well (lane 11, left panel). Comparison with nonserum treated DNA/CS-His6 RPC complexes (lane 8, left panel) showed increased fluorescence suggesting some perturbation of the complexes.

Fig. 6. Serum destabilises siRNA/CS-His6 RPC complexes. Plasmid DNA (pEGFP) or siRNA (siGFP) was exposed to foetal calf serum with or without condensation with 40 k CS-His6 RPC (w/w 15:1). Samples were then added to water, buffer (50 mM Tris HCl pH 7.8, 2.5 mM EDTA, 2.5% SDS) or 4 mg/ml proteinase K in buffer, incubated for 1 min prior to loading onto (50 ng per well) an 0.8% agarose (DNA) or 2.5% agarose (siRNA) gel for electrophoretic analysis. Lane 1; nucleic acid only, lane 2; nucleic acid + buffer, lane 3; nucleic acid + proteinase K, lane 4; nucleic acid + serum, lane 5; nucleic acid + serum + proteinase K, lane 6; buffer only, lane 7; proteinase K only, lane 8; nucleic acid + CS-His6 RPC, lane 9; nucleic acid + CS-His6 RPC + buffer, lane 10; nucleic acid + CS-His6 RPC + proteinase K, lane 11; nucleic acid + CS-His6 RPC + serum, lane 12; nucleic acid + CS-His6 RPC + serum + proteinase K, lane 13; serum only, lane 14; serum + proteinase K.

Fig. 7. siRNA mediated silencing of Hepatitis B surface antigen. siRNA targeting GFP (black bars) or HBsAg (hatched bars) delivered to Alexander cells condensed by 36 k His6 RPC or 53 k CS-His6 RPC (w/w 15:1; N:P 5.6:1) or JetPEI (N:P 5:1). (a) HBsAg mRNA levels were determined by QRT-PCR after 19 h, samples having been normalised for levels of GAPDH and expressed relative to mock treated controls. (b) HBsAg protein levels were determined by ELISA after 72 h, with levels expressed relative to mock treated controls. (c) siRNA targeting GFP (black bars) or HBsAg (hatched bars) was delivered to Alexander cells condensed by JetPEI (N:P 5:1); HBsAg protein levels were determined by ELISA after 72 h, with levels expressed relative to mock treated controls. Statistical analysis was performed using ANOVA with Bonferroni post hoc analysis for graph a) and c), and Kruskal–Wallis and Mann Whitney tests for graph b); ns = p N 0.05, ⁎ = p b 0.05, ⁎⁎ = p b 0.01.

Subsequent digestion with proteinase K released the DNA as visualised by the appearance of the open circular band (lane 12 left panel) albeit at reduced intensity suggesting the RPC provided a degree of protection from serum protein binding and degradation. In contrast siRNA condensed by CS-His6 RPC was not protected from the serum proteins, since restoration of siRNA mobility was not observed following proteinase K treatment (lane 12 right panel). This would suggest that the siRNA/CSHis6 RPC complexation is insufficient to protect siRNA from unwanted serum protein interactions. 3.7. Use of siRNA to target hepatitis B surface antigen (HBsAg) Alexander cells express hepatitis B surface antigen, which is secreted into the medium and can be detected by ELISA. We were interested to determine whether His6 RPC based vectors could deliver

