- Email: [email protected]
Dendrosomal curcumin nanoformulation modulate apoptosis-related genes and protein expression in hepatocarcinoma cell lines
Accepted Manuscript Title: Dendrosomal Curcumin Nanoformulation Modulate Apoptosis-Related Genes and Protein Expression in Hepatocarcinoma Cell Lines Author: Maryam Montazeri Majid Sadeghizadeh Yones Pilehvar-Soltanahmadi Faraz Zarghami Samaneh Khodi Mina Mohaghegh Nosratollah Zarghami PII: DOI: Reference:
S0378-5173(16)30419-7 http://dx.doi.org/doi:10.1016/j.ijpharm.2016.05.039 IJP 15778
To appear in:
International Journal of Pharmaceutics
Received date: Revised date: Accepted date:
20-2-2016 16-5-2016 21-5-2016
Please cite this article as: Montazeri, Maryam, Sadeghizadeh, Majid, PilehvarSoltanahmadi, Yones, Zarghami, Faraz, Khodi, Samaneh, Mohaghegh, Mina, Zarghami, Nosratollah, Dendrosomal Curcumin Nanoformulation Modulate Apoptosis-Related Genes and Protein Expression in Hepatocarcinoma Cell Lines.International Journal of Pharmaceutics http://dx.doi.org/10.1016/j.ijpharm.2016.05.039 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Dendrosomal Curcumin Nanoformulation Modulate Apoptosis-Related Genes and Protein Expression in Hepatocarcinoma Cell Lines
Maryam Montazeri1,2, Majid Sadeghizadeh3*, Yones Pilehvar-Soltanahmadi2,1, Faraz Zarghami4, Samaneh Khodi5, Mina Mohaghegh6, Nosratollah Zarghami2,1*
1
Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz
University of Medical Sciences, Tabriz, Iran 2
Hematology and Oncology Research Center, Tabriz University of Medical Sciences, Tabriz,
Iran 3
Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran,
Iran 4
Imam Reza Teaching Hospital, Tabriz University of Medical Sciences, Tabriz, Iran
5
Department of Medical Genetic, National Institute of Genetic Engineering and
Biotechnology, Tehran, Iran 6
Department of Molecular Biology and Biotechnology, University of Aix-Marseille,
Marseille, France
*Corresponding authors: Prof. Nosratollah Zarghami, Hematology and Oncology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran. E-mail: [email protected], Telefax: +98-4133364666
Dr. Majid Sadeghizadeh, Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran, Iran. Email: [email protected], Tel: +98912 214 84 75
Abstract The side-effects observed in conventional therapies have made them unpromising in curing Hepatocellular carcinoma; therefore, developing novel treatments can be an overwhelming significance. One of such novel agents is curcumin which can induce apoptosis in various cancerous cells, however, its poor solubility is restricted its application. To overcome this issue, this paper employed dendrosomal curcumin (DNC) was employed to in prevent hepatocarcinoma in both RNA and protein levels. Hepatocarcinoma cells, p53 wildtype HepG2 and p53 mutant Huh7, were treated with DNC and investigated for toxicity study using MTT assay. Cell cycle distribution and apoptosis were analyzed using Flow-cytometry and Annexin-V-FLUOS/PI staining. Real-time PCR and Western blot were employed to analyze p53, BAX, Bcl-2, p21 and Noxa in DNC-treated cells. DNC inhibited the growth in the form of time-dependent manner, while the carrier alone was not toxic to the cell. Flowcytometry data showed the constant concentration of 20µM DNC during the time significantly increases cell population in SubG1 phase. Annexin-V-PI test showed curcumininduced apoptosis was enhanced in Huh7 as well as HepG2, compared to untreated cells. Followed by treatment, mRNA expression of p21, BAX, and Noxa increased, while the expression of Bcl-2 decreased, and unlike HepG2, Huh7 showed down-regulation of p53. In summary, DNC-treated hepatocellular carcinoma cells undergo apoptosis by changing the expression of genes involved in the apoptosis and proliferation processes. These findings suggest that DNC, as a plant-originated therapeutic agent, could be applied in cancer treatment. Key words: dendrosomal curcumin, p53 mutant, apoptosis, Hepatocarcinoma, Real-Time PCR
1. Introduction Hepatocellular carcinoma (HCC), which is ranked as the fifth lethal cancer in men and the eighth one in women, is the third leading cause of cancer-related deaths worldwide estimated about 700,000 deaths per year. Since p53 gene is mutated in approximately about 50% of human cancers, and does not accumulate in normal unstressed cells, indicating its essential role in both clinical marker and therapeutic target, therefore it is important to detect its modification in therapeutic responses (Farnebo et al., 2010). 74% of p53 mutations are missense mutations occurring in DNA-binding domains. The ninth most common mutation in hepatocarcinoma cells is Y220C, occurred in exon 6 (Tyr-Cys). Y220C mutant exists in Huh7cell line, in which mutant p53 protein is overexpressed with a prolonged half-life leading to its accumulation in the nuclei (Boeckler et al., 2008). Conventional therapeutic methods, including surgery and liver transplant, have several limiting difficulties. For instance, the scarcity of donor organs makes the liver transplantation applicable in a small number of HCC patients (Darvesh et al., 2012). Therefore, regarding the alarming increase in HCC, new alternative treatment approaches are needed. Curcumin (diferuloyl methane), as a major active ingredient of turmeric, is derived from the dried roots of the plant Curcuma Longa and is used as a spice and a traditional medicine for many centuries in India and other Asian countries (Kazemi-Lomedasht et al., 2013). It has chemo-preventive and therapeutic features including anti-proliferative, anti-mutagenic and anti-carcinogenic properties (Esmatabadi et al., 2015; Nasiri et al., 2013). It induces the release of apoptosis inducing factor from mitochondria and eliminates the cancer cells (Rashmi et al., 2003). Although, the underlying mechanisms are not well-known, many molecular targets have been suggested including various transcription factors, inflammatory enzymes, cytokines, adhesion molecules and cell survival proteins (Badrzadeh et al., 2014; Milacic et al., 2008). Curcumin has shown a reduced solubility and poor uptake in both in vitro and in vivo studies, however
its application in medicine and more specifically drug delivery is spreading rapidly (Mollazade et al., 2013). A promising method to improve the solubility of curcumin is the application of polymeric nanoparticles, such as dendrosomes which were first applied as gene reporter (Sadeghizadeh et al., 2008). Dendrosomes are inexpensive, non-toxin, neutral, biodegradable, covalent or self- assembled, hyper branched, and spheroidal polymeric nanoparticles nano-carriers derived from oleic acid which were synthesized by our group for the first time. Previous studies by our group introduced a dendrosome specified Den O400, a nonionic biodegradable denderic glycol ester, to improve the solubility of curcumin, with maximum stability in the optimal ratio of 1:25 (curcumin /dendrosome), and to escalate its anti-tumor (Babaei et al., 2012; Tahmasebi Birgani et al., 2015). The physical and chemical stability of DNC was studied by Mirgani et al. Transmission electron micrographs has shown DNC as a sphere shaped nanostructure and DLS analysis has determined DNC with mean diameter of 200 nm, polydispersity index (PDI) of 0.4, meaning that its colloidal suspension is polydispersed, ζ-potential of around −7 mV, and very high loading efficiency of 87%. The content of curcumin into the dendrosome was also quantified by HPLC-DAD analysis which was at constant level after preparation (Table 1) (Tahmasebi Mirgani et al., 2014b). However, the toxicity of curcumin is more in cancer cells compared to normal cells, the apoptotic effects in high concentration of curcumin is reported in some normal cell types such as hepatocytes and human normal fibroblasts (Bisht et al., 2007; Singh, 2007). Here, HepG2, harboring wild-type p53, and Huh7, harboring p53 mutant, hepatoma cell lines were used to study the effect of DNC on cancer cells to investigate whether DNC reduces the expression of p53 mutant and leads cancer cells into cell death and if treated cancer cells make changes in the gene expression involved in apoptosis and cell cycle.
2. Materials and Methods 2.1 Cell lines, cell culture and Reagents The human cancer cell linesHepG2/Huh7 (derived from hepatocellular carcinoma) and HFSF-PI3 (normal human fibroblast) were obtained from the Iranian national cell bank (Pasteur institute of Iran, Tehran). The Huh7cell line was cultured in DMEM (low glucose) and HepG2 cell was cultured in DMEM (High glucose) culture medium (pH=7.2), supplemented with 100u/ml penicillin, 100μg/ml streptomycin, and 10% fetal bovine serum (FBS, GIBCO, USA), and incubated at 37ºC in a humidified atmosphere of 5% CO2. The culture medium was changed every other day. Curcumin was obtained from Merck (Indianapolis, IN, USA). 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Cell culture products were obtained from Gibco (UK), Annexin V FLOUS kit and Propidium iodide (PI) were purchased from Roche (Roche Applied Science, Penzberg, Germany).
2.2 OA400 carrier and DNC preparation Dendrosomes are PEGylated micelles derived from oleic acids, which was prepared by an optimized protocol in our Lab (Babaei et al., 2012). Briefly, OA400 was synthetized by esterification of oleoyl chloride (0.01 mol), polyethylene glycol 400 (0.01 mol) in presence of triethylamine (0.012 mol) and chloroform as solvent at 25°C for 4 hours, followed by filtration to remove triethylamine hydrochloride salt and evaporation in vacuum oven at 40°C for 4 hours to remove the chloroform (Tahmasebi Mirgani et al., 2014a). Curcumin was dissolved in various amounts of prepared polymeric carriers in weight/weight ratios of dendrosome/curcumin ranging from 1:10 to 1:50 and checked for absorbance spectra by ultraviolet spectrophotometry (Infinite® 200 PRO, Tecan, Mannedorf, Switzerland). The
mixture was incubated at 37 oC for an overnight in order to dissolve the curcumin completely in the polymeric carrier. Then, the appropriate mixture of dendrosome and curcumin was evaluated at wavelength of 420 nm, in comparison with free curcumin dissolved in PBS and 1% methanol as control samples and 1:25 was chosen as appropriate proportion 1:25 was chosen as appropriate proportion and very stable for weeks at room temperature without precipitation of curcumin. The loading of dendrosome nanocarriers with curcumin molecules was performed using Gou et al’s protocol (Gou et al., 2011). In summary, curcumin and dendrosome were co-dissolved in 5 mL acetone; this solution was added into 5 mL PBS while stirring constantly. Then, the acetone was evaporated in a rotary evaporator. The curcumin/dendrosome micelle solution was sterilized using a 0.22 μm syringe filter (EMD Millipore). Prepared DNC was kept away from light in 4°C for further procedures. Due to the innate fluorescence of curcumin, the cells were treated with 10 µM DNC and studied after 4h by fluorescence microscopy. Non-treated samples were used as a reference value; autofluorescence of the cells was set as “Zero” value.
2.3 Uptake of DNC versus void curcumin To study the uptake of DNC by different cell lines, the 80 x 103 cells per mL fresh cells were transferred into 12-well plate and treated with 18μM DNC as well as void curcumin for 0 to 7 h. To evaluate whether DNC is attached to the cell membrane or absorbed into cells, its cellular localization was evaluated by fluorescence microscopy after treating with DNC and void curcumin in various incubation times. Each experiment was repeated at least three times.
2.4 Cell proliferation assays MTT viability assay was used to assess cell proliferation as follows: Adherent cells were released from their substrate by trypsinization, centrifuged and resuspend at 1 x 10 6 per mL
followed by preparing serial dilutions of cells in culture medium from 1 x 106 to 1 x 103 cells per mL. 200 μL of the dilutions were plated into 96-well plate, in triplicate, including three control wells of medium alone to provide the blanks for absorbance readings. The cells were incubated at 37ºC in a humidified atmosphere of 5% CO2 for 24 h. In the following, 18µM of DNC was added to each well, except untreated sample, and the plates were return to cell culture incubator for 24, 48 and 72 h. Then, 5 mg/ml of MTT Reagent was added to each well, then the wells were emptied and 200 μL of DMSO was added and after 15 min the cell density was measured at 490 nm in a microtiter plate reader. The average values from triplicate readings were determined and subtracted the average value for the blank. The percentage of proliferation was determined for each concentration of the indicated DNC according to the manufacturer’s instruction (Sigma-Aldrich, USA). The percentage of cell viability of treated cells against control cells and the concentration at which cell growth was inhibited by 50% (inhibitory concentration: IC50) was determined by standard curve method (Zamani et al., 2015a)
2.5 Cell cycle analysis The effect of DNC on the distribution of cells in cell cycle was performed by flow cytometry analysis using Propidium Iodide (PI) staining. The cells were seeded in 12-well plate (3 × 105 cells/ml) and treated with 18μM DNC for 12, 24, 48 and 72 h. The cells were then harvested and washed twice with cold PBS, fixed in ice-cold 75% ethanol for 15 min at 4 °C. The cells were washed twice with cold PBS and resuspended in PBS containing 50 μg/mL PI, 0.1% sodium citrate, and 0.1 Triton X-100 followed by shaking at 37 °C for 15 minutes. Analyses were done on a FACS flow cytometer (FACS Calibur Becton Dickinson, USA) and the data were consequently evaluated using Cell Quest software (BD Biosciences).
