Dependence of Giardia lamblia encystation on novel transglutaminase activity

Molecular & Biochemical Parasitology 136 (2004) 173–180

Dependence of Giardia lamblia encystation on novel transglutaminase activity B.J. Davids a,∗ , K. Mehta b , L. Fesus c , J.M. McCaffery d , F.D. Gillin a a

c

Department of Pathology, Division of Infectious Diseases, UCSD Medical Center, University of California, CTF-C 403, 214 Dickinson Street, San Diego, CA 92103-8416, USA b Department of Bioimmunotherapy, M.D. Anderson Cancer Center, University of Texas, Houston, TX 77030, USA Departments of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, H-4012 Debrecen, Hungary d Department of Biology, Integrated Imaging Center, The Johns Hopkins University, Baltimore, MD 21218, USA Received 29 January 2004; received in revised form 25 March 2004; accepted 30 March 2004 Available online 22 April 2004

Abstract Earlier, we found that three protein disulfide isomerases (PDI) from Giardia lamblia (gPDI) also have transglutaminase (TGase) activity in vitro. We now show that differentiating Giardia cells contain isopeptide bonds (ε(␥-glutamyl)lysine), the biological product of TGase activity that results in irreversible crosslinking of proteins in vivo. HPLC analyses showed the highest isopeptide bond content in cells encysting for 21 h, indicating an important role for TGase early in encystation. We were not able to detect isopeptide bonds in water-resistant cysts, possibly because they could not be extracted. One of the hallmarks of early encystation is the formation of encystation secretory vesicles (ESV) that transport nascent cyst wall proteins (CWPs) to the outer cell surface. ImmunoEM and live-cell immunofluorescence assays of encysting parasites revealed that gPDIs 1–3 are located in ESV and that gPDI-2 is also novel in that it is localized on the cell surface. Cystamine, a widely used TGase inhibitor, caused a dose-dependent inhibition of ESV formation by 21 h, thereby preventing development of trophozoites into cysts. Since cystamine (0.5–1 mM) inhibited the TGase activity of recombinant gPDIs 1–3 in vitro, PDIs appear to be the physiologic targets of cystamine. We found that when parasites were treated with cystamine, CWPs were not processed normally. These data suggest that TGase-catalyzed reactions may be needed for either the machinery that processes CWP precursors or their recruitment to ESV. © 2004 Elsevier B.V. All rights reserved. Keywords: Giardia lamblia; Transglutaminase; Protein disulfide isomerase; Encystation

1. Introduction Intermolecular protein crosslinks confer strength and resistance upon extracellular structures from protist cell walls to mammalian extracellular matrix (ECM) [1–4]. Although disulfide bonds are common in ECM, other types of protein crosslinks may be crucial to assembly and physical properties of these complex structures. Transglutaminases (TGases) (E.C. 2.3.2.13) catalyze the covalent linkage of a Abbreviations: PDI, protein disulfide isomerase; gPDI, giardial protein disulfide isomerase; TGase, transglutaminase; HPLC, high performance liquid chromatography; ESV, encystation secretory vesicle; CWP, cyst wall protein; EM, electron microscopy; ECM, extracellular matrix; ER, endoplasmic reticulum; PV, peripheral vacuoles; ESCP, encystation-specific cysteine protease; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; BSA, bovine serum albumin; ORF, open reading frame ∗ Corresponding author. Tel.: +1-619-543-7729; fax: +1-619-543-6614. E-mail address: [email protected] (B.J. Davids). 0166-6851/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2004.03.011

specific protein glutaminyl residue with a lysine of a second specific protein to form an intermolecular ε(␥-glutamyl) lysine isopeptide crosslink. These stable covalent bonds resist all known proteases and cannot be broken even after the proteins are denatured. Post-translational crosslinking of proteins by TGase is necessary for a variety of cellular events including the assembly of ECM [5]. G. lamblia cyst walls are a valuable model of ECM with both structural and signaling properties [6–8]. Cyst wall proteins (CWP) are transported to the nascent wall via novel regulated secretory vesicles (ESV) [9,10]. Despite extensive disulfide bond formation, the CWPs do not become insoluble until after exocytosis [11]. The key roles of isopeptide bonds in stabilization of ECM stimulated us to test the hypothesis that they may play a role in giardial cyst wall formation. Many higher (or crown group) organisms have dedicated TGases [3]. In addition, protein disulfide isomerases (PDIs) of some organisms have recently been shown to also have