GENE DELIVERY

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENE DELIVERY

54

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

siRNA capable of down regulating HBsAg expression. Three siRNA sequences were designed to recognise HBsAg mRNA and delivered to cells using DOTAP, sequence 3 (siHBsAg-3) proving the most effective (data not shown). siHBsAg-3 was complexed with His6 RPC, CS-His6 RPC or DOTAP and added to Alexander cells; the effects on HBsAg mRNA and protein levels assessed by qRT-PCR and ELISA respectively. Falls in target mRNA were observed when using either His6 RPC or CSHis6 RPC to deliver siRNA (Fig. 7a). At the protein level a statistically significant fall was only observed when using the CS-His6 RPC vector (Fig. 7b). This result demonstrates the effective delivery of active siRNA but suggests the design of a more effective siRNA sequence is required for therapy. 4. Discussion Recent advances in our understanding of RNAi mechanisms, have led to the development of gene silencing agents currently being evaluated in phase III clinical trials into serious ophthalmic disorders, such as wet age-related macular degeneration and diabetic macular edema (Opko Ophthalmologics formally Acuity Pharmaceuticals, Sirna Therapeutics). Vectors for targeted delivery of siRNA are essential to enable this technology to fulfil its potential in developing new therapeutic entities. Conventional nucleic acid transfection agents, based on cationic lipids, are very efficient at delivering siRNA nonspecifically to cells in vitro; however target-selective delivery requires development of ligand-mediated vectors capable of delivering siRNA via target-associated membrane receptors. siRNA is a small, negatively charged, double stranded nucleic acid that can interact electrostatically with cationic polymers such as PEI and polylysine to form polyelectrolyte complexes, or ‘polyplexes’. These polyelectrolyte systems work well for delivery of plasmid DNA, and can be easily targeted to specific receptors. However they seem to be less suitable for siRNA delivery, possibly reflecting inefficient intracellular unpackaging, since siRNA must be delivered free into the cytoplasm in order to interact with the RNA induced silencing complex (RISC). We have recently developed a bioreversible polyelectrolyte system, designed for cytoplasmic reduction and efficient intracellular release of the nucleic acid delivered. The use of polylysine based polymers consisting of cysteine terminated monomers to condense nucleic acids [13,35], results in complex stability outside cells and triggered release in the cytoplasmic environment due to reduction of disulphide bonds. Since macromolecules like siRNA are internalized by endocytosis followed by lysosomal fusion causing siRNA degradation, endosomal escape is a prerequisite for efficient delivery of intact siRNA to the cytosol. We have previously demonstrated that inclusion of histidine residues in reducible polycations (His6 RPCs) mediate highly efficient levels of gene transfer (greater than PEI) without requirement for endosomolytic agents such as chloroquine [16]. We have now generated numerous batches of histidine-containing RPC vector confirming that the biological activity of these delivery agents is reproducible. We have shown here co-delivery of siRNA (siGFP) and plasmid DNA (pEGFP) by His6 RPC mediated an 85% reduction in gene expression confirming; the potency of the siRNA sequence, the intact nature of the RNAi processing machinery in the hepatoma cell lines, and the ability of His6 RPCs to deliver biologically active siRNA to cells. However silencing of endogenous expression is likely to be a greater challenge since target mRNAs are present in the cell prior to the arrival of siRNA. Furthermore in transient transfections the siRNA and DNA share a similar endosomal fate, such that there will be a subset of cells in which nucleic acids successfully escape, leading to nuclear import of DNA and subsequent transgene expression, together with localization of siRNA in the cytoplasm to degrade transgene mRNA. Correspondingly following siRNA delivery alone to EGFP stably expressing cells, the observed reductions in endogenous gene expression were more

modest decreasing by around 30%. Unlike DOTAP mediated delivery, reduced expression was solely due to decreased fluorescence per cell, rather than a decrease in the percentage number of cells expressing EGFP. However silencing efficiency could also be related to differential properties of DNA/siRNA/His6 RPC and siRNA/His6 RPC complex formation. The 162 k His6 RPC effectively condensed 8.6 kb plasmid DNA at a w/w ratio of 5, however it was unable to condense siRNA. In contrast the 80 k His6 RPC formed siRNA polyplexes of 90 nm diameter. Efficient complex formation was required for biological activity since siRNA/162 k His6 RPC polyplexes were unable to mediate target gene silencing at any of the w:w ratios employed, while 36–114 k polymers did, smaller or medium weight polymers being the most effective. This result is in contrast to DNA delivery where larger polymers mediated greater levels of transgene expression. These findings are in agreement with the study by Leng et al. showing that different compositions of branched histidine/lysine peptides were required depending on whether DNA or siRNA was the cargo [36]. Similarly polyplexes based on low molecular weight polycations such as 2 kDa PEI have been shown to be more efficient at delivering mRNA than 25 kDa PEI, presumably due to fewer electrostatic interactions enabling greater access of mRNA to translational machinery [37]. Like DNA, siRNA activity was greater when delivered using reducible polymers compared with non-reducible polylysine of similar molecular weight. Treatment of siRNA/His6 RPC complexes with 8 mM glutathione, cleaved the disulphide bonds within the polymer effectively releasing siRNA. This could imply that non-reducible polylysine/siRNA complexes are too stable, and for any complexes escaping the endosomes the polylysine remained associated with the siRNA limiting its association with the RISC. Since siRNA/His6 RPCs only generated modest falls in gene expression, we investigated the addition of a targeting peptide onto the termini of the RPC to allow uptake by receptor mediated endocytosis. Previous siRNA delivery strategies have included the addition of RGD to target carriers to integrins [4,36], folate to target folate receptors [38,39], sugars to target the asialoglycoprotein receptor [40–45] or incorporation of cell penetrating or fusogenic peptides [46–48]. The circumsporozoite protein of Plasmodium falciparum is involved in sporozoite entry into hepatocytes during the parasite life cycle. The plasma membrane of sporozoites is entirely covered by the CS protein [49] which has specific interactions with the hepatocyte plasma membrane basolateral domain [31–33]. The CS protein contains a signal sequence at its amino terminus, a central repeat region, two conserved amino acid motifs in region I and region II and anchor sequence at its carboxyl terminus [50–52]. Suarez et al. identified HNMPNDPNRNVDENANANSA in region III as having high binding activity to HepG2 cells, the residues shown in italics being particularly important [34]. Simultaneous elimination of heparin sulphate proteoglycans (HSPGs) and lipoprotein receptor related protein (LRP) from the surface of hepatocytes virtually eliminates recombinant CS protein binding but does not completely inhibit sporozoite invasion [33,53] suggesting other interactions may occur. The receptor/binding site for the peptide identified by Suarez et al. is presently unknown. We employed a cysteine terminated version of this peptide to permit linkage to the ends of the His6 RPCs by oxidative polycondensation. Complexation with plasmid DNA resulted in increased transfection compared with His6 RPC of both Alexander and HepG2 liver cell lines. There was no increased expression in ten of the twelve non-liver cell lines tested suggesting that the CS peptide targeted RPCs could be used to improve liver uptake in a specific manner. The addition of the CS peptide to His6 RPC was also important for siRNA delivery, reducing both total EGFP expression and the percentage number of cells expressing EGFP compared with untargeted polymer. This suggests CS-His6 RPC mediated delivery of biologically active