2.6 Detection of Apoptosis with Annexin-V-FLOUS staining In order to measure the percentage of apoptotic cells, Annexin-V-FLOUS kit was used to detect the exposed phosphatidylserine in the cell membrane. The cell lines were centrifuged and resuspended in 200μl of Binding Buffer. After 5 minute, Annexin-V-FLOUS (1μl) and PI (1μl) were added to tubes and incubated at room temperature (5 minutes) in the dark and then analyzed by FACSCalibur flow cytometer. Annexin-V-FLUOS positive and PI negative cells were quantified and the apoptosis percentage from the untreated cells was subtracted for each analysis.
2.7 mRNA Profiling of p53, p21, Noxa, BAX and Bcl-2 To measure mRNA expression of the p53 gene, total RNA was extracted from cultured cell using TRIzol® reagent (Invitrogen). DNase I (Fermentase, Lithuania) was used to remove DNA contamination. The purity and integrity of RNA (260/280 nm ratio) was studied by Spectrophotometer (Nano Drop ND-1000) and gel electrophoresis on 1% agarose gel. Prime Script™ RT reagent (Takara Bio) kit was used for cDNA synthesis, according to the manufacturer's instructions, containing 25 pmol oligo dT primer, 50 pmol random 6 mers and 500 ng of total RNA.
2.8 Real Time PCR Real Time PCR was done in presence of 2 µl SYBER green master mix (Takara Bio), 200ng of the generated cDNA, and 250 nM of appropriate primers. The thermocycler condition was as follows: 95°C for 15 min for initial activation, followed by 40 cycles at 95°C for 5 seconds, annealing temperatures 63°C for 23 seconds, 72°C for 34 sec, and a final extension at 72°C for 10 minutes. Real Time PCR was carried out in triplicate. The cycling program was set on ABI 7500 device. PCR products were visualized by electrophoresis on a 1.5% to
check the size of PCR products. PCR efficiency was studied using linear regression analysis to the exponential phase of the amplification curve for each PCR reaction using a program such as LinReg PCR (Schefe et al., 2006). The list of primers for specific genes and housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are indicated in Table 2. Comparative threshold cycle (Ct) method was employed to study the relative quantification of related genes. The Ct value of the gene was normalized for each sample using the formula: ΔCt = Ct (genes) - Ct (GAPDH). Formula of ΔΔCt = ΔCt (treated) - ΔCt (untreated) was used to determine relative expression levels. The value was used to plot the expression of genes using the formula 2−ΔΔCt (Liu et al., 2013).
2.9 Western blot analysis To extract total proteins, the cells were lysed using Radioimmunoprecipitation assay buffer (RIPA buffer) (2.5M NaCl, 1M Tris-HCL pH 7.6, 10% SDS pH 8.0, 0.1M NaVO4, 0.5M EDTA and 10 μl/mL NP-40), then, protein concentration was quantified by Bradford assay with BSA as a standard. Beta-actin was employed as housekeeping gene. An equal amount of protein was separated (80 μg protein per lane) by SDS-PAGE gel electrophoresis and transferred to a membrane. The membrane was blocked with 5% non-fat milk for 1.5 h at 37°C. In the following, fresh blocking buffer supplemented with 1:1000 primary mAb of p53, p21, BAX, Bcl-2 and Beta-actin (Abcam, USA) was replaced for an overnight at 4◦C. Then, the membrane was washed three times with TBST for 10 min and incubated for 1h and 15 min at 37 ◦C in blocking buffer with 1:5000 dilutions of HRP goat anti-mouse IgG secondary Abs. Then, the membrane was washed three times with TBST for 10 min. Detection was performed using ECL kit (RPN2235, Amersham, UK) according to the manufacturer’s instruction.
2.10 Statistical analysis All experiments were performed three times. Data obtained from cell proliferation assays and other experiments were analyzed using the ANOVA and the statistical significance level was set at p ≤ 0.05. All Statistical analysis was performed using Graph Pad Prism software (Inc., La Jolla, CA, USA).
3. Results 3.1 The effect of DNC on HepG2/Huh7 cancer cells Here, the cancerous cell lines treated with void dendrosome, free curcumin and DNC were visualized by light and UV microscopy. As shown, due to the innate fluorescent characteristic of curcumin, the free-curcumin can be seen mostly as crystals in intercellular spaces, while, the DNC -treated cells show curcumin mostly as intracellular dispersed plots, which indicates that dendrosomal nanocarrier significantly improves the internalization of curcumin inside the cells (Fig. 1). DNC inhibits the hepatocellular carcinoma cells in the form of time-dependent, while the carrier alone is not toxic to the cell (Fig. 2). At an effective dose for anticancer activity (below 25 μM) and even at 50 μM, curcumin and free nanocarrier were not significantly toxic to normal human fibroblastic cells (HFSF-PI3). It suggests that the mortality observed in the cells is induced by curcumin and the carrier only increases the solubility of curcumin and facilitates the delivery to cells. IC50 in three different periods of 24, 48, and 72 for Huh7 cells treated with DNC was obtained 23, 18, and 14 µM (p<0.0091) and for and HepG2 was 25, 22, 17 µM respectively (p<0.0041). Based on figure 2, IC50 in different periods of time for Huh7 cells treated with free curcumin was observed after 48h and 72h which were about 48 (p<0.003) and 40 (p<0.0051), respectively. IC50 in HepG2 cells treated with free curcumin after 24h, 48h and 72h were about 50 (p<0049), 48 (p<0.0064) and 35 (p<0.0043),
respectively. Based on the data obtained, the concentration of 18μM was considered as a choice for concentration.
3.2 The effects of DNC on HepG2/Huh7 cell cycle distribution Flow cytometry was applied to analyze the mechanism of the growth inhibitory effects of DNC. The cell population increase after treatment during the time (12, 24, 48, and 72 h) led to the appearance of the SubG1 peak compared to untreated cells (Fig. 3). The results showed that DNC has induced tumor cell death in the hepatocarcinoma cells in the form of timedependent. It was also shown that in the concentration close to IC50 (18µM), by increasing the time, Huh7 cell population increases in SubG1 area up to 17.05% ± 0.003%, 37.8% ± 0.008%, 65.26% ± 0.001% and 79.11% ± 0.00% after 12, 24, 48, and 72 h which is obviously more than untreated cells (3.7% ± 0.007%). DNC -treated HepG2 cell population increased in SubG1 area up to 14.37% ± 0.002%, 32.31% ± 0.03%, 35.80% ± 0.01%, and 40.71% ± 0.018% after 12, 24, 48, and 72 h which is more than untreated cells (5.07% ± 0.003%). DNC -treated Huh7 showed a more remarkable reduction in cell population in S, G1 and G2/M phases during the time (Fig. 4) (Table 3).
3.3 DNC triggers apoptosis in HepG2/Huh7 cells Annexin-V-PI test and the treatment with 18µM DNC in time-dependent manner were applied to study the apoptosis induced in the cells (apoptosis or necrosis). In this experiment, the exposure of the cells to the right of histogram shows that the cell death is triggered by apoptosis, in which the results were significant compared to untreated cells (p<0.0001) (Fig. 5). Increasing the time from 24 h to 72 h obviously induced apoptosis in both DNC -treated cells, which was significant compared to the untreated cells. For DNC -treated Huh7, the percentage of total apoptosis (referring to the sum of early and late apoptosis) was 22.34% ±
0.0065%, 34.9% ± 0.0125%, and 59.01% ± 0.021% after 24, 48 and 72 h, respectively. For DNC-treated HepG2 the percentage of apoptosis was 35.36% ± 0.011%, 20.68% ± 0.005%, and 45.09% ± 0.009% after 24, 48 and 72 h, respectively. An increased in late apoptosis was only observed in DNC -treated HepG2 cells after 48 and 72h (Table 4) (Fig. 6).
3.4 Expression of p53, p21, BAX, Bcl-2, and Noxa genes in DNC - treated cells The analysis showed that followed by the treatment with 18μM DNC, mRNA expression of the pro-apoptosis genes of BAX, Noxa and p21 significantly increased during a period of 24, 48 and 72 h, while the expression of anti-apoptosis Bcl-2 decreases. p53-mutant Huh7 showed a significant down-regulated expression during the treatment, whereas, p53-wild-type HepG2 showed an up-regulated expression. No changes were observed in the expression pattern of DNC -treated HFSF-PI3 cells (Fig. 7). Statistically calculated values for BAX، Bcl-2، p21، Noxa and p53 genes were obtained. The results of the melting curve analysis indicated the lack of non-specific product (data not shown). Western blot indicated that in presence of DNC the levels of p53 and Bcl-2 reduces in Huh7, while the levels of BAX and p21 increases, whereas, the increased levels of p53 along with BAX and p21, and reduced level of Bcl-2 were observed in HepG2, which are the characteristic features of apoptosis (Fig 8).