174

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

TGase activity [1,12–14]. Earlier we expressed and characterized three of the five novel PDIs of the protozoan parasite Giardia lamblia [14]. gPDIs 1–5 are unusual in that each has only a single PDI active site [14,15]. We found that gPDIs 1–3 also function as Ca2+ -dependent TGases, although they do not have sequences typical of mammalian TGase active sites. The TGase active site of PDIs includes the amino acids His–Cys that are also in the core of the Cys–Gly–His–Cys PDI active site [16]. Recombinant gPDI 1–3 enzymes all had substantial TGase activity in vitro, similar to PDIs of round worms and humans [1,12,13,17]. In our earlier study [14], we did not explore the function of TGase in G. lamblia in vivo. However, we speculated that isopeptide bonds might help strengthen the cyst wall during differentiation. Using well-validated TGase inhibitors, studies on parasitic worms have shown that TGase is essential in regulating embryonic development, maturation of the cuticle, and normal worm growth [1]. In addition, Brugia malayi TGase crosslinks host proteins to the cuticle of the worm suggesting a role in protecting the worm from host defenses [18]. In Plasmodium species, TGase has been implicated in cross-linking proteins of the mosquito host and parasite oocysts [19]. TGase may also increase deformability of the exoskeleton of infected human red blood cells helping the parasites to thrive in host environments. Because TGases are important for the survival of protozoan and metazoan parasites, they may have strong potential as new targets for chemotherapy [1]. G. lamblia has two distinct stages in its life cycle that could utilize TGase activity [6]. The trophozoite form colonizes the small intestine by asexual multiplication and causes disease. Some trophozoites respond to physiological cues by transforming into infectious cysts during passage from the small intestine to the outside environment. The early events in encystation include the synthesis and export via ESV of three CWPs of 26–44 kDa [6,20–22]. CWPs 1–3 all form extensive intermolecular disulfide bonds that are essential for CW formation and integrity, likely catalyzed by PDIs within the ER and the ESVs. Neither the mechanisms that regulate these events nor any physiologic role for TGase in Giardia have been established. Therefore, in the present studies, we tested the hypothesis that TGase activity plays a key role in G. lamblia encystation. Together, our data suggest that TGase activity is important in trophozoite encystation, and bifunctional G. lamblia PDIs catalyze the formation of both disulfide and isopeptide protein crosslinks in vivo as well as in vitro.

2. Materials and methods 2.1. Chemicals All chemicals were purchased from Sigma–Aldrich (St. Louis, MO) unless otherwise noted.

2.2. Trophozoite culture and encystation Trophozoites of G. lamblia strain WB, clone C6 (ATCC #50803), were cultured as described in modified TYI-S33 medium (Keister, 1983). Encystation was as described by Sun et al. [23]. 2.3. Quantification of ε(γ-glutamyl)lysine dipeptide Accurate determination of ε(␥-glutamyl)lysine dipeptides in proteins is based on isopeptide bonds’ characteristic survival of the exhaustive proteolytic digestion used to separate them from the great excess of peptide bonds. Vegetatively growing trophozoites, cells encysting for 21 or 42 h, and water-resistant cysts were washed 2× with cold PBS, then in cold 0.2 M N-ethylmorpholine acetate, pH 8.0. Parasites were concentrated by centrifugation and dried under a vacuum (Jouan; RC10.10; Winchester, VA). Cell pellets were resuspended, extensively proteolytically digested, and HPLC was used to quantify extractable isopeptide content as described by Tarcsa and Fesus [24]. 2.4. Inhibition of G. lamblia encystation Log phase trophozoites of G. lamblia were transferred to encystation media “GS4” in the presence of cystamine (0.5–5 mM final concentration) or Tris–HCl control. After 21 h, the numbers of ESV per parasite were counted microscopically in live cells using Nomarski differential interference contrast optics. Following 42 h encystation, parasites were washed 3× at RT in double distilled water and the number of water-resistant cysts were enumerated using a hemacytometer. 2.5. Northern and Western analyses of cystamine-treated parasites For Northern analyses, total RNA was isolated from control or cystamine-treated vegetative or 21 h encysting cells using Trizol (Invitrogen Corp., Carlsbad, CA) by manufacturer’s protocols. Ten micrograms of each RNA was separated on a denaturing 1.2% agarose gel, transferred to a Zeta-Probe filter (Bio-Rad, Hercules, CA), cross-linked to the filter (GS Gene Linker UV Chamber; Bio-Rad), and was prehybridized in a hybridization buffer containing 50% formamide, 5X SSPE, 5X Denharts, 0.1 ␮g/ml salmon sperm DNA, and 1.0% SDS for 2 h at 42 ◦ C. The Prime-it II kit (Stratagene, La Jolla, CA) was used to make a 32 P-labeled CWP2 probe from a purified plasmid insert containing the CWP2 coding region and the primer 5 GGCGGAATTCTCAGATGTATCGATACGTATCCCTTCTGCGGACAATAGGCTT3 by manufacturers’ instructions. Hybridization of the probe took place in hybridization buffer at 42 ◦ C overnight and filters were washed with 2X SSC/0.2% SDS for 10 min at RT, 2X SSC/0.2% SDS for 30 min at 60 ◦ C, and 0.1X SSC/0.1% SDS for 10 min at