siRNA to a greater proportion of the cells than the non-targeted polymer. To our knowledge this is the first time a peptide from the circumsporozoite protein has been employed to deliver nucleic acids. Our approach of adding peptides to the termini of the His6 RPCs to improve biological activity, should prove useful to target a variety of other cellular receptors mediating nucleic acid uptake into diseaseassociated tissues. Targeting Hepatitis B surface antigen with siRNA complexed with CS-His6 RPC, resulted in a statistically significant reduction in protein levels compared with control siRNA, confirming that this approach could down regulate pathogenic viral expression for treating liver disease. The reason that the CS-His6 RPC was not more effective than the untargeted polymer at the mRNA level is unclear. In order to develop vectors for in vivo delivery the issue of serum stability must be addressed, since the activity of His6 RPC was attenuated in the presence of serum (Fig. 6 and data not shown). To improve stability we envisage the requirement for ligand bearing RPCs containing mid-chain cysteine residues e.g. CH6KCKH6C (the thiols of the mid-chain cysteine being protected with acetamidomethyl) for use in template assisted condensation. Following oxidative polycondensation of the monomer and deprotection of the mid-chain thiols, the RPC can be complexed with siRNA and then stabilized by further oxidative polycondensation forming reducible crosslinks between internal dilsulphides; this technique having previously been successfully used for DNA delivery [54]. In conclusion His6 RPCs mediate siRNA delivery, albeit requiring different properties to those that are optimal for plasmid DNA. Rational design of siRNA carriers is fundamental for improving efficiency by more effectively releasing siRNA yet maintaining protection outside target cells. Acknowledgements We wish to acknowledge Fionnadh Carroll (University of Oxford) for the technical assistance and Michal Pechar (Institute for Macromolecular Chemistry, Prague, Czech Republic) for the useful advise. This work was funded by the Biotechnology and Biological Sciences Research Council, UK. References [1] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C.C. Mello, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature 391 (6669) (1998) 806–811. [2] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl, Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411 (6836) (2001) 494–498. [3] T. Tuschl, P.D. Zamore, R. Lehmann, D.P. Bartel, P.A. Sharp, Targeted mRNA degradation by double-stranded RNA in vitro, Genes Dev. 13 (24) (1999) 3191–3197. [4] R.M. Schiffelers, A. Ansari, J. Xu, Q. Zhou, Q. Tang, G. Storm, G. Molema, P.Y. Lu, P.V. Scaria, M.C. Woodle, Cancer siRNA therapy by tumor selective delivery with ligandtargeted sterically stabilized nanoparticle, Nucleic Acids Res. 32 (19) (2004) e149. [5] M. Thomas, J.J. Lu, Q. Ge, C. Zhang, J. Chen, A.M. Klibanov, Full deacylation of polyethylenimine dramatically boosts its gene delivery efficiency and specificity to mouse lung, Proc. Natl. Acad. Sci. U. S. A. 102 (16) (2005) 5679–5684. [6] Q. Ge, L. Filip, A. Bai, T. Nguyen, H.N. Eisen, J. Chen, Inhibition of influenza virus production in virus-infected mice by RNA interference, Proc. Natl. Acad. Sci. U. S. A. 101 (23) (2004) 8676–8681. [7] S. Hu-Lieskovan, J.D. Heidel, D.W. Bartlett, M.E. Davis, T.J. Triche, Sequence-specific knockdown of EWS-FLI1 by targeted, nonviral delivery of small interfering RNA inhibits tumor growth in a murine model of metastatic Ewing's sarcoma, Cancer Res. 65 (19) (2005) 8984–8992. [8] M. Keller, A.D. Miller, Intracellular Delivery of Nucleic Acids, Springer, New York, 2005. [9] V.A. Bloomfield, Condensation of DNA by multivalent cations: considerations on mechanism, Biopolymers 31 (13) (1991) 1471–1481. [10] H.G. Hansma, R. Golan, W. Hsieh, C.P. Lollo, P. Mullen-Ley, D. Kwoh, DNA condensation for gene therapy as monitored by atomic force microscopy, Nucleic Acids Res. 26 (10) (1998) 2481–2487. [11] D. Matulis, I. Rouzina, V.A. Bloomfield, Thermodynamics of DNA binding and condensation: isothermal titration calorimetry and electrostatic mechanism, J. Mol. Biol. 296 (4) (2000) 1053–1063. [12] J. Widom, R.L. Baldwin, Cation-induced toroidal condensation of DNA studies with Co3+(NH3)6, J. Mol. Biol. 144 (4) (1980) 431–453. [13] M.L. Read, K.H. Bremner, D. Oupicky, N.K. Green, P.F. Searle, L.W. Seymour, Vectors based on reducible polycations facilitate intracellular release of nucleic acids, J. Gene Med. 5 (3) (2003) 232–245.