5. Discussion Hepatocellular carcinoma (HCC) is the third leading cause of death from cancer which its therapy by conventional methods involves limiting difficulties, thereby; new therapeutic strategies are needed (Wang et al., 2013). Dietary polyphenols have demonstrated significant effect as both preventive and therapeutic agents in various cancerous cells such as breast, liver, lung, prostate and skin (Lall et al., 2015). Curcumin, as one of the considerable
hydrophobic molecules, is a pleiotropic drug which can identify various targets and selectively penetrate through the cancerous cell membrane, compared to normal types, and initiates tumor growth prevention and apoptosis induction (Chaudhary and Hruska, 2003; Tabatabaei Mirakabad et al., 2015). The application of curcumin is limited due to its low solubility, poor absorption and rapid metabolism, which was overcome in our previous study in combination with a synthetized Dendrosomal carrier with a great potential for the solubility of curcumin and increasing its uptake in the tumor cells and cytotoxicity. The developed DNC was a curcumin-loaded mPEG-OA polymerases with a very stable structure for a long time after formulation (Erfani-Moghadam et al., 2014). Our group also confirmed the inhibitory role of DNC in cancer cell metastasis (Dehghan Esmatabadi et al., 2015; Farhangi et al., 2015), and in the methylation of tumor suppressor genes (Zamani et al., 2015b). The therapeutic effect of DNC was also reported by our group in an animal model of Multiple Sclerosis disease with decreasing inflammation and improving myelin repair mechanisms (Mohajeri et al., 2015). The protective effects of DNC were also studied in vivo tumor growth models on mammary tumor bearing mice, in which demonstrated a significant DNC -mediated reduction in the incidence, the size and the weight of tumors (Alizadeh et al., 2015; Farhangi et al., 2015), and on rat colon cancer that showed “dendrosome can be used as a suitable nanoparticle to increase curcumin efficiency in the prevention or treatment of colon cancer” (Sarbolouki et al., 2012). According to previous findings on the potential of DNC, in this research, we were aimed to utilize it as an agent on the hepatocarcinoma cancer cells to study its effect on tumor cell death. Since, the high level of p53 missense mutation is observed in human malignancies cell lines which not only makes the protein lose its tumor suppressor function but also acquire new oncogenic gain-of-function, thus p53 mutant protein accumulates in tumors and affects
pathology (Goh et al., 2011). Therefore, here we employed Huh7, as p53 mutant cell line, compared to HepG2 as p53 wild-type. Huh7 contains Y220C mutant by which a surface crevice is created and the protein consequently become highly destabilized (Boeckler et al., 2008). To gain an insight into the effect of nanocarrier in curcumin penetration, Huh7/HepG2 cells were treated with DNC, free curcumin and nanocarrier in concentration close to IC50 (18μM). Studies by fluorescent microscopy showed that free curcumin mostly aggregates in intercellular space as crystal bodies with different sizes, while DNC can easily penetrate inside the cells, indicating that the solubility, uptake and cytotoxicity of curcumin are enhanced significantly using dendrosomal nanocarrier. The results of MTT in the presence of DNC, free curcumin, and nanocarrier indicated that DNC affects as a tumor preventive in a time-dependent manner, suggesting that DNC prevents tumor growth and reduces the viability of Huh7/HepG2 cells, whereas, free curcumin and nanocarrier alone showed no remarkable toxicity in the same concentration as DNC. Mortality induced by DNC was not detected in normal fibroblasts cell lines. The differences between the cell viability in presence of DNC, free curcumin, nanocarrier and the untreated cells were significant (p<0.05), therefore, only DNC was investigated in the further experiments. MTT assay was already done on U87 human glioblastoma cell line (U87MG) which showed higher toxicity of curcumin and DNC after 24h and 48h treatment, it suggests that the toxicity triggered by DNC depends on the cell type (Erfani-Moghadam et al., 2014). In fact, the MTT results showed that the DNC increases tumor cell access to curcumin and triggers tumor cell death. A concentration close to average IC50 of each cell at different incubation time (18µM) was chosen for further experiments. Studies in the past three decades in the field of absorption, distribution, metabolism and excretion of curcumin have indicated its poor absorption, fast metabolism, and extremely poor solubility in water, which have restricted its potential
anticancer application (Li et al., 2005; Wahlstrom and Blennow, 1978). Here, microscopic observations showed sedimentary crystals of the free curcumin in intercellular space, which illustrates its insolubility, moreover, based on MTT results no considerable mortality in the cancerous cell lines as well as DNC in the same suppressive concentration was observed, therefore; only DNC was investigated in the further experiments. We used PI stained DNA to quantify cell cycle by flow cytometry, and our data suggests a significant increase in DNC -treated Huh7/HepG2 cells in SubG1 area during the time, which was along with a significant reduction in cell population in S, G1 and G2/M phases. Considering that Huh7 approximately showed two-fold increase in SubG1 area compared to HepG2. Although the behavior of curcumin against the cell cycle is different depending on the cell type, they all increase hypo diploid cells (SubG1) (Chakraborty et al., 2006; ErfaniMoghadam et al., 2014). Wang et al also reported the attenuation of cell growth by curcumin in Huh7 and HepG2 cells in the G2/M phase (Wang et al., 2008). In our study, Annexin-V- FLUOS and PI staining were used to study the apoptosis process. The curcumin-induced apoptosis has been studied in many papers, and its role to modulate various apoptosis pathways has been described (Chakraborty et al., 2006; Erfani-Moghadam et al., 2014). In the present study, Huh7/HepG2 cells were exposed to 18μM concentrations of DNC for 24, 48 and 72 h. Our results showed significant effect of DNC on apoptosis induction in a time-dependent manner with no necrosis observed following the treatment, which is in accordance with those of our previous dendrosome research (Tahmasebi Mirgani et al., 2014a). As the time increased, the mean percentage of apoptosis in Huh7 increased, so that reached up to 59.01% ± 0.021 within 72 h, which is more compared to HepG2 cells (45.09% ±0.009), therefore it seems that DNC induces cell death more considerable in p53 mutant Huh7 after 72 h compared to p53 wild-type. DNC -treated HepG2 also showed a different
behavior in apoptosis by the time during the treatment, so that it shows late apoptosis in 48 and 72h compared to 24h. Conclusively, it was found that DNC induces cell death in Huh7/HepG2 which is compatible with activation of the apoptotic pathways in a timedependent manner. Our group previously studied the effect of DNC and free curcumin, and confirmed that DNC do not induce apoptosis in normal fibroblast cell lines (Babaei et al., 2012). Our data is consistent with the previous researches on apoptotic role of curcumin in different cancer cell lines (Liu et al., 2013; Moos et al., 2004; Song et al., 2005), accordingly, DNC could significantly trigger apoptosis in p53 wild-type as well as p53 mutant. Careful study of cell distribution and apoptosis in hepatocarcinoma cell lines revealed that the Huh7 cells, expressing a high level of p53 mutant, was more sensitive to DNC toxicity. On the other hand, HepG2 cells, expressing wild-type p53 also showed sensitivity, but in lower apoptotic percentage. Although our data is in contrary to the findings indicating the cells with a high level of wild-type p53 are more sensitive to curcumin toxicity (Sa and Das, 2008), our results may be due to the fact that HepG2 expresses moderate levels of p53. Conclusively, our results provide support for a potential therapeutic role of DNC in the prevention of hepatocarcinoma via its apoptosis-inducing and anti-proliferative properties even in cancerous cells with a high level of mutant p53. As motioned in many studies, the mechanism of action of curcumin is mediated by regulating down-stream proteins of p53, such as p21 which mainly function in cell growth and the other proteins such as BAX, Bcl-2, and Noxa which are involved in apoptosis (Liu et al., 2013). In our paper the expression pattern rendered by DNC was studied in mRNA level using Realtime PCR and emphasized that DNC is able to up-regulate the pro-apoptotic proteins of BAX and Noxa, and down-regulate anti-apoptotic protein of Bcl-2. Song and colleagues also demonstrated that curcumin in a time dependent manner significantly increases BAX protein expression, as well as reducing the expression of Bcl-2 (Chaudhary and Hruska, 2003).
According to the generally known, overexpression of BAX promotes cell death; unlike, Bcl-2 functions as a suppressor of apoptosis, our finding is indicative of the Bcl-2 family role in apoptosis induction mediated by DNC in hepatocarcinoma cell lines. The role of p53 in apoptotic property of curcumin is controversial, since some studies demonstrate the curcumin induces apoptosis through p53-dependent induction, whereas some others indicate p53-independent pathways (Watson et al., 2010). Our data illustrated that p53 protein level is up-regulated in HepG2, whereas is down-regulated in Huh7 after DNC treatment, both in mRNA and protein levels. The same results have been found in a study on p53-mutant breast cancer cell line (Bae et al., 2014). Functional activation of p53 wild-type was observed by the increased expression of p21, BAX and Noxa in DNC -treated HepG2, while DNC could lead to the same results with down-regulated mutant p53 in Huh7 cell lines. Accordingly, DNC -induced apoptosis may also be through p53-independent pathways. Our group formerly reported DNC -induced apoptosis in A431 and U87MG cell lines using PARP and caspase-3 proteins, respectively (Babaei et al., 2012; Tahmasebi Mirgani et al., 2014a), and here with the study of BAX and Bcl-2 proteins, we conclude that DNC may trigger apoptosis in p53 mutant cell lines by mediating various target molecules involved in apoptosis pathway. Western blot analysis was performed for final approval of the results of real-time PCR and flow cytometry (cell cycle and apoptosis). The results of western blotting indicated that the expression of Bcl-2 reduces and the expression of BAX, p21 increases in DNC -treated Huh7/HepG2 cell lines, and the p53 is up-regulated and down-regulated in HepG2 and Huh7 cell lines, respectively, which were in line with the data obtained from real-time PCR and flow cytometry tests.
6. Conclusions In conclusion, due to the accumulation and oncogenic activity of mutant p53 in human cancers, it is important to focus on the potential impact of p53 mutation on therapeutic responses. Here we studied the effect of DNC as a safe formulation with plant origin to inhibit the proliferation of Huh7/HepG2 hepatocellular carcinoma cells, as tumor models. As shown, DNC induces apoptosis in form of time-dependent by modulating the Bcl-2, BAX and Noxa. Moreover, due to p53 independent cytotoxic effect of DNC on hepatoma cancer cells, DNC could be a promising therapeutic method in cancerous cell lines, even p53 mutant cancers. According to the significance of data obtained in the study, the investigation of DNC in animal models will be in progress.
Acknowledgments This work was supported by grant from the department of Medical Biotechnology, Faculty of Advance Medical Sciences, Tabriz University of medical science (Project Number: 91/4-3/2). The authors gratefully acknowledge these research departments for their sincere support offered during the project. The authors are so thankful to their colleague at Tarbiat Modares University, for her kind help in performing experiments. The authors are thankful to their coworkers in the Cell and Molecular Laboratory of Iran University for their support in performing flow cytometry and western blot analysis. The current work is dedicated to the late Professor Mohammad Nabi Sarbolouki who was a pioneer of dendrosome-based delivery of curcumin.
Conflict of Interest: The authors disclose no conflicts.
References Alizadeh, A.M., Sadeghizadeh, M., Najafi, F., Ardestani, S.K., Erfani-Moghadam, V., Khaniki, M., Rezaei, A., Zamani, M., Khodayari, S., Khodayari, H., Mohagheghi, M.A., 2015. Encapsulation of
curcumin in diblock copolymer micelles for cancer therapy. BioMed research international 2015, 824746. Babaei, E., Sadeghizadeh, M., Hassan, Z.M., Feizi, M.A.H., Najafi, F., Hashemi, S.M., 2012. DNC significantly
suppresses
cancer
cell
proliferation
in
vitro
and
in
vivo.
International
immunopharmacology 12, 226-234. Badrzadeh, F., Akbarzadeh, A., Zarghami, N., Yamchi, M.R., Zeighamian, V., Tabatabae, F.S., Taheri, M., Kafil, H.S., 2014. Comparison between effects of free curcumin and curcumin loaded NIPAAmMAA nanoparticles on telomerase and PinX1 gene expression in lung cancer cells. Asian Pac J Cancer Prev 15, 8931-8936. Bae, Y.-H., Shin, J.-M., Park, H.-J., Jang, H.-O., Bae, M.-K., Bae, S.-K., 2014. Gain-of-function mutant p53-R280K mediates survival of breast cancer cells. Genes & genomics 36, 171-178. Bisht, S., Feldmann, G., Soni, S., Ravi, R., Karikar, C., Maitra, A., Maitra, A., 2007. Polymeric nanoparticle-encapsulated curcumin (“nanocurcumin”): a novel strategy for human cancer therapy. J Nanobiotechnology 5, 1-18. Boeckler, F.M., Joerger, A.C., Jaggi, G., Rutherford, T.J., Veprintsev, D.B., Fersht, A.R., 2008. Targeted rescue of a destabilized mutant of p53 by an in silico screened drug. Proc Natl Acad Sci U S A 105, 10360-10365. Chakraborty, S., Ghosh, U., Bhattacharyya, N., Bhattacharya, R., Roy, M., 2006. Inhibition of telomerase activity and induction of apoptosis by curcumin in K-562 cells. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 596, 81-90. Chaudhary, L.R., Hruska, K.A., 2003. Inhibition of cell survival signal protein kinase B/Akt by curcumin in human prostate cancer cells. Journal of cellular biochemistry 89, 1-5. Darvesh, A.S., Aggarwal, B.B., Bishayee, A., 2012. Curcumin and liver cancer: a review. Curr Pharm Biotechnol 13, 218-228. Dehghan Esmatabadi, M.J., Farhangi, B., Safari, Z., Kazerooni, H., Shirzad, H., Zolghadr, F., Sadeghizadeh, M., 2015. DNC inhibits metastatic potential of human SW480 colon cancer cells
through Down-regulation of Claudin1, Zeb1 and Hef1-1 gene expression. Asian Pac J Cancer Prev 16, 2473-2481. Erfani-Moghadam, V., Nomani, A., Zamani, M., Yazdani, Y., Najafi, F., Sadeghizadeh, M., 2014. A novel diblock of copolymer of (monomethoxy poly [ethylene glycol]-oleate) with a small hydrophobic fraction to make stable micelles/polymersomes for curcumin delivery to cancer cells. International journal of nanomedicine 9, 5541. Esmatabadi, M.D., Sarkandi, M., Zadeh, H.M., Khaledi, G., Montazeri, M., Shekarabi, H.Z., Hormoz, Y.A., Asgari, E.A., 2015. Comparative evaluation of curcumin and curcumin loaded-dendrosome nanoparticle effects on the viability of SW480 colon carcinoma and Huh7 hepatoma cells. Research Journal of Pharmacognosy (RJP) 2, 9-16. Farhangi, B., Alizadeh, A.M., Khodayari, H., Khodayari, S., Dehghan, M.J., Khori, V., Heidarzadeh, A., Khaniki, M., Sadeghiezadeh, M., Najafi, F., 2015. Protective effects of DNC on an animal metastatic breast tumor. European journal of pharmacology 758, 188-196. Farnebo, M., Bykov, V.J., Wiman, K.G., 2010. The p53 tumor suppressor: a master regulator of diverse cellular processes and therapeutic target in cancer. Biochemical and biophysical research communications 396, 85-89. Goh, A.M., Coffill, C.R., Lane, D.P., 2011. The role of mutant p53 in human cancer. J Pathol 223, 116126. Gou, M., Men, K., Shi, H., Xiang, M., Zhang, J., Song, J., Long, J., Wan, Y., Luo, F., Zhao, X., 2011. Curcumin-loaded biodegradable polymeric micelles for colon cancer therapy in vitro and in vivo. Nanoscale 3, 1558-1567. Kazemi-Lomedasht, F., Rami, A., Zarghami, N., 2013. Comparison of inhibitory effect of curcumin nanoparticles and free curcumin in human telomerase reverse transcriptase gene expression in breast cancer. Adv Pharm Bull 3, 127-130. Lall, R.K., Syed, D.N., Adhami, V.M., Khan, M.I., Mukhtar, H., 2015. Dietary polyphenols in prevention and treatment of prostate cancer. Int J Mol Sci 16, 3350-3376.