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

RT. Washed filters were exposed to a phosphor-imaging screen overnight and scanned for probe binding on a Storm 860 phosphor-imager (Molecular Dynamics; Amersham Biosciences, Piscataway, NJ). Protein extracts of G. lamblia were prepared from 21 h encysting cultures containing 4 mM cystamine or Tris–HCl (buffer control) for Western analysis as described [8] in the presence of a protease inhibitor cocktail (Complete Mini; Roche, Nutley, NJ). Membranes containing size separated and blotted proteins were probed for 1 h with anti-CWP (monoclonal antibody 8C5 [25]; 1/500 dilution in PBS/0.1% dried milk/0.05% Tween 20), washed 3× over 30 min in PBS, incubated in Zymax HRP-labeled goat anti-mouse (1/10,000 dilution in PBS/0.1% dried milk/0.05% Tween 20; Zymed Laboratories Inc.; South San Francisco, CA), washed 3× over 30 min in PBS, and developed in ECL (Amersham Biosciences). 2.6. Inhibition of TGase activity by cystamine Recombinant gPDIs 1–3 were purified and standard solid-phase microplate TGase assays were performed as described [14]. Briefly, gPDIs (15 ␮g/ml) were incubated in the absence or presence of cystamine (0.1–1.0 mM, final concentration), and the conjugation of the amine donor, 5(biotinamido)pentylamine, into dimethyl casein was measured. Incorporated amino donor was detected using alkaline phosphatase labeled-streptavidin followed by development with p-nitrophenyl phosphate, and absorbencies were read at 405 nm on a microtiter plate reader. 2.7. Immune localization of PDIs during encystation Encysting cells (21 h) were prepared for cryosection electron microscopy as previously described (Sun et al., 2003). Sections were stained with 20 ␮g/ml rabbit polyclonal antiPDI 1–3 [14] followed by 5 nm AU-conjugated donkey antirabbit (Jackson Immunoresearch Laboratories, West Grove, PA) and imaged on a Philips EM 410 TEM electron microscope equipped with a SIS Megaview III digital camera. Live-cell immunofluorescence assays also were employed to confirm the localization of PDI-2 to the cell surface of encysting parasites. Trophozoites or 24 h encysting G. lamblia were concentrated and washed with ice-cold PBS. Cells (5 × 106 ) were incubated in 1.5 ml Eppendorf tubes on ice containing anti-PDI-2 immune antiserum or corresponding pre-immune sera (diluted 1/100 in block: 6% goat serum, 0.5% glycerol, 0.05% BSA, 0.05% fish gelatin, and 0.04% sodium azide in PBS) for 1 h with gentle periodic agitation. Live cells were washed 2× in block, incubated on ice in FITC-labeled donkey anti-rabbit antibody (1/100 in block; Pierce, Rockford, IL) for 1 h, washed 2× with block, and post-fixed in 2% paraformaldehyde for 20 min at RT to facilitate imaging. Following fixation, cells were washed in block, concentrated by centrifugation, and resuspended in 20 ␮l of FluoroGuardTM antifade reagent (Bio-Rad). Each

175

cell preparation was imaged on an E800 Nikon (New York City, NY) research microscope equipped with an EXFO (Vanier, Canada) X-cite fluorescent 120 W metal halide illuminator and imaged with a DMX 1200F Nikon fluorescent sensitive digital camera. 2.8. Statistical analyses Data from cystamine inhibition assays and HPLC analyses were analyzed using ANOVA (Systat, Version 5). Means comparisons were made using Tukey–Kramer’s multiple comparisons test. P-values of <0.05 were considered significantly different.

