Dengue serotype circulation in natural populations of Aedes aegypti

Accepted Manuscript Title: Dengue serotype circulation in natural populations of Aedes aegypti Authors: Taissa Pereira dos Santos, Oswaldo Gonsalvez Cruz, Keli Antunes Barbosa da Silva, M´arcia Gonc¸alves de Castro, Anielly Ferreira de Brito, Renato Cesar Maspero, Rosilene de Alcˆantra, Fl´avia Barreto dos Santos, Nildimar A. Honorio, Ricardo Lourenc¸o-de-Oliveira PII: DOI: Reference:

S0001-706X(17)30522-3 http://dx.doi.org/doi:10.1016/j.actatropica.2017.07.014 ACTROP 4374

To appear in:

Acta Tropica

Received date: Revised date: Accepted date:

6-5-2017 13-7-2017 13-7-2017

Please cite this article as: dos Santos, Taissa Pereira, Cruz, Oswaldo Gonsalvez, da Silva, Keli Antunes Barbosa, de Castro, M´arcia Gonc¸alves, de Brito, Anielly Ferreira, Maspero, Renato Cesar, de Alcˆantra, Rosilene, dos Santos, Fl´avia Barreto, Honorio, Nildimar A., Lourenc¸o-de-Oliveira, Ricardo, Dengue serotype circulation in natural populations of Aedes aegypti.Acta Tropica http://dx.doi.org/10.1016/j.actatropica.2017.07.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Dengue serotype circulation in natural populations of Aedes aegypti Taissa Pereira dos Santos1 , Oswaldo Gonsalvez Cruz2 , Keli Antunes Barbosa da Silva1 ,Márcia Gonçalves de Castro1 Anielly Ferreira de Brito1 ,Renato Cesar Maspero3, Rosilene de Alcântra3 , Flávia Barreto dos Santos4, Nildimar A. Honorio1,4, Ricardo Lourenço-de-Oliveira1 1

Instituto Oswaldo Cruz, Laboratório de Mosquitos Transmissores de Hematozoários, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil 2

Programa de Computação Cientifica-PROCC, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil 3

Prefeitura Municipal do Rio de Janeiro, Secretaria Municipal de Saude, Rio de Janeiro, RJ, Brasil Núcleo Operacional Sentinela de Mosquitos Vetores – Nosmove/Fiocruz, Rio de Janeiro, RJ, Brasil 4

5

Instituto Oswaldo Cruz, Laboratório de Biologia Molecular de Flavivírus, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil * Corresponding author at: Maladies Infectieuses et Vecteurs : Ecologie, Génétique, Evolution et Contrôle- IRD, Montpellier, France. E-mail adresses: [email protected] Abstract Ae. aegypti is the main vector of dengue (DENV), Zika (ZIKV), and chikungunya (CHIKV) viruses. The transmission dynamics of these arboviruses, especially the arboviral circulation in the mosquito population during low and high transmission seasons in endemic areas are still poorly understood. We conducted an entomological survey to determine dengue infection rates in Ae. aegypti and Aedes albopictus. These collections were performed in 2012-2013 during a Rio de Janeiro epidemic, just before the introduction and spread of ZIKV and CHIKV in the city. MosquiTrap© and BG-Sentinel traps were installed in three fixed and seven itinerant neighborhoods each month over ten months. Mosquitoes were in supernatants pools tested and individually confirmed for DENV infection using RT-PCR. A total of 3,053 Aedes mosquitos were captured and Ae. aegypti was much more frequent (92.9%) than Ae. albopictus (6.8%). Ae. aegypti females accounted for 71.8% of captured mosquitoes by MosquitTrap© and were the only species found naturally infected with DENV (infection rate= 0.81%). Only one Ae. aegypti male, collected by BG-sentinel, was also tested positive for DENV. The peak of DENV-positive mosquitoes coincided the season of the highest incidence of human cases. The most common serotypes detected in mosquitoes were DENV-3 (24%) and DENV-1 (24%), followed by DENV-4 (20%), DENV-2 (8%) and DENV-1 plus DENV4 (4%), while 95% of laboratory-confirmed human infections in the period were due to DENV-4. These contrasting results suggest silent maintenance of DENV serotypes during the epidemics, reinforcing the importance of entomological and viral surveillance in endemic areas.