Li, L., Braiteh, F.S., Kurzrock, R., 2005. Liposome-encapsulated curcumin: in vitro and in vivo effects on proliferation, apoptosis, signaling, and angiogenesis. Cancer 104, 1322-1331. Liu, T.-Y., Tan, Z.-J., Jiang, L., Gu, J.-F., Wu, X.-S., Cao, Y., Li, M.-L., Wu, K.-J., Liu, Y.-B., 2013. Curcumin induces apoptosis in gallbladder carcinoma cell line GBC-SD cells. Cancer Cell Int 13, 64. Milacic, V., Banerjee, S., Landis-Piwowar, K.R., Sarkar, F.H., Majumdar, A.P., Dou, Q.P., 2008. Curcumin inhibits the proteasome activity in human colon cancer cells in vitro and in vivo. Cancer Research 68, 7283-7292. Mohajeri, M., Sadeghizadeh, M., Najafi, F., Javan, M., 2015. Polymerized nano-curcumin attenuates neurological symptoms in EAE model of multiple sclerosis through down regulation of inflammatory and oxidative processes and enhancing neuroprotection and myelin repair. Neuropharmacology 99, 156-167. Mollazade, M., Nejati-Koshki, K., Akbarzadeh, A., Hanifehpour, Y., Zarghami, N., Joo, S., 2013. PAMAM dendrimers arugment inhibitory effect of curcumin on cancer cell proliferation: possible inhibition of telomerase. Asian Pac J Cancer Prev 14, 6925-6928. Moos, P.J., Edes, K., Mullally, J.E., Fitzpatrick, F.A., 2004. Curcumin impairs tumor suppressor p53 function in colon cancer cells. Carcinogenesis 25, 1611-1617. Nasiri, M., Zarghami, N., Koshki, K.N., Mollazadeh, M., Moghaddam, M.P., Yamchi, M.R., Esfahlan, R.J., Barkhordari, A., Alibakhshi, A., 2013. Curcumin and silibinin inhibit telomerase expression in T47D human breast cancer cells. Asian Pacific Journal of Cancer Prevention 14, 3449-3453. Rashmi, R., Kumar, T.S., Karunagaran, D., 2003. Human colon cancer cells differ in their sensitivity to curcumin-induced apoptosis and heat shock protects them by inhibiting the release of apoptosisinducing factor and caspases. FEBS letters 538, 19-24. Sa, G., Das, T., 2008. Anti cancer effects of curcumin: cycle of life and death. Cell Division 3, 14. Sadeghizadeh, M., Ranjbar, B., Damaghi, M., Khaki, L., Sarbolouki, M.N., Najafi, F., Parsaee, S., Ziaee, A.A., Massumi, M., Lubitz, W., 2008. Dendrosomes as novel gene porters‐III. Journal of Chemical Technology and Biotechnology 83, 912-920.
Sarbolouki, M.N., Alizadeh, A.M., Khaniki, M., Azizian, S., Mohaghgheghi, M.A., 2012. Protective effect of DNC combination on colon cancer in rat. Tehran University of Medical Sciences 69. Schefe, J.H., Lehmann, K.E., Buschmann, I.R., Unger, T., Funke-Kaiser, H., 2006. Quantitative realtime RT-PCR data analysis: current concepts and the novel “gene expression’s C T difference” formula. Journal of molecular medicine 84, 901-910. Singh, S., 2007. From exotic spice to modern drug? Cell 130, 765-768. Song, G., Mao, Y., Cai, Q., Yao, L., Ouyang, G., Bao, S., 2005. Curcumin induces human HT-29 colon adenocarcinoma cell apoptosis by activating p53 and regulating apoptosis-related protein expression. Brazilian journal of medical and biological research 38, 1791-1798. Tabatabaei Mirakabad, F.S., Akbarzadeh, A., Milani, M., Zarghami, N., Taheri-Anganeh, M., Zeighamian, V., Badrzadeh, F., Rahmati-Yamchi, M., 2015. A Comparison between the cytotoxic effects of pure curcumin and curcumin-loaded PLGA-PEG nanoparticles on the MCF-7 human breast cancer cell line. Artificial cells, nanomedicine, and biotechnology, 1-8. Tahmasebi Birgani, M., Erfani-Moghadam, V., Babaei, E., Najafi, F., Zamani, M., Shariati, M., Nazem, S., Farhangi, B., Motahari, P., Sadeghizaded, M., 2015. Dendrosomal nano-curcumin; The novel formulation to improve the anticancer properties of curcumin. Progress in Biological Sciences 5, 143158. Tahmasebi Mirgani, M., Isacchi, B., Sadeghizadeh, M., Marra, F., Bilia, A.R., Mowla, S.J., Najafi, F., Babaei, E., 2014a. DNC nanoformulation downregulates pluripotency genes via miR-145 activation in U87MG glioblastoma cells. International journal of nanomedicine 9, 403. Tahmasebi Mirgani, M., Isacchi, B., Sadeghizadeh, M., Marra, F., Bilia, A.R., Mowla, S.J., Najafi, F., Babaei, E., 2014b. DNC nanoformulation downregulates pluripotency genes via miR-145 activation in U87MG glioblastoma cells. Int J Nanomedicine 9, 403-417. Wahlstrom, B., Blennow, G., 1978. A study on the fate of curcumin in the rat. Acta pharmacologica et toxicologica 43, 86-92.
Wang, W.Z., Cheng, J., Luo, J., Zhuang, S.M., 2008. Abrogation of G2/M arrest sensitizes curcuminresistant hepatoma cells to apoptosis. FEBS Lett 582, 2689-2695. Wang, W.Z., Li, L., Liu, M.Y., Jin, X.B., Mao, J.W., Pu, Q.H., Meng, M.J., Chen, X.G., Zhu, J.Y., 2013. Curcumin induces FasL-related apoptosis through p38 activation in human hepatocellular carcinoma Huh7 cells. Life Sci 92, 352-358. Watson, J.L., Hill, R., Yaffe, P.B., Greenshields, A., Walsh, M., Lee, P.W., Giacomantonio, C.A., Hoskin, D.W., 2010. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells. Cancer letters 297, 1-8. Zamani, M., Sadeghizadeh, M., Behmanesh, M., Najafi, F., 2015a. DNC increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer. Phytomedicine 22, 961-967. Zamani, M., Sadeghizadeh, M., Behmanesh, M., Najafi, F., 2015b. DNC increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer. Phytomedicine 22, 961-967.
Figure Legends Fig. 1. Microscopic visualization of treated cells. (A, B) Light and UV microscopy images of dendrosome-treated cells. (C, D) Light and UV microscopy images of free curcumin-treated cells, respectively. (E, F) Light and UV microscopy images of DNC -treated cells, respectively. After 4 h of treatment with 18μM DNC. Magnification ×10. Fig. 2. The effect of DNC, free curcumin and the carrier on the survival tumor cells using MTT. The cells were treated with a range of concentrations of each reagent during the time. (A) Huh7 cells after 24, 48 and 72 h treatment. (B) HepG2 cells after 24, 48 and 72 h treatment. (C) The effect of DNC on HFSF-PI3 normal human fibroblast cells during 24, 48 and 72 h. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 3. Flow cytometry histograms of cell lines. (A) Flow cytometry histograms of Huh7 cell line after 12, 24, and 48 and 72 h treatment with 18µM DNC. (B) Flow cytometry histograms of HepG2 cell line after 12, 24, 48 and 72 h treatment with 18µM DNC. Fig. 4. Flow cytometry charts of cell lines after 12, 24, 48 and 72 h treatment with 18µM DNC. A) Huh7 cell lines. B) HepG2 cell lines. The percentage of cells in G1 phase and SubG1 area was decreased and increased, respectively. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 5. The induction of cell death using Annexin-V-FLOUS/PI staining after treatment with 18µM DNC in three periods of 24, 48, and 72 h. (A) Huh7 cell line, (B) HepG2 cell line. The stained cells (AnnexinV-/PI-), (AnnexinV +/PI-), (AnnexinV+/PI+) and (AnnexinV-/PI+) were characterized as healthy cells, the cells in the early phase of apoptosis, the cells in the delayed phase of apoptosis and necrosis cells, respectively.
Fig. 6. Early and late apoptosis analysis after treatment with 18µM DNC in three periods of 24, 48, and 72 h. (A) Huh7 cell line. (B) HepG2 cell line. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 7. The effect of DNC on the expression of genes involved in the apoptosis including p21، Noxa، Bcl-2, BAX and p53. Data are reported as Mean ± SD. *p<0.05، **: p<0.01* ،**: p<0.001 and ****: p<0.0001. Fig. 8. Western Blot analysis of HepG2/Huh7 cells in presence of DNC. Western Blot was performed and results were expressed relative to untreated cells. Beta-actin was used as housekeeping gene. p53 was detected using monoclonal p53 antibodies. Note that p53 expression increased in DNC -treated HepG2 and decreased in DNC -treated Huh7 during the time. DNC up-regulated BAX and p21 and down-regulated Bcl-2 in both cell lines.
Table 1: The physical and chemical stability of DNC Size (nm)
PDI
ζ-potential (mV)
EE (%)
142.97±4.27
0.4±0.03
-7.81±1.4
87.65±1.82
Abbreviations: EE, encapsulation efficiency; PDI, polydispersity index.
Table 2: primers used for specific genes and housekeeping gene Gene p53 p21 Noxa BAX
Primer
Size
Forward: TCCTCAGCATCTTATCCGAGTG Reverse: AGGACAGGCACAAACACGCACC Forward: CCTGTCACTGTCTTGTACCC Reverse: GTGGTAGAAATCTGTCATGCTG Forward: GAGCTGGAAGTCGAGTGTG Reverse: CTCTTTTGAAGGAGTCCCCTC
265
Forward: GTGGATGACTGAGTACCTGAAC Reverse: GCCAGGAGAAATCAAACAGAGG
119
121 148
Forward: GAGCAGATCATGAAGACAGGG 149 Reverse: ATGCGCTTGAGACACTCG GAPDH Forward: 5'CCCACTCCTCCACCTTTGAC3' 75 Reverse: 5'CATACCAGGAAATGAGCTTGACAA3' Abbreviations: F, forward primer; R, reverse primer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase Bcl-2
Table 3: Cell cycle distribution in Huh7/HepG2 cells after time dependent treatment of the cells with 18μM DNC using flow cytometry analysis Cell type Huh7
HepG2
T=0
T = 12
T = 24
T = 48
SubG1
3.7± 0.007
17.05 ± 0.003
37.83 ± 0.008
65.26 ± 0.001
79.11 ± 0.00
G1
46.95± 0.004
34.21 ± 0.00
31.50 ±0.16
6.34 ± 0.002
7.41 ±0.02
S
7.85± 0.01
6.28 ± 0.029
5.24 ±0.04
3.44 ± 0.01
1.07 ± 0.004
G2/M
29.92± 0.011
18.57 ± 0.017
12.08 ±0.02
18.07 ± 0.004
4.91 ± 0.012
SubG1
5.07 ± 0.003
14.37 ± 0.002
32.31 ± 0.03
35.80 ± 0.01
40.71 ± 0.018
G1
51.52± 0.008
37.77 ± 0.037
29.76 ± 0.03
27.35 ± 0.04
21.34 ± 0.07
S
12.69± 0.02
6.11 ± 0.021
5.11 ± 0.02
4.69 ± 0.01
3.53 ± 0.06
G2/M
21.90± 0.01
29.95 ± 0.060
16.64 ± 0.01
17.36 ± 0.02
15.12 ± 0.02
Note: Data expressed as mean ± standard deviation of three replicates Abbreviation: t, time.
T = 72
Table 4: Early and late apoptosis analysis after treatment with 18µM DNC Cell type Huh7
T=0
T = 48
T = 72
Early apoptosis (LR) 0.48± 0.002 20.26± 0.013 31.50±0.025 57.59±0.038 Late apoptosis (UR)
HepG2
T = 24
1.41± 0.001
2.08 ±0.00
3.40±0.00
1.42±0.004
Early apoptosis (LR) 2.78± 0.011 31.34 ±0.007 14.61±0.001 28.59±0.006 Late apoptosis (UR)
0.83 ±0.002
4.02 ±0.016
Note: Data expressed as mean ± standard deviation. Abbreviation: t, time.