3. Results and discussion 3.1. The content of isopeptide bonds in G. lamblia changes during differentiation We were able to extract and measure ε(␥-glutamyl)lysine isodipeptide levels in exhaustive proteolytic digests of trophozoites and cells encysting for 21 and 42 h [26]. Vegetatively growing trophozoites contained isodipeptides (Table 1). Moreover, at 21 h, the time of peak levels of CWP transcripts and ESV numbers [10], cells contained at least two-fold more isopeptide bonds (P < 0.001). However, the extractable isopeptide content decreased significantly at 42 h (P < 0.05) and isopeptides were not detected in waterresistant cysts. This suggests that isopeptide bond formation may be important during the first 21 h of encystation. It is quite possible that isopeptides are actually present in water-resistant cysts but that they are in protease-resistant structures and cannot be released by the extensive digestion in the standard purification. The apparent decrease in isodipeptide content in the 42 h encysting cells would be due to the cysts in that mixed population. This is very plausible because cyst walls are highly resistant structures in which ∼37% of the insoluble cyst wall material remaining after treatment with SDS and digestion with amyloglucosidase, papain, DNase, RNase, and proteinase K is protein [27]. On Table 1 Analysis of isopeptide content from G. lamblia Protein source

nmol isopeptide/mg of protein ± S.D.

Trophozoite 21 h encysting 42 h encysting Water-resistant cysts

0.71 1.86 0.33 0.0

± ± ± ±

0.11 0.12∗ 0.10# 0.0#

The expressed values are means of three determinations with standard deviations (S.D.). The 21 h encysting samples had a significantly increased amount of isopeptide bonds compared to vegetative trophozoites. The 42 h and water-resistant cysts had significantly lower amounts of isopeptide bonds compared to trophozoite and 21 h encysting cells. ∗ P < 0.001. # P < 0.05.

176

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

the other hand, if cysts do not contain isodipeptides, this would suggest that either the intact crosslinked proteins or fragments of them are exported or released from the cells into the medium during late encystation. Alternately, the isopeptide bonds might be hydrolyzed within the cells during encystation. In vitro TGase from human red cells and guinea pig liver can hydrolyze synthetic isopeptide bonds [28], although this activity has not been demonstrated in any biological system to date. 3.2. Cystamine inhibits TGase activity of giardial PDIs Earlier, we characterized three giardial PDIs (gPDIs; MW =∼ 50, 26, and 13 kDa) that are highly unusual in having only a single CGHC active site [14]. Each expressed enzyme has two distinct protein crosslinking activities. Each can form or rearrange disulfide bonds and each has substantial calcium-dependent TGase activity that was inhibited by the substrate analog, monodansylcadaverine (results unpublished). We separately incubated purified recombinant gPDI 1–3 with cystamine, a TGase active-site inhibitor, and assessed their TGase activity. With at least 0.5 mM cystamine, we detected a significant inhibition in the ability of gPDI-1 to form isopeptide bonds compared to the cystamine-free control (P < 0.05; Fig. 1). The pattern of inhibition was the same for gPDI-2 (P < 0.05 for 0.5 mM cystamine versus control). However, the TGase activity of PDI-3 was slightly less sensitive as 1 mM cystamine was needed to inhibit significantly (P < 0.01) (data not shown). gPDI-3 may be intrinsically less sensitive to cystamine, or the recombinant protein may be imperfectly folded. Although the giardial PDI TGase activities were inhibited in vitro by cystamine, it is possible that other monofunctional TGases may exist. To date, however, neither others nor we have found any signif-

Fig. 2. Effect of cystamine on G. lamblia encystation-secretory vesicle (ESV) formation. Trophozoites were encysted for 21 h in the absence or presence of cystamine and the numbers of ESV/cell were determined. (A) When cells were exposed to >4 mM cystamine, a significant (∗ P < 0.05) reduction in the number of ESV per trophozoite was observed. We also detected a significant decrease (∗ P < 0.05) in the percentage of cells expressing ESV in the presence of 5 mM of cystamine (B). Data are expressed as the mean number of ESV per trophozoite or percentage of trophozoites containing one or more ESV ± S.D. (N = 3).