Keywords: dengue serotypes; arbovirus detection; infected mosquitoes 1. Introduction Ae. aegypti is the primary vector of dengue, chikungunya, and zika viruses in Brazil (de Castro et al., 2012; Ferreira-de-Brito et al., 2016; Gubler, 2002; Honório et al., 2015; Lourenco-de-Oliveira et al., 2002). Dengue fever is a complex, multi-factorial disease found throughout the world, with global incidence reaching from 50 to 100 million cases per year (Guzman et al., 2010; Lambrechts and Failloux, 2012). The disease is caused by four dengue virus serotypes (DENV-1,-2,-3, and - 4). Brazil has suffered a large dengue epidemics over the last 30 years. The frequency of epidemics has been particularly high in the city of Rio de Janeiro, which is thought to have been the area of introduction for DENV-2 and DENV-3 in 1990 and 2001, respectively. The introduction of these serotypes was followed by epidemics that spread throughout the country. Circulation of DENV-3 in Rio de Janeiro was first identified in 2000 (Nogueira et al., 2001, 1990; Nogueira and Eppinghaus, 2011; Ribeiro Nogueira et al., 2005). DENV -1, 2, and -3 have co-circulated since 2010. A reemergence of DENV-1 and the introduction of DENV-4 were recorded in 2011 (de Castro et al., 2012; Ministério da Saúde, 2011; Nogueira and Eppinghaus, 2011). The introduction of DENV-4 into Rio de Janeiro resulted in 66,278 dengue cases in 2013, and 2,658 cases in 2014; DENV-4 was the serotype detected in more than 95% of laboratory-diagnosed human cases in 2013 (SMSRJ). There were 18,070 confirmed DENV cases in 2015 and 25,804 in 2016, and CHIKV and ZIKV have also been circulating in the city since 2015 (Brasil et al., 2016; Conteville et al., 2016; Ferreira-de-Brito et al., 2016; Honório et al., 2015). We conducted an entomological surveillance using molecular tools aiming at monitoring DENV infection in mosquitoes in Rio de Janeiro during the 2012-2013 DENV-1/DENV4 outbreak, before the introduction of ZIKV and CHIKV in the city. Entomological surveillance may help to predict and detect the occurrence of dengue transmission hotspots, and rapidly optimize the implementation of control measures. With the purpose of warning public health authorities of ‘at risk’ areas for dengue outbreaks. This work describes arbovirus infection rates and serotype circulation in randomly captured Ae. aegypti during an epidemic year. 2. Methods The municipality of Rio de Janeiro is subdivided into 161 neighborhoods. We randomly selected ten neighborhoods for monthly mosquito sampling from October 2012 to July 2013: three neighborhoods were permanently sampled throughout the study, while other seven neighborhoods were randomly sampled each month. Mosquitoes were captured using MosquiTrap© placed individually in 20 randomly chosen dwellings in each neighborhood. Additionally, two BG-Sentinel traps operated in two strategic sites with high human traffic in each neighborhood (e.g., commercial establishments, schools, health clinics, churches). MosquiTrap© remained in the residences during the last two weeks of each month, and mosquitoes were collected once per week. The BG-Sentinel traps operated for 24 hours prior to the collection in each neighborhood. Total sampling effort for the study period included collections from 200 residences (MosquiTrap©) and 20 areas with high human traffic (BG-Sentinels). Mosquito identifications were carried out following Consoli and Lourenço (1994), and specimens were organized by sex, trap type, capture location, and date of capture.