18.26±0.01
16.5±0.012
S0378-5173(16)30419-7 http://dx.doi.org/doi:10.1016/j.ijpharm.2016.05.039 IJP 15778
To appear in:
International Journal of Pharmaceutics
Received date: Revised date: Accepted date:
20-2-2016 16-5-2016 21-5-2016
Please cite this article as: Montazeri, Maryam, Sadeghizadeh, Majid, PilehvarSoltanahmadi, Yones, Zarghami, Faraz, Khodi, Samaneh, Mohaghegh, Mina, Zarghami, Nosratollah, Dendrosomal Curcumin Nanoformulation Modulate Apoptosis-Related Genes and Protein Expression in Hepatocarcinoma Cell Lines.International Journal of Pharmaceutics http://dx.doi.org/10.1016/j.ijpharm.2016.05.039 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Dendrosomal Curcumin Nanoformulation Modulate Apoptosis-Related Genes and Protein Expression in Hepatocarcinoma Cell Lines
Maryam Montazeri1,2, Majid Sadeghizadeh3*, Yones Pilehvar-Soltanahmadi2,1, Faraz Zarghami4, Samaneh Khodi5, Mina Mohaghegh6, Nosratollah Zarghami2,1*
1
Department of Medical Biotechnology, Faculty of Advanced Medical Sciences, Tabriz
University of Medical Sciences, Tabriz, Iran 2
Hematology and Oncology Research Center, Tabriz University of Medical Sciences, Tabriz,
Iran 3
Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran,
Iran 4
Imam Reza Teaching Hospital, Tabriz University of Medical Sciences, Tabriz, Iran
5
Department of Medical Genetic, National Institute of Genetic Engineering and
Biotechnology, Tehran, Iran 6
Department of Molecular Biology and Biotechnology, University of Aix-Marseille,
Marseille, France
*Corresponding authors: Prof. Nosratollah Zarghami, Hematology and Oncology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran. E-mail: [email protected], Telefax: +98-4133364666
Dr. Majid Sadeghizadeh, Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran, Iran. Email: [email protected], Tel: +98912 214 84 75
Abstract The side-effects observed in conventional therapies have made them unpromising in curing Hepatocellular carcinoma; therefore, developing novel treatments can be an overwhelming significance. One of such novel agents is curcumin which can induce apoptosis in various cancerous cells, however, its poor solubility is restricted its application. To overcome this issue, this paper employed dendrosomal curcumin (DNC) was employed to in prevent hepatocarcinoma in both RNA and protein levels. Hepatocarcinoma cells, p53 wildtype HepG2 and p53 mutant Huh7, were treated with DNC and investigated for toxicity study using MTT assay. Cell cycle distribution and apoptosis were analyzed using Flow-cytometry and Annexin-V-FLUOS/PI staining. Real-time PCR and Western blot were employed to analyze p53, BAX, Bcl-2, p21 and Noxa in DNC-treated cells. DNC inhibited the growth in the form of time-dependent manner, while the carrier alone was not toxic to the cell. Flowcytometry data showed the constant concentration of 20µM DNC during the time significantly increases cell population in SubG1 phase. Annexin-V-PI test showed curcumininduced apoptosis was enhanced in Huh7 as well as HepG2, compared to untreated cells. Followed by treatment, mRNA expression of p21, BAX, and Noxa increased, while the expression of Bcl-2 decreased, and unlike HepG2, Huh7 showed down-regulation of p53. In summary, DNC-treated hepatocellular carcinoma cells undergo apoptosis by changing the expression of genes involved in the apoptosis and proliferation processes. These findings suggest that DNC, as a plant-originated therapeutic agent, could be applied in cancer treatment. Key words: dendrosomal curcumin, p53 mutant, apoptosis, Hepatocarcinoma, Real-Time PCR
1. Introduction Hepatocellular carcinoma (HCC), which is ranked as the fifth lethal cancer in men and the eighth one in women, is the third leading cause of cancer-related deaths worldwide estimated about 700,000 deaths per year. Since p53 gene is mutated in approximately about 50% of human cancers, and does not accumulate in normal unstressed cells, indicating its essential role in both clinical marker and therapeutic target, therefore it is important to detect its modification in therapeutic responses (Farnebo et al., 2010). 74% of p53 mutations are missense mutations occurring in DNA-binding domains. The ninth most common mutation in hepatocarcinoma cells is Y220C, occurred in exon 6 (Tyr-Cys). Y220C mutant exists in Huh7cell line, in which mutant p53 protein is overexpressed with a prolonged half-life leading to its accumulation in the nuclei (Boeckler et al., 2008). Conventional therapeutic methods, including surgery and liver transplant, have several limiting difficulties. For instance, the scarcity of donor organs makes the liver transplantation applicable in a small number of HCC patients (Darvesh et al., 2012). Therefore, regarding the alarming increase in HCC, new alternative treatment approaches are needed. Curcumin (diferuloyl methane), as a major active ingredient of turmeric, is derived from the dried roots of the plant Curcuma Longa and is used as a spice and a traditional medicine for many centuries in India and other Asian countries (Kazemi-Lomedasht et al., 2013). It has chemo-preventive and therapeutic features including anti-proliferative, anti-mutagenic and anti-carcinogenic properties (Esmatabadi et al., 2015; Nasiri et al., 2013). It induces the release of apoptosis inducing factor from mitochondria and eliminates the cancer cells (Rashmi et al., 2003). Although, the underlying mechanisms are not well-known, many molecular targets have been suggested including various transcription factors, inflammatory enzymes, cytokines, adhesion molecules and cell survival proteins (Badrzadeh et al., 2014; Milacic et al., 2008). Curcumin has shown a reduced solubility and poor uptake in both in vitro and in vivo studies, however
its application in medicine and more specifically drug delivery is spreading rapidly (Mollazade et al., 2013). A promising method to improve the solubility of curcumin is the application of polymeric nanoparticles, such as dendrosomes which were first applied as gene reporter (Sadeghizadeh et al., 2008). Dendrosomes are inexpensive, non-toxin, neutral, biodegradable, covalent or self- assembled, hyper branched, and spheroidal polymeric nanoparticles nano-carriers derived from oleic acid which were synthesized by our group for the first time. Previous studies by our group introduced a dendrosome specified Den O400, a nonionic biodegradable denderic glycol ester, to improve the solubility of curcumin, with maximum stability in the optimal ratio of 1:25 (curcumin /dendrosome), and to escalate its anti-tumor (Babaei et al., 2012; Tahmasebi Birgani et al., 2015). The physical and chemical stability of DNC was studied by Mirgani et al. Transmission electron micrographs has shown DNC as a sphere shaped nanostructure and DLS analysis has determined DNC with mean diameter of 200 nm, polydispersity index (PDI) of 0.4, meaning that its colloidal suspension is polydispersed, ζ-potential of around −7 mV, and very high loading efficiency of 87%. The content of curcumin into the dendrosome was also quantified by HPLC-DAD analysis which was at constant level after preparation (Table 1) (Tahmasebi Mirgani et al., 2014b). However, the toxicity of curcumin is more in cancer cells compared to normal cells, the apoptotic effects in high concentration of curcumin is reported in some normal cell types such as hepatocytes and human normal fibroblasts (Bisht et al., 2007; Singh, 2007). Here, HepG2, harboring wild-type p53, and Huh7, harboring p53 mutant, hepatoma cell lines were used to study the effect of DNC on cancer cells to investigate whether DNC reduces the expression of p53 mutant and leads cancer cells into cell death and if treated cancer cells make changes in the gene expression involved in apoptosis and cell cycle.
2. Materials and Methods 2.1 Cell lines, cell culture and Reagents The human cancer cell linesHepG2/Huh7 (derived from hepatocellular carcinoma) and HFSF-PI3 (normal human fibroblast) were obtained from the Iranian national cell bank (Pasteur institute of Iran, Tehran). The Huh7cell line was cultured in DMEM (low glucose) and HepG2 cell was cultured in DMEM (High glucose) culture medium (pH=7.2), supplemented with 100u/ml penicillin, 100μg/ml streptomycin, and 10% fetal bovine serum (FBS, GIBCO, USA), and incubated at 37ºC in a humidified atmosphere of 5% CO2. The culture medium was changed every other day. Curcumin was obtained from Merck (Indianapolis, IN, USA). 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Cell culture products were obtained from Gibco (UK), Annexin V FLOUS kit and Propidium iodide (PI) were purchased from Roche (Roche Applied Science, Penzberg, Germany).
2.2 OA400 carrier and DNC preparation Dendrosomes are PEGylated micelles derived from oleic acids, which was prepared by an optimized protocol in our Lab (Babaei et al., 2012). Briefly, OA400 was synthetized by esterification of oleoyl chloride (0.01 mol), polyethylene glycol 400 (0.01 mol) in presence of triethylamine (0.012 mol) and chloroform as solvent at 25°C for 4 hours, followed by filtration to remove triethylamine hydrochloride salt and evaporation in vacuum oven at 40°C for 4 hours to remove the chloroform (Tahmasebi Mirgani et al., 2014a). Curcumin was dissolved in various amounts of prepared polymeric carriers in weight/weight ratios of dendrosome/curcumin ranging from 1:10 to 1:50 and checked for absorbance spectra by ultraviolet spectrophotometry (Infinite® 200 PRO, Tecan, Mannedorf, Switzerland). The
mixture was incubated at 37 oC for an overnight in order to dissolve the curcumin completely in the polymeric carrier. Then, the appropriate mixture of dendrosome and curcumin was evaluated at wavelength of 420 nm, in comparison with free curcumin dissolved in PBS and 1% methanol as control samples and 1:25 was chosen as appropriate proportion 1:25 was chosen as appropriate proportion and very stable for weeks at room temperature without precipitation of curcumin. The loading of dendrosome nanocarriers with curcumin molecules was performed using Gou et al’s protocol (Gou et al., 2011). In summary, curcumin and dendrosome were co-dissolved in 5 mL acetone; this solution was added into 5 mL PBS while stirring constantly. Then, the acetone was evaporated in a rotary evaporator. The curcumin/dendrosome micelle solution was sterilized using a 0.22 μm syringe filter (EMD Millipore). Prepared DNC was kept away from light in 4°C for further procedures. Due to the innate fluorescence of curcumin, the cells were treated with 10 µM DNC and studied after 4h by fluorescence microscopy. Non-treated samples were used as a reference value; autofluorescence of the cells was set as “Zero” value.
2.3 Uptake of DNC versus void curcumin To study the uptake of DNC by different cell lines, the 80 x 103 cells per mL fresh cells were transferred into 12-well plate and treated with 18μM DNC as well as void curcumin for 0 to 7 h. To evaluate whether DNC is attached to the cell membrane or absorbed into cells, its cellular localization was evaluated by fluorescence microscopy after treating with DNC and void curcumin in various incubation times. Each experiment was repeated at least three times.
2.4 Cell proliferation assays MTT viability assay was used to assess cell proliferation as follows: Adherent cells were released from their substrate by trypsinization, centrifuged and resuspend at 1 x 10 6 per mL
followed by preparing serial dilutions of cells in culture medium from 1 x 106 to 1 x 103 cells per mL. 200 μL of the dilutions were plated into 96-well plate, in triplicate, including three control wells of medium alone to provide the blanks for absorbance readings. The cells were incubated at 37ºC in a humidified atmosphere of 5% CO2 for 24 h. In the following, 18µM of DNC was added to each well, except untreated sample, and the plates were return to cell culture incubator for 24, 48 and 72 h. Then, 5 mg/ml of MTT Reagent was added to each well, then the wells were emptied and 200 μL of DMSO was added and after 15 min the cell density was measured at 490 nm in a microtiter plate reader. The average values from triplicate readings were determined and subtracted the average value for the blank. The percentage of proliferation was determined for each concentration of the indicated DNC according to the manufacturer’s instruction (Sigma-Aldrich, USA). The percentage of cell viability of treated cells against control cells and the concentration at which cell growth was inhibited by 50% (inhibitory concentration: IC50) was determined by standard curve method (Zamani et al., 2015a)
2.5 Cell cycle analysis The effect of DNC on the distribution of cells in cell cycle was performed by flow cytometry analysis using Propidium Iodide (PI) staining. The cells were seeded in 12-well plate (3 × 105 cells/ml) and treated with 18μM DNC for 12, 24, 48 and 72 h. The cells were then harvested and washed twice with cold PBS, fixed in ice-cold 75% ethanol for 15 min at 4 °C. The cells were washed twice with cold PBS and resuspended in PBS containing 50 μg/mL PI, 0.1% sodium citrate, and 0.1 Triton X-100 followed by shaking at 37 °C for 15 minutes. Analyses were done on a FACS flow cytometer (FACS Calibur Becton Dickinson, USA) and the data were consequently evaluated using Cell Quest software (BD Biosciences).