55

[14] P. Midoux, M. Monsigny, Efficient gene transfer by histidylated polylysine/pDNA complexes, Bioconjug. Chem. 10 (3) (1999) 406–411. [15] C. Pichon, M.B. Roufai, M. Monsigny, P. Midoux, Histidylated oligolysines increase the transmembrane passage and the biological activity of antisense oligonucleotides, Nucleic Acids Res. 28 (2) (2000) 504–512. [16] M.L. Read, S. Singh, Z. Ahmed, M. Stevenson, S.S. Briggs, D. Oupicky, L.B. Barrett, R. Spice, M. Kendall, M. Berry, J.A. Preece, A. Logan, L.W. Seymour, A versatile reducible polycation-based system for efficient delivery of a broad range of nucleic acids, Nucleic Acids Res. 33 (9) (2005) e86. [17] D.V. Schaffer, N.A. Fidelman, N. Dan, D.A. Lauffenburger, Vector unpacking as a potential barrier for receptor-mediated polyplex gene delivery, Biotechnol. Bioeng. 67 (5) (2000) 598–606. [18] C.M. Ward, M.L. Read, L.W. Seymour, Systemic circulation of poly(L-lysine)/DNA vectors is influenced by polycation molecular weight and type of DNA: differential circulation in mice and rats and the implications for human gene therapy, Blood 97 (8) (2001) 2221–2229. [19] E.E. Mast, M.J. Alter, H.S. Margolis, Strategies to prevent and control hepatitis B and C virus infections: a global perspective, Vaccine 17 (13–14) (1999) 1730–1733. [20] A.P. McCaffrey, H. Nakai, K. Pandey, Z. Huang, F.H. Salazar, H. Xu, S.F. Wieland, P.L. Marion, M.A. Kay, Inhibition of hepatitis B virus in mice by RNA interference, Nat. Biotechnol. 21 (6) (2003) 639–644. [21] C. Klein, C.T. Bock, H. Wedemeyer, T. Wustefeld, S. Locarnini, H.P. Dienes, S. Kubicka, M.P. Manns, C. Trautwein, Inhibition of hepatitis B virus replication in vivo by nucleoside analogues and siRNA, Gastroenterology 125 (1) (2003) 9–18. [22] H. Giladi, M. Ketzinel-Gilad, L. Rivkin, Y. Felig, O. Nussbaum, E. Galun, Small interfering RNA inhibits hepatitis B virus replication in mice, Mol. Ther. 8 (5) (2003) 769–776. [23] D.V. Morrissey, K. Blanchard, L. Shaw, K. Jensen, J.A. Lockridge, B. Dickinson, J.A. McSwiggen, C. Vargeese, K. Bowman, C.S. Shaffer, B.A. Polisky, S. Zinnen, Activity of stabilized short interfering RNA in a mouse model of hepatitis B virus replication, Hepatology 41 (6) (2005) 1349–1356. [24] O. Cussenot, P. Berthon, R. Berger, I. Mowszowicz, A. Faille, F. Hojman, P. Teillac, A. Le Duc, F. Calvo, Immortalization of human adult normal prostatic epithelial cells by liposomes containing large T-SV40 gene, J. Urol. 146 (3) (1991) 881–886. [25] O. Cussenot, P. Berthon, B. Cochand-Priollet, N.J. Maitland, A. Le Duc, Immunocytochemical comparison of cultured normal epithelial prostatic cells with prostatic tissue sections, Exp. Cell Res. 214 (1) (1994) 83–92. [26] P. Berthon, O. Cussenot, L. Hopwood, A. Leduc, N.J. Maitland, Functional expression of SV40 in normal human epithelial and fibroblastic cells-differentiation pattern of non-tumorigenic cell lines, Int. J. Oncol. 