Mosquitoes were individually macerated in 300μl Leibovitz 15 medium (L15) supplemented with 23% fetal calf serum, following centrifuged for 15 min at 3,000 rpm. The supernatant was stored at -20 ºC during one month. RNA extraction was done from supernatants aliquots of 2 to 5 mosquitoes belonging to the same species and collecting site and day. In this work we use the term "supernatants pools" as a representative of the RNA extracted from the aliquots of the supernatant of the individual ground mosquitoes. Viral RNA was extracted from a 150μl volume added from supernatants pools using the QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, USA) following manufacturer instructions. DENV infections were determined by RT-PCR, following Lanciotti RS et al. (1992). This protocol is performed in two amplification steps of. In a first step, viral RNA is reverse transcribed into complementary DNA (cDNA) using Consensual primers (D1 and D2), complementary to the C and prM gene sequences for the four serotypes (Table 1). Table 1. Primers used in the PCR reactions.

Primer Name

Primer sequence

Sense(5’3’)

Genomic Location

D1

TCAATATGCTGAAACGCGGAGAAACCG

forward

134-161

D2

TTGCACCAACAGTCAATGTCTTCAGGTTC

reverse

616-644

511 (D1+D2

TS1

CGTCTCAGTGATCCGGGGG

reverse

568-586

482(D1+TS1)

TS2

CGCCACAAGGGCCATGAACAG

reverse

232-252

119(D1+TS2)

TS3

TAACATCATCATGAGACAGAGC

reverse

400-421

290(D1+TS3)

TS4

CTCTGTTGTCTTAAACAAGAGA

reverse

506-527

392(D1+TS4)

Size(base pairs)

In a second PCR (semi-nested) step, the products obtained in the first step were amplified using the consensual primer (D1) and specific primers TS1, TS2, TS3 and TS4 (Table 1) for DENV-1 to 4. For positive controls, PCR products from DENV positive samples isolated from Ae. albopictus clone C6 / 36 culture cells (Igarashi 1978) were used. As a negative control, we used DNase and RNase free water and uninfected lab-bred mosquitoes. When a given supernatants pools tested positive with RT-PCR, we analyzed the supernatant of each mosquito comprising the supernatants pools. Individual positive mosquito RNAs were preserved in -80ºC for the Simplexa DENGUE real-time RT-PCR analysis in July 2014. The samples were treated with DNase products for RT-PCR and Simplexa RT-PCR amplification. The data concerning dengue cases and serotypes DENV detected in humans were obtained from the Municipal Health Department. The use of these data was approved by the FIOCRUZ Ethics Committee. DENV detection of the four serotypes were performed by RT-PCR from randomly human dengue cases (SI1).

3. Results We captured 3,053 specimens, including 2,785 Ae. aegypti (2,469 females + 369 males), 210 Ae. albopictus (199 females + 11 males), and 5 Ae. (Stegomyia) mosquitoes that we could not identify at a species level. Of the total sample, 2,500 (81.8%) mosquitoes were captured with MosquiTrap©, including 2,299 Ae. aegypti (2,193 females + 106 males), and 197 Ae. albopictus (188 females + 9 males). The BG-sentinel captured 553 individuals in total (17.4% of all specimens), including 276 Ae. aegypti females (9.0%)

and 263 males (8.6%). Only four Ae. albopictus were collected in BG-sentinel, including two females and two males. Ae. aegypti females captured by MosquitTrap© represented 75.3% of all collected mosquitoes. Specimens belonging to other mosquito species, such as Culex quinquefascitus and Limatus durhamii, were captured in both traps. However, the amount captured was very low and they were thus not considered in the analyses of this study. Specimens were analyzed individually using RT-PCR, resulting in 25 DENV-positive individuals (Fig 1). The sample consisted of 24 positive Ae. aegypti females captured with MosquiTrap©, and a single DENV-1-positive male Ae. aegypti captured by BG-sentinel. Of the 25 positive individuals, DENV infection was confirmed in 5 (20%) of the samples through detection of a 511 bp band in the first RT-PCR reaction. DENV serotype was confirmed in 25 individuals (0.81%). The most frequent serotypes detected were DENV -3 (25%) and DENV-1 (25%), followed by DENV -4 (20%), DENV-2 (8%), and there was one case of co-infection with DENV-1 and DENV-4 (4%). Fig 1. DENV-infected Ae. aegypti.