2.6 Detection of Apoptosis with Annexin-V-FLOUS staining In order to measure the percentage of apoptotic cells, Annexin-V-FLOUS kit was used to detect the exposed phosphatidylserine in the cell membrane. The cell lines were centrifuged and resuspended in 200μl of Binding Buffer. After 5 minute, Annexin-V-FLOUS (1μl) and PI (1μl) were added to tubes and incubated at room temperature (5 minutes) in the dark and then analyzed by FACSCalibur flow cytometer. Annexin-V-FLUOS positive and PI negative cells were quantified and the apoptosis percentage from the untreated cells was subtracted for each analysis.
2.7 mRNA Profiling of p53, p21, Noxa, BAX and Bcl-2 To measure mRNA expression of the p53 gene, total RNA was extracted from cultured cell using TRIzol® reagent (Invitrogen). DNase I (Fermentase, Lithuania) was used to remove DNA contamination. The purity and integrity of RNA (260/280 nm ratio) was studied by Spectrophotometer (Nano Drop ND-1000) and gel electrophoresis on 1% agarose gel. Prime Script™ RT reagent (Takara Bio) kit was used for cDNA synthesis, according to the manufacturer's instructions, containing 25 pmol oligo dT primer, 50 pmol random 6 mers and 500 ng of total RNA.
2.8 Real Time PCR Real Time PCR was done in presence of 2 µl SYBER green master mix (Takara Bio), 200ng of the generated cDNA, and 250 nM of appropriate primers. The thermocycler condition was as follows: 95°C for 15 min for initial activation, followed by 40 cycles at 95°C for 5 seconds, annealing temperatures 63°C for 23 seconds, 72°C for 34 sec, and a final extension at 72°C for 10 minutes. Real Time PCR was carried out in triplicate. The cycling program was set on ABI 7500 device. PCR products were visualized by electrophoresis on a 1.5% to
check the size of PCR products. PCR efficiency was studied using linear regression analysis to the exponential phase of the amplification curve for each PCR reaction using a program such as LinReg PCR (Schefe et al., 2006). The list of primers for specific genes and housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are indicated in Table 2. Comparative threshold cycle (Ct) method was employed to study the relative quantification of related genes. The Ct value of the gene was normalized for each sample using the formula: ΔCt = Ct (genes) - Ct (GAPDH). Formula of ΔΔCt = ΔCt (treated) - ΔCt (untreated) was used to determine relative expression levels. The value was used to plot the expression of genes using the formula 2−ΔΔCt (Liu et al., 2013).
2.9 Western blot analysis To extract total proteins, the cells were lysed using Radioimmunoprecipitation assay buffer (RIPA buffer) (2.5M NaCl, 1M Tris-HCL pH 7.6, 10% SDS pH 8.0, 0.1M NaVO4, 0.5M EDTA and 10 μl/mL NP-40), then, protein concentration was quantified by Bradford assay with BSA as a standard. Beta-actin was employed as housekeeping gene. An equal amount of protein was separated (80 μg protein per lane) by SDS-PAGE gel electrophoresis and transferred to a membrane. The membrane was blocked with 5% non-fat milk for 1.5 h at 37°C. In the following, fresh blocking buffer supplemented with 1:1000 primary mAb of p53, p21, BAX, Bcl-2 and Beta-actin (Abcam, USA) was replaced for an overnight at 4◦C. Then, the membrane was washed three times with TBST for 10 min and incubated for 1h and 15 min at 37 ◦C in blocking buffer with 1:5000 dilutions of HRP goat anti-mouse IgG secondary Abs. Then, the membrane was washed three times with TBST for 10 min. Detection was performed using ECL kit (RPN2235, Amersham, UK) according to the manufacturer’s instruction.
2.10 Statistical analysis All experiments were performed three times. Data obtained from cell proliferation assays and other experiments were analyzed using the ANOVA and the statistical significance level was set at p ≤ 0.05. All Statistical analysis was performed using Graph Pad Prism software (Inc., La Jolla, CA, USA).
3. Results 3.1 The effect of DNC on HepG2/Huh7 cancer cells Here, the cancerous cell lines treated with void dendrosome, free curcumin and DNC were visualized by light and UV microscopy. As shown, due to the innate fluorescent characteristic of curcumin, the free-curcumin can be seen mostly as crystals in intercellular spaces, while, the DNC -treated cells show curcumin mostly as intracellular dispersed plots, which indicates that dendrosomal nanocarrier significantly improves the internalization of curcumin inside the cells (Fig. 1). DNC inhibits the hepatocellular carcinoma cells in the form of time-dependent, while the carrier alone is not toxic to the cell (Fig. 2). At an effective dose for anticancer activity (below 25 μM) and even at 50 μM, curcumin and free nanocarrier were not significantly toxic to normal human fibroblastic cells (HFSF-PI3). It suggests that the mortality observed in the cells is induced by curcumin and the carrier only increases the solubility of curcumin and facilitates the delivery to cells. IC50 in three different periods of 24, 48, and 72 for Huh7 cells treated with DNC was obtained 23, 18, and 14 µM (p<0.0091) and for and HepG2 was 25, 22, 17 µM respectively (p<0.0041). Based on figure 2, IC50 in different periods of time for Huh7 cells treated with free curcumin was observed after 48h and 72h which were about 48 (p<0.003) and 40 (p<0.0051), respectively. IC50 in HepG2 cells treated with free curcumin after 24h, 48h and 72h were about 50 (p<0049), 48 (p<0.0064) and 35 (p<0.0043),
respectively. Based on the data obtained, the concentration of 18μM was considered as a choice for concentration.
3.2 The effects of DNC on HepG2/Huh7 cell cycle distribution Flow cytometry was applied to analyze the mechanism of the growth inhibitory effects of DNC. The cell population increase after treatment during the time (12, 24, 48, and 72 h) led to the appearance of the SubG1 peak compared to untreated cells (Fig. 3). The results showed that DNC has induced tumor cell death in the hepatocarcinoma cells in the form of timedependent. It was also shown that in the concentration close to IC50 (18µM), by increasing the time, Huh7 cell population increases in SubG1 area up to 17.05% ± 0.003%, 37.8% ± 0.008%, 65.26% ± 0.001% and 79.11% ± 0.00% after 12, 24, 48, and 72 h which is obviously more than untreated cells (3.7% ± 0.007%). DNC -treated HepG2 cell population increased in SubG1 area up to 14.37% ± 0.002%, 32.31% ± 0.03%, 35.80% ± 0.01%, and 40.71% ± 0.018% after 12, 24, 48, and 72 h which is more than untreated cells (5.07% ± 0.003%). DNC -treated Huh7 showed a more remarkable reduction in cell population in S, G1 and G2/M phases during the time (Fig. 4) (Table 3).
3.3 DNC triggers apoptosis in HepG2/Huh7 cells Annexin-V-PI test and the treatment with 18µM DNC in time-dependent manner were applied to study the apoptosis induced in the cells (apoptosis or necrosis). In this experiment, the exposure of the cells to the right of histogram shows that the cell death is triggered by apoptosis, in which the results were significant compared to untreated cells (p<0.0001) (Fig. 5). Increasing the time from 24 h to 72 h obviously induced apoptosis in both DNC -treated cells, which was significant compared to the untreated cells. For DNC -treated Huh7, the percentage of total apoptosis (referring to the sum of early and late apoptosis) was 22.34% ±
0.0065%, 34.9% ± 0.0125%, and 59.01% ± 0.021% after 24, 48 and 72 h, respectively. For DNC-treated HepG2 the percentage of apoptosis was 35.36% ± 0.011%, 20.68% ± 0.005%, and 45.09% ± 0.009% after 24, 48 and 72 h, respectively. An increased in late apoptosis was only observed in DNC -treated HepG2 cells after 48 and 72h (Table 4) (Fig. 6).
3.4 Expression of p53, p21, BAX, Bcl-2, and Noxa genes in DNC - treated cells The analysis showed that followed by the treatment with 18μM DNC, mRNA expression of the pro-apoptosis genes of BAX, Noxa and p21 significantly increased during a period of 24, 48 and 72 h, while the expression of anti-apoptosis Bcl-2 decreases. p53-mutant Huh7 showed a significant down-regulated expression during the treatment, whereas, p53-wild-type HepG2 showed an up-regulated expression. No changes were observed in the expression pattern of DNC -treated HFSF-PI3 cells (Fig. 7). Statistically calculated values for BAX، Bcl-2، p21، Noxa and p53 genes were obtained. The results of the melting curve analysis indicated the lack of non-specific product (data not shown). Western blot indicated that in presence of DNC the levels of p53 and Bcl-2 reduces in Huh7, while the levels of BAX and p21 increases, whereas, the increased levels of p53 along with BAX and p21, and reduced level of Bcl-2 were observed in HepG2, which are the characteristic features of apoptosis (Fig 8).