6 (1995) 333–343. [27] N.J. Maitland, C.A. Macintosh, J. Hall, M. Sharrard, G. Quinn, S. Lang, In vitro models to study cellular differentiation and function in human prostate cancers, Radiat. Res. 155 (1 Pt 2) (2001) 133–142. [28] C.A. Macintosh, Department of Biology, University of York, 1998. [29] A. Reynolds, D. Leake, Q. Boese, S. Scaringe, W.S. Marshall, A. Khvorova, Rational siRNA design for RNA interference, Nat. Biotechnol. 22 (3) (2004) 326–330. [30] R. Young, P.A. Lovell, Introduction to Polymers, Chapman and Hall, London, 1991. [31] C. Cerami, U. Frevert, P. Sinnis, B. Takacs, P. Clavijo, M.J. Santos, V. Nussenzweig, The basolateral domain of the hepatocyte plasma membrane bears receptors for the circumsporozoite protein of Plasmodium falciparum sporozoites, Cell 70 (6) (1992) 1021–1033. [32] U. Frevert, P. Sinnis, C. Cerami, W. Shreffler, B. Takacs, V. Nussenzweig, Malaria circumsporozoite protein binds to heparan sulfate proteoglycans associated with the surface membrane of hepatocytes, J. Exp. Med. 177 (5) (1993) 1287–1298. [33] U. Frevert, P. Sinnis, J.D. Esko, V. Nussenzweig, Cell surface glycosaminoglycans are not obligatory for Plasmodium berghei sporozoite invasion in vitro, Mol. Biochem. Parasitol. 76 (1–2) (1996) 257–266. [34] J.E. Suarez, M. Urquiza, A. Puentes, J.E. Garcia, H. Curtidor, M. Ocampo, R. Lopez, L.E. Rodriguez, R. Vera, M. Cubillos, M.H. Torres, M.E. Patarroyo, Plasmodium falciparum circumsporozoite (CS) protein peptides specifically bind to HepG2 cells, Vaccine 19 (31) (2001) 4487–4495. [35] D.L. McKenzie, K.Y. Kwok, K.G. Rice, A potent new class of reductively activated peptide gene delivery agents, J. Biol. Chem. 275 (14) (2000) 9970–9977. [36] Q. Leng, P. Scaria, J. Zhu, N. Ambulos, P. Campbell, A.J. Mixson, Highly branched HK peptides are effective carriers of siRNA, J. Gene Med. 7 (7) (2005) 977–986. [37] T. Bettinger, R.C. Carlisle, M.L. Read, M. Ogris, L.W. Seymour, Peptide-mediated RNA delivery: a novel approach for enhanced transfection of primary and post-mitotic cells, Nucleic Acids Res. 29 (18) (2001) 3882–3891. [38] S.H. Kim, H. Mok, J.H. Jeong, S.W. Kim, T.G. Park, Comparative evaluation of targetspecific GFP gene silencing efficiencies for antisense ODN, synthetic siRNA, and siRNA plasmid complexed with PEI-PEG-FOL conjugate, Bioconjug. Chem. 17 (1) (2006) 241–244. [39] S.H. Kim, J.H. Jeong, K.C. Cho, S.W. Kim, T.G. Park, Target-specific gene silencing by siRNA plasmid DNA complexed with folate-modified poly(ethylenimine), J. Control. Release 104 (1) (2005) 223–232. [40] S.R. Popielarski, S.H. Pun, M.E. Davis, A nanoparticle-based model delivery system to guide the rational design of gene delivery to the liver. 1. Synthesis and characterization, Bioconjug. Chem. 16 (5) (2005) 1063–1070. [41] X. Sun, L. Hai, Y. Wu, H.Y. Hu, Z.R. Zhang, Targeted gene delivery to hepatoma cells using galactosylated liposome-polycation-DNA complexes (LPD), J. Drug Target. 13 (2) (2005) 121–128. [42] H. Hosseinkhani, T. Azzam, Y. Tabata, A.J. Domb, Dextran-spermine polycation: an efficient nonviral vector for in vitro and in vivo gene transfection, Gene Ther. 11 (2) (2004) 194–203. [43] J.C. Perales, G.A. Grossmann, M. Molas, G. Liu, T. Ferkol, J. Harpst, H. Oda, R.W. Hanson, Biochemical and functional characterization of DNA complexes capable of