Number of Ae. aegypti infected mosquitoes

5 4 DENV-1 3 DENV-2 2

DENV-3 DENV-4

1 0 Oct

Nov

Des

Jan

Fev

Mar

Avr

Mai

Jun

July

Month

The numbers of DENV-infected Ae. aegypti per sampling in a month. Mosquitoes were collected in Rio de Janeiro from October 2012 to July 2013. The 25 individuals that tested positive during conventional PCR screening were retested using the SimplexaTM Dengue RT-PCR kit 12 months after the end of the field collections. This second analysis confirmed the serotype (DENV 1-4 = cycle threshold 23, 19.8, 36.9 and 30.2, respectively), as well as co-infections with DENV-1 and DENV4 (= cycle threshold 38.6 and 38.9, respectively). The occurrence of positive mosquitoes per month and neighborhood corresponded with the occurrence of confirmed human dengue cases (SI2). Table 2. DENV detection by conventional and real-time RT-PCR in mosquitoes (analyzed in pools or individually by month and capture area in Rio de Janeiro. Positive Number

supernatants polls Individuals confirmed

Simplexa RT-PCR

Month

Mosquitoes supernatants Captured polls

RT-PCR

by RT-PCR

(CT values)

Serotype

Neighborhood

October

231

3

1 female Ae. aegypti 1 female Ae. aegypti

X X

D1 D2

Penha Penha

100

1 female Ae. aegypti

X

D1

Agua Santa

November

429

138

2

0

X

X

X

December

479

389

*

*

*

*

*

January

294

123

*

*

*

*

*

February

388

205

5

1 female Ae. aegypti 1 female Ae. aegypti 1 female Ae. aegypti

23 19.8 X

D4 D4 D4

Estácio de Sá Estácio de Sá Estácio de Sá

1 female Ae. aegypti

X

D3

Deodoro

March

398

205

15

1 female Ae. aegypti 1 male Ae. aegypti 1 female Ae. aegypti 1 female Ae. aegypti 1 female Ae. aegypti 1 female Ae. aegypti

X X 38.6 + 38.9 36.9 X X

D3 D1 D1 + D4 D4 D1 D2

Catete Catete Catete Catete Catete Penha Circular

1 female Ae. aegypti

X

D3

1 female Ae. aegypti

X

D1

Camorim Campo Afonsos

1 female Ae. aegypti

X

D1

Paciencia

1 female Ae. aegypti 1 female Ae. aegypti

30.2 X

D4 D3

Camorim Camorim Barra de

1 female Ae. aegypti

X

D3

Guaratiba

April

208

112

5

dos

1 female Ae. aegypti

X

D3

Botafogo

May

223

122

0

*

*

*

*

June

183

98

2

1 female Ae. aegypti

X

D

Grajaú

1 female Ae. aegypti

X

D

Grajaú

1 female Ae. aegypti 1 female Ae. aegypti

X X

D D

Penha Centro

1 female Ae. aegypti

X

D

Abolição

D2(8%) D4(20%)

D(20%) D1 + D4 (4%)

July

131

91

3

Total

3 053

1583

35

Frequency

D1 (24 %) D3 (24%)

*Information is missing because there were no positive mosquitoes in that month. D= Mosquitoes are positive for only the first RT-PCR reaction. X= No positive results. 4. Discussion We detected the co-circulation of the four DENV serotypes in mosquitoes in Rio de Janeiro during a DENV-4 epidemic. Over the course of the study period, the epidemic resulted in 67,977 human reported cases. However, only 185 (0.28%) cases could be laboratory confirmed by RT-PCR, with 174 confirmed as DENV-4. The high number of DENV-positive mosquitoes coincided with the peak in human dengue diagnoses cases, which occurred in the months of February, March, and April of 2013 (Fig. 1 and SI2). However, DENV serotype prevalence in humans did not match the serotype prevalence in mosquitoes. DENV-4 was the predominant serotype identified in laboratory confirmed human cases, while the most common serotypes identified in mosquitoes were DENV-3 and DENV-1.DENV-4. DENV-2 were also detected in mosquitoes during this period, although less commonly. Sang samples collected from inhabitants of Rio de Janeiro throughout the study period revealed low circulation of DENV-3 and -1, the most frequently isolated serotypes in collected mosquitoes. In humans, the second most common serotype was DENV-1. Mosquitoes with DENV-3 were detected from February to April, while serotype 3 cases in humans were detected from March to May. However, the serotypes determined by RT-PCR did not generate the same results than Simplexa RT-PCR. This difference can be due to at least two reasons: i) DENV-4 may be more