5. Discussion Hepatocellular carcinoma (HCC) is the third leading cause of death from cancer which its therapy by conventional methods involves limiting difficulties, thereby; new therapeutic strategies are needed (Wang et al., 2013). Dietary polyphenols have demonstrated significant effect as both preventive and therapeutic agents in various cancerous cells such as breast, liver, lung, prostate and skin (Lall et al., 2015). Curcumin, as one of the considerable
hydrophobic molecules, is a pleiotropic drug which can identify various targets and selectively penetrate through the cancerous cell membrane, compared to normal types, and initiates tumor growth prevention and apoptosis induction (Chaudhary and Hruska, 2003; Tabatabaei Mirakabad et al., 2015). The application of curcumin is limited due to its low solubility, poor absorption and rapid metabolism, which was overcome in our previous study in combination with a synthetized Dendrosomal carrier with a great potential for the solubility of curcumin and increasing its uptake in the tumor cells and cytotoxicity. The developed DNC was a curcumin-loaded mPEG-OA polymerases with a very stable structure for a long time after formulation (Erfani-Moghadam et al., 2014). Our group also confirmed the inhibitory role of DNC in cancer cell metastasis (Dehghan Esmatabadi et al., 2015; Farhangi et al., 2015), and in the methylation of tumor suppressor genes (Zamani et al., 2015b). The therapeutic effect of DNC was also reported by our group in an animal model of Multiple Sclerosis disease with decreasing inflammation and improving myelin repair mechanisms (Mohajeri et al., 2015). The protective effects of DNC were also studied in vivo tumor growth models on mammary tumor bearing mice, in which demonstrated a significant DNC -mediated reduction in the incidence, the size and the weight of tumors (Alizadeh et al., 2015; Farhangi et al., 2015), and on rat colon cancer that showed “dendrosome can be used as a suitable nanoparticle to increase curcumin efficiency in the prevention or treatment of colon cancer” (Sarbolouki et al., 2012). According to previous findings on the potential of DNC, in this research, we were aimed to utilize it as an agent on the hepatocarcinoma cancer cells to study its effect on tumor cell death. Since, the high level of p53 missense mutation is observed in human malignancies cell lines which not only makes the protein lose its tumor suppressor function but also acquire new oncogenic gain-of-function, thus p53 mutant protein accumulates in tumors and affects
pathology (Goh et al., 2011). Therefore, here we employed Huh7, as p53 mutant cell line, compared to HepG2 as p53 wild-type. Huh7 contains Y220C mutant by which a surface crevice is created and the protein consequently become highly destabilized (Boeckler et al., 2008). To gain an insight into the effect of nanocarrier in curcumin penetration, Huh7/HepG2 cells were treated with DNC, free curcumin and nanocarrier in concentration close to IC50 (18μM). Studies by fluorescent microscopy showed that free curcumin mostly aggregates in intercellular space as crystal bodies with different sizes, while DNC can easily penetrate inside the cells, indicating that the solubility, uptake and cytotoxicity of curcumin are enhanced significantly using dendrosomal nanocarrier. The results of MTT in the presence of DNC, free curcumin, and nanocarrier indicated that DNC affects as a tumor preventive in a time-dependent manner, suggesting that DNC prevents tumor growth and reduces the viability of Huh7/HepG2 cells, whereas, free curcumin and nanocarrier alone showed no remarkable toxicity in the same concentration as DNC. Mortality induced by DNC was not detected in normal fibroblasts cell lines. The differences between the cell viability in presence of DNC, free curcumin, nanocarrier and the untreated cells were significant (p<0.05), therefore, only DNC was investigated in the further experiments. MTT assay was already done on U87 human glioblastoma cell line (U87MG) which showed higher toxicity of curcumin and DNC after 24h and 48h treatment, it suggests that the toxicity triggered by DNC depends on the cell type (Erfani-Moghadam et al., 2014). In fact, the MTT results showed that the DNC increases tumor cell access to curcumin and triggers tumor cell death. A concentration close to average IC50 of each cell at different incubation time (18µM) was chosen for further experiments. Studies in the past three decades in the field of absorption, distribution, metabolism and excretion of curcumin have indicated its poor absorption, fast metabolism, and extremely poor solubility in water, which have restricted its potential
anticancer application (Li et al., 2005; Wahlstrom and Blennow, 1978). Here, microscopic observations showed sedimentary crystals of the free curcumin in intercellular space, which illustrates its insolubility, moreover, based on MTT results no considerable mortality in the cancerous cell lines as well as DNC in the same suppressive concentration was observed, therefore; only DNC was investigated in the further experiments. We used PI stained DNA to quantify cell cycle by flow cytometry, and our data suggests a significant increase in DNC -treated Huh7/HepG2 cells in SubG1 area during the time, which was along with a significant reduction in cell population in S, G1 and G2/M phases. Considering that Huh7 approximately showed two-fold increase in SubG1 area compared to HepG2. Although the behavior of curcumin against the cell cycle is different depending on the cell type, they all increase hypo diploid cells (SubG1) (Chakraborty et al., 2006; ErfaniMoghadam et al., 2014). Wang et al also reported the attenuation of cell growth by curcumin in Huh7 and HepG2 cells in the G2/M phase (Wang et al., 2008). In our study, Annexin-V- FLUOS and PI staining were used to study the apoptosis process. The curcumin-induced apoptosis has been studied in many papers, and its role to modulate various apoptosis pathways has been described (Chakraborty et al., 2006; Erfani-Moghadam et al., 2014). In the present study, Huh7/HepG2 cells were exposed to 18μM concentrations of DNC for 24, 48 and 72 h. Our results showed significant effect of DNC on apoptosis induction in a time-dependent manner with no necrosis observed following the treatment, which is in accordance with those of our previous dendrosome research (Tahmasebi Mirgani et al., 2014a). As the time increased, the mean percentage of apoptosis in Huh7 increased, so that reached up to 59.01% ± 0.021 within 72 h, which is more compared to HepG2 cells (45.09% ±0.009), therefore it seems that DNC induces cell death more considerable in p53 mutant Huh7 after 72 h compared to p53 wild-type. DNC -treated HepG2 also showed a different
behavior in apoptosis by the time during the treatment, so that it shows late apoptosis in 48 and 72h compared to 24h. Conclusively, it was found that DNC induces cell death in Huh7/HepG2 which is compatible with activation of the apoptotic pathways in a timedependent manner. Our group previously studied the effect of DNC and free curcumin, and confirmed that DNC do not induce apoptosis in normal fibroblast cell lines (Babaei et al., 2012). Our data is consistent with the previous researches on apoptotic role of curcumin in different cancer cell lines (Liu et al., 2013; Moos et al., 2004; Song et al., 2005), accordingly, DNC could significantly trigger apoptosis in p53 wild-type as well as p53 mutant. Careful study of cell distribution and apoptosis in hepatocarcinoma cell lines revealed that the Huh7 cells, expressing a high level of p53 mutant, was more sensitive to DNC toxicity. On the other hand, HepG2 cells, expressing wild-type p53 also showed sensitivity, but in lower apoptotic percentage. Although our data is in contrary to the findings indicating the cells with a high level of wild-type p53 are more sensitive to curcumin toxicity (Sa and Das, 2008), our results may be due to the fact that HepG2 expresses moderate levels of p53. Conclusively, our results provide support for a potential therapeutic role of DNC in the prevention of hepatocarcinoma via its apoptosis-inducing and anti-proliferative properties even in cancerous cells with a high level of mutant p53. As motioned in many studies, the mechanism of action of curcumin is mediated by regulating down-stream proteins of p53, such as p21 which mainly function in cell growth and the other proteins such as BAX, Bcl-2, and Noxa which are involved in apoptosis (Liu et al., 2013). In our paper the expression pattern rendered by DNC was studied in mRNA level using Realtime PCR and emphasized that DNC is able to up-regulate the pro-apoptotic proteins of BAX and Noxa, and down-regulate anti-apoptotic protein of Bcl-2. Song and colleagues also demonstrated that curcumin in a time dependent manner significantly increases BAX protein expression, as well as reducing the expression of Bcl-2 (Chaudhary and Hruska, 2003).
According to the generally known, overexpression of BAX promotes cell death; unlike, Bcl-2 functions as a suppressor of apoptosis, our finding is indicative of the Bcl-2 family role in apoptosis induction mediated by DNC in hepatocarcinoma cell lines. The role of p53 in apoptotic property of curcumin is controversial, since some studies demonstrate the curcumin induces apoptosis through p53-dependent induction, whereas some others indicate p53-independent pathways (Watson et al., 2010). Our data illustrated that p53 protein level is up-regulated in HepG2, whereas is down-regulated in Huh7 after DNC treatment, both in mRNA and protein levels. The same results have been found in a study on p53-mutant breast cancer cell line (Bae et al., 2014). Functional activation of p53 wild-type was observed by the increased expression of p21, BAX and Noxa in DNC -treated HepG2, while DNC could lead to the same results with down-regulated mutant p53 in Huh7 cell lines. Accordingly, DNC -induced apoptosis may also be through p53-independent pathways. Our group formerly reported DNC -induced apoptosis in A431 and U87MG cell lines using PARP and caspase-3 proteins, respectively (Babaei et al., 2012; Tahmasebi Mirgani et al., 2014a), and here with the study of BAX and Bcl-2 proteins, we conclude that DNC may trigger apoptosis in p53 mutant cell lines by mediating various target molecules involved in apoptosis pathway. Western blot analysis was performed for final approval of the results of real-time PCR and flow cytometry (cell cycle and apoptosis). The results of western blotting indicated that the expression of Bcl-2 reduces and the expression of BAX, p21 increases in DNC -treated Huh7/HepG2 cell lines, and the p53 is up-regulated and down-regulated in HepG2 and Huh7 cell lines, respectively, which were in line with the data obtained from real-time PCR and flow cytometry tests.
6. Conclusions In conclusion, due to the accumulation and oncogenic activity of mutant p53 in human cancers, it is important to focus on the potential impact of p53 mutation on therapeutic responses. Here we studied the effect of DNC as a safe formulation with plant origin to inhibit the proliferation of Huh7/HepG2 hepatocellular carcinoma cells, as tumor models. As shown, DNC induces apoptosis in form of time-dependent by modulating the Bcl-2, BAX and Noxa. Moreover, due to p53 independent cytotoxic effect of DNC on hepatoma cancer cells, DNC could be a promising therapeutic method in cancerous cell lines, even p53 mutant cancers. According to the significance of data obtained in the study, the investigation of DNC in animal models will be in progress.
Acknowledgments This work was supported by grant from the department of Medical Biotechnology, Faculty of Advance Medical Sciences, Tabriz University of medical science (Project Number: 91/4-3/2). The authors gratefully acknowledge these research departments for their sincere support offered during the project. The authors are so thankful to their colleague at Tarbiat Modares University, for her kind help in performing experiments. The authors are thankful to their coworkers in the Cell and Molecular Laboratory of Iran University for their support in performing flow cytometry and western blot analysis. The current work is dedicated to the late Professor Mohammad Nabi Sarbolouki who was a pioneer of dendrosome-based delivery of curcumin.
Conflict of Interest: The authors disclose no conflicts.
References Alizadeh, A.M., Sadeghizadeh, M., Najafi, F., Ardestani, S.K., Erfani-Moghadam, V., Khaniki, M., Rezaei, A., Zamani, M., Khodayari, S., Khodayari, H., Mohagheghi, M.A., 2015. Encapsulation of
curcumin in diblock copolymer micelles for cancer therapy. BioMed research international 2015, 824746. Babaei, E., Sadeghizadeh, M., Hassan, Z.M., Feizi, M.A.H., Najafi, F., Hashemi, S.M., 2012. DNC significantly
suppresses
cancer
cell
proliferation
in
vitro
and
in
vivo.
International
immunopharmacology 12, 226-234. Badrzadeh, F., Akbarzadeh, A., Zarghami, N., Yamchi, M.R., Zeighamian, V., Tabatabae, F.S., Taheri, M., Kafil, H.S., 2014. Comparison between effects of free curcumin and curcumin loaded NIPAAmMAA nanoparticles on telomerase and PinX1 gene expression in lung cancer cells. Asian Pac J Cancer Prev 15, 8931-8936. Bae, Y.-H., Shin, J.-M., Park, H.-J., Jang, H.-O., Bae, M.-K., Bae, S.-K., 2014. Gain-of-function mutant p53-R280K mediates survival of breast cancer cells. Genes & genomics 36, 171-178. Bisht, S., Feldmann, G., Soni, S., Ravi, R., Karikar, C., Maitra, A., Maitra, A., 2007. Polymeric nanoparticle-encapsulated curcumin (“nanocurcumin”): a novel strategy for human cancer therapy. J Nanobiotechnology 5, 1-18. Boeckler, F.M., Joerger, A.C., Jaggi, G., Rutherford, T.J., Veprintsev, D.B., Fersht, A.R., 2008. Targeted rescue of a destabilized mutant of p53 by an in silico screened drug. Proc Natl Acad Sci U S A 105, 10360-10365. Chakraborty, S., Ghosh, U., Bhattacharyya, N., Bhattacharya, R., Roy, M., 2006. Inhibition of telomerase activity and induction of apoptosis by curcumin in K-562 cells. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 596, 81-90. Chaudhary, L.R., Hruska, K.A., 2003. Inhibition of cell survival signal protein kinase B/Akt by curcumin in human prostate cancer cells. Journal of cellular biochemistry 89, 1-5. Darvesh, A.S., Aggarwal, B.B., Bishayee, A., 2012. Curcumin and liver cancer: a review. Curr Pharm Biotechnol 13, 218-228. Dehghan Esmatabadi, M.J., Farhangi, B., Safari, Z., Kazerooni, H., Shirzad, H., Zolghadr, F., Sadeghizadeh, M., 2015. DNC inhibits metastatic potential of human SW480 colon cancer cells
through Down-regulation of Claudin1, Zeb1 and Hef1-1 gene expression. Asian Pac J Cancer Prev 16, 2473-2481. Erfani-Moghadam, V., Nomani, A., Zamani, M., Yazdani, Y., Najafi, F., Sadeghizadeh, M., 2014. A novel diblock of copolymer of (monomethoxy poly [ethylene glycol]-oleate) with a small hydrophobic fraction to make stable micelles/polymersomes for curcumin delivery to cancer cells. International journal of nanomedicine 9, 5541. Esmatabadi, M.D., Sarkandi, M., Zadeh, H.M., Khaledi, G., Montazeri, M., Shekarabi, H.Z., Hormoz, Y.A., Asgari, E.A., 2015. Comparative evaluation of curcumin and curcumin loaded-dendrosome nanoparticle effects on the viability of SW480 colon carcinoma and Huh7 hepatoma cells. Research Journal of Pharmacognosy (RJP) 2, 9-16. Farhangi, B., Alizadeh, A.M., Khodayari, H., Khodayari, S., Dehghan, M.J., Khori, V., Heidarzadeh, A., Khaniki, M., Sadeghiezadeh, M., Najafi, F., 2015. Protective effects of DNC on an animal metastatic breast tumor. European journal of pharmacology 758, 188-196. Farnebo, M., Bykov, V.J., Wiman, K.G., 2010. The p53 tumor suppressor: a master regulator of diverse cellular processes and therapeutic target in cancer. Biochemical and biophysical research communications 396, 85-89. Goh, A.M., Coffill, C.R., Lane, D.P., 2011. The role of mutant p53 in human cancer. J Pathol 223, 116126. Gou, M., Men, K., Shi, H., Xiang, M., Zhang, J., Song, J., Long, J., Wan, Y., Luo, F., Zhao, X., 2011. Curcumin-loaded biodegradable polymeric micelles for colon cancer therapy in vitro and in vivo. Nanoscale 3, 1558-1567. Kazemi-Lomedasht, F., Rami, A., Zarghami, N., 2013. Comparison of inhibitory effect of curcumin nanoparticles and free curcumin in human telomerase reverse transcriptase gene expression in breast cancer. Adv Pharm Bull 3, 127-130. Lall, R.K., Syed, D.N., Adhami, V.M., Khan, M.I., Mukhtar, H., 2015. Dietary polyphenols in prevention and treatment of prostate cancer. Int J Mol Sci 16, 3350-3376.