GENE DELIVERY

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENE DELIVERY

56

[44] [45]

[46]

[47]

[48] [49]

M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56 targeting genes to hepatocytes via the asialoglycoprotein receptor, J. Biol. Chem. 272 (11) (1997) 7398–7407. G.Y. Wu, C.H. Wu, Delivery systems for gene therapy, Biotherapy 3 (1) (1991) 87–95. A. Sato, M. Takagi, A. Shimamoto, S. Kawakami, M. Hashida, Small interfering RNA delivery to the liver by intravenous administration of galactosylated cationic liposomes in mice, Biomaterials 28 (7) (2007) 1434–1442. J.J. Turner, S. Jones, M.M. Fabani, G. Ivanova, A.A. Arzumanov, M.J. Gait, RNA targeting with peptide conjugates of oligonucleotides, siRNA and PNA, Blood Cells Mol. Dis. 38 (1) (2007) 1–7. S. Oliveira, I. van Rooy, O. Kranenburg, G. Storm, R.M. Schiffelers, Fusogenic peptides enhance endosomal escape improving siRNA-induced silencing of oncogenes, Int. J. Pharm. 331 (2) (2007) 211–214. A. Muratovska, M.R. Eccles, Conjugate for efficient delivery of short interfering RNA (siRNA) into mammalian cells, FEBS Lett. 558 (1–3) (2004) 63–68. V. Nussenzweig, R.S. Nussenzweig, Rationale for the development of an engineered sporozoite malaria vaccine, Adv. Immunol. 45 (1989) 283–334.

[50] P. Sinnis, P. Clavijo, D. Fenyo, B.T. Chait, C. Cerami, V. Nussenzweig, Structural and functional properties of region II-plus of the malaria circumsporozoite protein, J. Exp. Med. 180 (1) (1994) 297–306. [51] L.S. Ozaki, P. Svec, R.S. Nussenzweig, V. Nussenzweig, G.N. Godson, Structure of the plasmodium knowlesi gene coding for the circumsporozoite protein, Cell 34 (3) (1983) 815–822. [52] J.B. Dame, J.L. Williams, T.F. McCutchan, J.L. Weber, R.A. Wirtz, W.T. Hockmeyer, W. L. Maloy, J.D. Haynes, I. Schneider, D. Roberts, et al., Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium falciparum, Science 225 (4662) (1984) 593–599. [53] M. Shakibaei, U. Frevert, Dual interaction of the malaria circumsporozoite protein with the low density lipoprotein receptor-related protein (LRP) and heparan sulfate proteoglycans, J. Exp. Med. 184 (5) (1996) 1699–1711. [54] Y. Park, K.Y. Kwok, C. Boukarim, K.G. Rice, Synthesis of sulfhydryl cross-linking poly (ethylene glycol)-peptides and glycopeptides as carriers for gene delivery, Bioconjug. Chem. 13 (2) (2002) 232–239.