resistant to degradation than other serotypes or, ii) others serotypes detected in RT-PCR could be the result of the amplification of DENV nonspecific fragments. The lack of serotype confirmation in human cases may lead to the false impression that other serotypes are not circulating during this epidemic. For example, two of our positive mosquitoes from April, one infected with DENV-3 and another by DENV-4, occurred in an area with no reported human dengue cases (data not shown). Further, georeferencing of human cases covers only ~70% of reported cases, and a significant fraction of infections may be asymptomatic and thus, underreported (Honório et al., 2009). Collection of field mosquitoes for arbovirus detection typically occurs at sampling locations near residences where human infections have been confirmed. It is thus common that DENV serotypes detected in mosquitoes collected near residences matches the serotype of associated human infections in the area (de Castro et al., 2012; Lourenco-deOliveira et al., 2002). This collection design is useless for the purpose of surveillance or analysis of virus distribution. In the present study, a random collection of adult mosquitos was a unique approach, in which 79.6% of infected mosquitoes were captured in intermittently monitored neighborhoods. Natural dengue infection rates were low for mosquitoes captured using both trap types, even in areas with confirmed human cases. This could be explained by the viral RNA degradation in trapped mosquitoes, which may have died several hours before collection. One study showed that after experimental mosquito infection with DENV and killing at low temperature (unnatural conditions), storage at a temperature and humidity comparable to that found in tropical countries (26-31 °C; 50-60% RH) still allowed detection of infection in dead mosquitoes for up to 13 weeks(Bangs et al., 2007). In the current study, infected mosquitoes were preserved at -80 °C for 12 months after field capture, indicating that well-preserved viral RNA can be studied for up to a year after collection. The locations chosen for collections facilitated a sampling “sweep” of the Rio de Janeiro territory. DENV is maintained in nature through cyclical replication between humans and vectors. However, several factors can influence viral circulation, such as herd immunity, and vertical or venereal transmission in the vector (Mora-Covarrubias et al., 2010). Herd immunity is an important moderating factor in the potential for epidemics due to the reemergence or introduction of DENV serotypes. Vertical and venereal transmission in mosquitoes increases viral success in nature; some authors have suggested that the rate of vertical transmission of dengue varies between 0.8% and 13%(Pessanha et al. 2011, Perez-Castro et al. 2016, Peña-García et al. 2016). In the present study, we found a natural infection rate of 0.81%, which included one naturally infected, male Ae. aegypti. The detection of viral genome of DENV-1, DENV-3, and DENV-2 in male and female Ae. aegypti during a DENV-4 epidemic year may suggest the occurrence of vertical transmission. This phenomenon would help the maintenance of all four serotypes in the area, which can then emerge/re-emerge as an epidemic at any time depending on the herd immunity of local populations. Unfortunately, in the present study it was not possible to determine the transmission hotspot areas. 5. Conclusion