Li, L., Braiteh, F.S., Kurzrock, R., 2005. Liposome-encapsulated curcumin: in vitro and in vivo effects on proliferation, apoptosis, signaling, and angiogenesis. Cancer 104, 1322-1331. Liu, T.-Y., Tan, Z.-J., Jiang, L., Gu, J.-F., Wu, X.-S., Cao, Y., Li, M.-L., Wu, K.-J., Liu, Y.-B., 2013. Curcumin induces apoptosis in gallbladder carcinoma cell line GBC-SD cells. Cancer Cell Int 13, 64. Milacic, V., Banerjee, S., Landis-Piwowar, K.R., Sarkar, F.H., Majumdar, A.P., Dou, Q.P., 2008. Curcumin inhibits the proteasome activity in human colon cancer cells in vitro and in vivo. Cancer Research 68, 7283-7292. Mohajeri, M., Sadeghizadeh, M., Najafi, F., Javan, M., 2015. Polymerized nano-curcumin attenuates neurological symptoms in EAE model of multiple sclerosis through down regulation of inflammatory and oxidative processes and enhancing neuroprotection and myelin repair. Neuropharmacology 99, 156-167. Mollazade, M., Nejati-Koshki, K., Akbarzadeh, A., Hanifehpour, Y., Zarghami, N., Joo, S., 2013. PAMAM dendrimers arugment inhibitory effect of curcumin on cancer cell proliferation: possible inhibition of telomerase. Asian Pac J Cancer Prev 14, 6925-6928. Moos, P.J., Edes, K., Mullally, J.E., Fitzpatrick, F.A., 2004. Curcumin impairs tumor suppressor p53 function in colon cancer cells. Carcinogenesis 25, 1611-1617. Nasiri, M., Zarghami, N., Koshki, K.N., Mollazadeh, M., Moghaddam, M.P., Yamchi, M.R., Esfahlan, R.J., Barkhordari, A., Alibakhshi, A., 2013. Curcumin and silibinin inhibit telomerase expression in T47D human breast cancer cells. Asian Pacific Journal of Cancer Prevention 14, 3449-3453. Rashmi, R., Kumar, T.S., Karunagaran, D., 2003. Human colon cancer cells differ in their sensitivity to curcumin-induced apoptosis and heat shock protects them by inhibiting the release of apoptosisinducing factor and caspases. FEBS letters 538, 19-24. Sa, G., Das, T., 2008. Anti cancer effects of curcumin: cycle of life and death. Cell Division 3, 14. Sadeghizadeh, M., Ranjbar, B., Damaghi, M., Khaki, L., Sarbolouki, M.N., Najafi, F., Parsaee, S., Ziaee, A.A., Massumi, M., Lubitz, W., 2008. Dendrosomes as novel gene porters‐III. Journal of Chemical Technology and Biotechnology 83, 912-920.
Sarbolouki, M.N., Alizadeh, A.M., Khaniki, M., Azizian, S., Mohaghgheghi, M.A., 2012. Protective effect of DNC combination on colon cancer in rat. Tehran University of Medical Sciences 69. Schefe, J.H., Lehmann, K.E., Buschmann, I.R., Unger, T., Funke-Kaiser, H., 2006. Quantitative realtime RT-PCR data analysis: current concepts and the novel “gene expression’s C T difference” formula. Journal of molecular medicine 84, 901-910. Singh, S., 2007. From exotic spice to modern drug? Cell 130, 765-768. Song, G., Mao, Y., Cai, Q., Yao, L., Ouyang, G., Bao, S., 2005. Curcumin induces human HT-29 colon adenocarcinoma cell apoptosis by activating p53 and regulating apoptosis-related protein expression. Brazilian journal of medical and biological research 38, 1791-1798. Tabatabaei Mirakabad, F.S., Akbarzadeh, A., Milani, M., Zarghami, N., Taheri-Anganeh, M., Zeighamian, V., Badrzadeh, F., Rahmati-Yamchi, M., 2015. A Comparison between the cytotoxic effects of pure curcumin and curcumin-loaded PLGA-PEG nanoparticles on the MCF-7 human breast cancer cell line. Artificial cells, nanomedicine, and biotechnology, 1-8. Tahmasebi Birgani, M., Erfani-Moghadam, V., Babaei, E., Najafi, F., Zamani, M., Shariati, M., Nazem, S., Farhangi, B., Motahari, P., Sadeghizaded, M., 2015. Dendrosomal nano-curcumin; The novel formulation to improve the anticancer properties of curcumin. Progress in Biological Sciences 5, 143158. Tahmasebi Mirgani, M., Isacchi, B., Sadeghizadeh, M., Marra, F., Bilia, A.R., Mowla, S.J., Najafi, F., Babaei, E., 2014a. DNC nanoformulation downregulates pluripotency genes via miR-145 activation in U87MG glioblastoma cells. International journal of nanomedicine 9, 403. Tahmasebi Mirgani, M., Isacchi, B., Sadeghizadeh, M., Marra, F., Bilia, A.R., Mowla, S.J., Najafi, F., Babaei, E., 2014b. DNC nanoformulation downregulates pluripotency genes via miR-145 activation in U87MG glioblastoma cells. Int J Nanomedicine 9, 403-417. Wahlstrom, B., Blennow, G., 1978. A study on the fate of curcumin in the rat. Acta pharmacologica et toxicologica 43, 86-92.
Wang, W.Z., Cheng, J., Luo, J., Zhuang, S.M., 2008. Abrogation of G2/M arrest sensitizes curcuminresistant hepatoma cells to apoptosis. FEBS Lett 582, 2689-2695. Wang, W.Z., Li, L., Liu, M.Y., Jin, X.B., Mao, J.W., Pu, Q.H., Meng, M.J., Chen, X.G., Zhu, J.Y., 2013. Curcumin induces FasL-related apoptosis through p38 activation in human hepatocellular carcinoma Huh7 cells. Life Sci 92, 352-358. Watson, J.L., Hill, R., Yaffe, P.B., Greenshields, A., Walsh, M., Lee, P.W., Giacomantonio, C.A., Hoskin, D.W., 2010. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells. Cancer letters 297, 1-8. Zamani, M., Sadeghizadeh, M., Behmanesh, M., Najafi, F., 2015a. DNC increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer. Phytomedicine 22, 961-967. Zamani, M., Sadeghizadeh, M., Behmanesh, M., Najafi, F., 2015b. DNC increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer. Phytomedicine 22, 961-967.
Figure Legends Fig. 1. Microscopic visualization of treated cells. (A, B) Light and UV microscopy images of dendrosome-treated cells. (C, D) Light and UV microscopy images of free curcumin-treated cells, respectively. (E, F) Light and UV microscopy images of DNC -treated cells, respectively. After 4 h of treatment with 18μM DNC. Magnification ×10. Fig. 2. The effect of DNC, free curcumin and the carrier on the survival tumor cells using MTT. The cells were treated with a range of concentrations of each reagent during the time. (A) Huh7 cells after 24, 48 and 72 h treatment. (B) HepG2 cells after 24, 48 and 72 h treatment. (C) The effect of DNC on HFSF-PI3 normal human fibroblast cells during 24, 48 and 72 h. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 3. Flow cytometry histograms of cell lines. (A) Flow cytometry histograms of Huh7 cell line after 12, 24, and 48 and 72 h treatment with 18µM DNC. (B) Flow cytometry histograms of HepG2 cell line after 12, 24, 48 and 72 h treatment with 18µM DNC. Fig. 4. Flow cytometry charts of cell lines after 12, 24, 48 and 72 h treatment with 18µM DNC. A) Huh7 cell lines. B) HepG2 cell lines. The percentage of cells in G1 phase and SubG1 area was decreased and increased, respectively. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 5. The induction of cell death using Annexin-V-FLOUS/PI staining after treatment with 18µM DNC in three periods of 24, 48, and 72 h. (A) Huh7 cell line, (B) HepG2 cell line. The stained cells (AnnexinV-/PI-), (AnnexinV +/PI-), (AnnexinV+/PI+) and (AnnexinV-/PI+) were characterized as healthy cells, the cells in the early phase of apoptosis, the cells in the delayed phase of apoptosis and necrosis cells, respectively.
Fig. 6. Early and late apoptosis analysis after treatment with 18µM DNC in three periods of 24, 48, and 72 h. (A) Huh7 cell line. (B) HepG2 cell line. Data are reported as Mean ± SD. *: p<0.05، **: p<0.01 ،**: p<0.001 and ****: p<0.0001. Fig. 7. The effect of DNC on the expression of genes involved in the apoptosis including p21، Noxa، Bcl-2, BAX and p53. Data are reported as Mean ± SD. *p<0.05، **: p<0.01* ،**: p<0.001 and ****: p<0.0001. Fig. 8. Western Blot analysis of HepG2/Huh7 cells in presence of DNC. Western Blot was performed and results were expressed relative to untreated cells. Beta-actin was used as housekeeping gene. p53 was detected using monoclonal p53 antibodies. Note that p53 expression increased in DNC -treated HepG2 and decreased in DNC -treated Huh7 during the time. DNC up-regulated BAX and p21 and down-regulated Bcl-2 in both cell lines.
Table 1: The physical and chemical stability of DNC Size (nm)
PDI
ζ-potential (mV)
EE (%)
142.97±4.27
0.4±0.03
-7.81±1.4
87.65±1.82
Abbreviations: EE, encapsulation efficiency; PDI, polydispersity index.
Table 2: primers used for specific genes and housekeeping gene Gene p53 p21 Noxa BAX
Primer
Size
Forward: TCCTCAGCATCTTATCCGAGTG Reverse: AGGACAGGCACAAACACGCACC Forward: CCTGTCACTGTCTTGTACCC Reverse: GTGGTAGAAATCTGTCATGCTG Forward: GAGCTGGAAGTCGAGTGTG Reverse: CTCTTTTGAAGGAGTCCCCTC
265
Forward: GTGGATGACTGAGTACCTGAAC Reverse: GCCAGGAGAAATCAAACAGAGG
119
121 148
Forward: GAGCAGATCATGAAGACAGGG 149 Reverse: ATGCGCTTGAGACACTCG GAPDH Forward: 5'CCCACTCCTCCACCTTTGAC3' 75 Reverse: 5'CATACCAGGAAATGAGCTTGACAA3' Abbreviations: F, forward primer; R, reverse primer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase Bcl-2
Table 3: Cell cycle distribution in Huh7/HepG2 cells after time dependent treatment of the cells with 18μM DNC using flow cytometry analysis Cell type Huh7
HepG2
T=0
T = 12
T = 24
T = 48
SubG1
3.7± 0.007
17.05 ± 0.003
37.83 ± 0.008
65.26 ± 0.001
79.11 ± 0.00
G1
46.95± 0.004
34.21 ± 0.00
31.50 ±0.16
6.34 ± 0.002
7.41 ±0.02
S
7.85± 0.01
6.28 ± 0.029
5.24 ±0.04
3.44 ± 0.01
1.07 ± 0.004
G2/M
29.92± 0.011
18.57 ± 0.017
12.08 ±0.02
18.07 ± 0.004
4.91 ± 0.012
SubG1
5.07 ± 0.003
14.37 ± 0.002
32.31 ± 0.03
35.80 ± 0.01
40.71 ± 0.018
G1
51.52± 0.008
37.77 ± 0.037
29.76 ± 0.03
27.35 ± 0.04
21.34 ± 0.07
S
12.69± 0.02
6.11 ± 0.021
5.11 ± 0.02
4.69 ± 0.01
3.53 ± 0.06
G2/M
21.90± 0.01
29.95 ± 0.060
16.64 ± 0.01
17.36 ± 0.02
15.12 ± 0.02
Note: Data expressed as mean ± standard deviation of three replicates Abbreviation: t, time.
T = 72
Table 4: Early and late apoptosis analysis after treatment with 18µM DNC Cell type Huh7
T=0
T = 48
T = 72
Early apoptosis (LR) 0.48± 0.002 20.26± 0.013 31.50±0.025 57.59±0.038 Late apoptosis (UR)
HepG2
T = 24
1.41± 0.001
2.08 ±0.00
3.40±0.00
1.42±0.004
Early apoptosis (LR) 2.78± 0.011 31.34 ±0.007 14.61±0.001 28.59±0.006 Late apoptosis (UR)
0.83 ±0.002
4.02 ±0.016
Note: Data expressed as mean ± standard deviation. Abbreviation: t, time.
18.26±0.01
16.5±0.012