Our results suggest a “silent” circulation of DENV in the area of serotypes that are less frequently found in associated human populations. These data also emphasize the importance of entomological and viral surveillance. Conflict of the interest: The authors declare that there is no conflict of interest. Acknowledgments: We thank the Cecilia Nicolai, Marcos Nunes Ferreira, Marcos Pinheiro, Claudia Codeço, Bruno Oliveira Mariano, Andiaria Ramos, Maycon Neves, Marcelo Celestino, Renato Carvalho, Marcelo Quintela for support. Financial support was provided by CSF/CNPq, FIOCRUZ, FAPERJ, and SMS/RJ. References Bangs, M.J., Pudiantari, R., Gionar, Y.R., 2007. Persistence of dengue virus RNA in dried Aedes aegypti (Diptera: Culicidae) exposed to natural tropical conditions. J Med Entomol 44, 163–167. Brasil, P., Calvet, G.A., Siqueira, A.M., Wakimoto, M., de Sequeira, P.C., Nobre, A., Quintana, M. de S.B., Mendon??a, M.C.L. de, Lupi, O., de Souza, R.V., Romero, C., Zogbi, H., Bressan, C. da S., Alves, S.S., Louren??o-de-Oliveira, R., Nogueira, R.M.R., Carvalho, M.S., de Filippis, A.M.B., Jaenisch, T., 2016. Zika Virus Outbreak in Rio de Janeiro, Brazil: Clinical Characterization, Epidemiological and Virological Aspects. PLoS Negl. Trop. Dis. 10, 1–13. doi:10.1371/journal.pntd.0004636 Conteville, L.C., Zanella, L., Marín, M.A., de Filippis, A.M.B., Nogueira, R.M.R., Vicente, A.C.P., de Mendonça, M.C.L., 2016. Phylogenetic analyses of chikungunya virus among travelers in Rio De Janeiro, Brazil, 2014-2015. Mem. Inst. Oswaldo Cruz 111, 347–348. doi:10.1590/0074-02760160004 de Castro, M.G., Nogueira, R.M.R., de Filippis, A.M.B., Ferreira, A.A., Lima, M. da R.Q., Faria, N.R. da C., Nogueira, F. de B., Simões, J.B.S., Nunes, P.C.G., Sampaio, S.A., Lourenço-de-Oliveira, R., dos Santos, F.B., 2012. Dengue virus type 4 in Niterói, Rio de Janeiro: The role of molecular techniques in laboratory diagnosis and entomological surveillance. Mem. Inst. Oswaldo Cruz 107, 940–945. doi:10.1590/S0074-02762012000700017 Ferreira-de-Brito, A., Ribeiro, I.P., Miranda, R.M. de, Fernandes, R.S., Campos, S.S., Silva, K.A.B. da, Castro, M.G. de, Bonaldo, M.C., Brasil, P., Lourenço-de-Oliveira, R., 2016. First detection of natural infection of Aedes aegypti with Zika virus in Brazil and throughout South America. Mem. Inst. Oswaldo Cruz 111, 655–658. doi:10.1590/0074-02760160332 Gubler, D.J., 2002. Full-Text 10, 100–103. Guzman, M.G., Halstead, S.B., Artsob, H., Buchy, P., Farrar, J., Gubler, D.J.,

Hunsperger, E., Kroeger, A., Margolis, H.S., Martínez, E., Nathan, M.B., Pelegrino, J.L., Simmons, C., Yoksan, S., Peeling, R.W., 2010. Dengue: a continuing global threat. Nat. Rev. Microbiol. 8, S7–S16. doi:10.1038/nrmicro2460 Honório, N.A., Câmara, D.C.P., Calvet, G.A., Brasil, P., 2015. Chikungunya: an arbovirus infection in the process of establishment and expansion in Brazil. Cad. Saude Publica 31, 906–908. doi:10.1590/0102-311XPE020515 Honório, N.A., Nogueira, R.M.R., Codeço, C.T., Carvalho, M.S., Cruz, O.G., Magalhães, M.D.A.F.M., De Araújo, J.M.G., De Araújo, E.S.M., Gomes, M.Q., Pinheiro, L.S., Pinel, C.D.S., Lourenço-de-Oliveira, R., 2009. Spatial evaluation and modeling of dengue seroprevalence and vector density in Rio de Janeiro, Brazil. PLoS Negl. Trop. Dis. 3, 1–11. doi:10.1371/journal.pntd.0000545 Lambrechts, L., Failloux, A.B., 2012. Vector biology prospects in dengue research. Mem. Inst. Oswaldo Cruz 107, 1080–1082. doi:10.1590/S0074-02762012000800022 Lanciotti RS, Calisher CH, Gubler DJ, Chang GL, V. V, 1992. Reverse TranscriptasePolymerase Chain Reaction (RT-PCR). J Clin Microbiol 30, 545–51. Lourenco-de-Oliveira, R., Honório, N.A., Castro, M.G., Schatzmayr, H.G., Miagostovich, M.P., Alves, J.C.R., Silva, W.C., Leite, P.J., Nogueira, R.M.R., 2002. Dengue virus type 3 isolation from Aedes aegypti in the municipality of Nova Igua??u, State of Rio de Janeiro. Mem. Inst. Oswaldo Cruz 97, 799–800. doi:10.1590/S0074-02762002000600009 Ministério da Saúde, 2011. Relatório de Situação - Rio de janeiro, Sistema Nacional de Vigilância em Saúde. Mora-Covarrubias, A., Jiménez-Vega, F., Treviño-Aguilar, S.M., Covarrubias, M., Jiménez Vega, F., Treviño Aguilar, S.M., others, 2010. Distribuci{ó}n geoespacial y detecci{ó}n del virus del dengue en mosquitos Aedes (Stegomyia) aegyptide Ciudad Ju{á}rez, Chihuahua, M{é}xico. Salud P{Ú}Blica De M{É}Xico 52, 127– 133. Nogueira, R.M., Eppinghaus, A.L., 2011. Dengue virus type 4 arrives in the state of Rio de Janeiro: a challenge for epidemiological surveillance and control. Mem. Inst. Oswaldo Cruz 106, 255–256. Nogueira, R.M., Miagostovich, M.P., de Filippis, a M., Pereira, M. a, Schatzmayr, H.G., 2001. Dengue virus type 3 in Rio de Janeiro, Brazil. Mem. Inst. Oswaldo Cruz 96, 925–6. Nogueira, R.M.R., Miagostovich, M.P., Lampe, E., Shatzamayr, H.G., 1990. Isolation of Dengue Virus Type 2 in Rio de Janeiro. Mem Inst Oswaldo Cruz. P??rez-Castro, R., Castellanos, J.E., Olano, V.A., Matiz, M.I., Jaramillo, J.F., Vargas, S.L., Sarmiento, D.M., Stenstr??m, T.A., Overgaard, H.J., 2016. Detection of all four dengue serotypes in Aedes aegypti female mosquitoes collected in a rural area in Colombia. Mem. Inst. Oswaldo Cruz 111, 233–240. doi:10.1590/0074-

02760150363 Peña-García, V.H., Triana-Chávez, O., Mejía-Jaramillo, A.M., Díaz, F.J., GómezPalacio, A., Arboleda-Sánchez, S., 2016. Infection rates by dengue virus in mosquitoes and the influence of temperature may be related to different endemicity patterns in three Colombian cities. Int. J. Environ. Res. Public Health 13, 1–16. doi:10.3390/ijerph13070734 Pessanha, J.E.M., Caiafa, W.T., Cecilio, A.B., de Melo Iani, F.C., Araujo, S.C., Nascimento, J.C., Kroon, E.G., Proieti, F.A., Arias, J.R., 2011. Cocirculation of two dengue virus serotypes in individual and pooled samples of Aedes aegypti and Aedes albopictus larvae. Rev. Soc. Bras. Med. Trop. 44, 103–105. doi:S003786822011000100023 [pii] Ribeiro Nogueira, R.M., Gonçalves Schatzmayr, H., Bispo De Filippis, A.M., Barreto Dos Santos, F., Venâncio Da Cunha, R., Coelho, J.O., De Souza, L.J., Ramos Guimarães, F., Machado De Araújo, E.S., Santos De Simone, T., Baran, M., Teixeira, G., Pereira Miagostovich, M., 2005. Dengue virus type 3, Brazil, 2002. Emerg. Infect. Dis. 11, 1376–1381. doi:10.3201/eid1109.041043