icant matches to known TGase ORFs containing traditional TGase active sites in searches of the G. lamblia genome database (http://jbpc.mbl.edu/giardia-html/). We have not expressed PDI 4 and 5 to date. 3.3. Importance of TGase activity for encystation

Fig. 1. The effect of cystamine on TGase activity of gPDI-1. A significant decrease (∗ P < 0.05) in the transfer of the biotin-labeled amino donor, 5(biotinamido)pentylamine, to dimethyl casein by gPDI-1 was observed in the presence of the TGase active-site inhibitor cystamine compared to the gPDI-1 alone. Data are expressed as mean optical densities ± S.D. (N = 3).

During encystation, cystamine inhibited the formation of ESV and mature cysts (Figs. 2 and 3, respectively). This inhibition was not due to a cytotoxic effect of cystamine, since greater than 98% viability was maintained in all experiments. Moreover, trophozoite vegetative growth was not significantly inhibited at these cystamine concentrations (data not shown). We detected a two-fold decrease in the number of ESV per cell beginning at 4 mM of cystamine (P < 0.05 for 4 mM versus control; Fig. 2A). In addition, the number of parasites expressing one or more ESV also

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

Fig. 3. Effect of cystamine on formation of water-resistant cysts. When parasites were allowed to encyst for 42 h in >3 mM of cystamine, a significant reduction (∗ P < 0.05) in the formation of water-resistant cysts was detected. Data are expressed as the mean number of cysts/ml of culture ± S.D. (N = 3).

decreased (Fig. 2B). For example, 41.3% of parasites incubated with 5 mM cystamine had an average of ∼1.5 ESV per cell, while 76% of untreated cells contained an average of 4.1 ESV. Moreover, the number of mature cysts recovered showed a significant inhibition compared to the control (P < 0.05; Fig. 3) with as little as 3 mM of cystamine. Given that cystamine inhibited the ability of parasites to assemble ESV, it is not surprising that the effect on formation of water-resistant cysts, which requires assembly of a functional cyst wall, was greatly amplified, decreasing cyst numbers by >90% (Fig. 3). TGase activity may be needed for a step upstream of or involved in ESV formation that is magnified later in encystation. Concentrations of less than 1 mM cystamine were reported to decrease microfilaria production and mobility of B. malayi [29,30] in minimal culture media. The higher concentration of cystamine needed to inhibit giardial encystation may be due to the complex encystation media which contains 10 mM l-cysteine and possibly other interfering compounds [31,32]. 3.4. Processing of cyst wall proteins may be dependent on TGase activity To address the mechanism of encystation inhibition, we asked whether cystamine affects CWP transcription, translation, and/or processing during encystation. We did not detect any significant changes in the steady state levels of CWP2 mRNA in cells cultured in cystamine compared to the buffer control (Fig. 4A). However, we did detect an alteration in the CWP protein profile. In Western analyses, monoclonal antiCWP recognizes protein bands having relative molecular masses of ∼23.5, 29, 31, 39, and 45 kDa in control encysting cells. In contrast, when cells were encysted in the presence of 4 mM cystamine, the 39 kDa band was slightly reduced, the other lower molecular weight bands were decreased, and the 26 kDa CWP2 band was not detected (Fig. 4B).

177

Fig. 4. Effect of cystamine on cyst wall protein-2 (CWP2) RNA levels and polypeptide processing. (A) G. lamblia RNA isolated from trophozoites (“vegetative”) or 21 h encysting cells in the absence (“control”) or presence of 4 mM cystamine (“+cystamine”) hybridized with CWP2 or BIP (loading control; [38]) probes. The CWP2 probe did not bind to trophozoite RNA but hybridized equally to RNA from both untreated and 21 h encysting cells. (B) Western analysis showed differences in protein processing when parasites were incubated in cystamine (“+cystamine”) compared to the cystamine-free control (“control”). Monoclonal anti-CWP detected a decrease in the expression of proteins having a relative molecular mass of 23.5, 29, and 31 kDa (see solid lines), and an absence of a protein having a molecular mass of 26 kDa (see arrow) when parasites were cultured in cystamine. Size markers (“markers”) are indicated by arrows on the left side of figure in kDa and loading control is shown below (“CWP1”).

The ∼45 kDa band was not changed or slightly increased. Previous studies reported that CWP2 is processed from a 39 kDa precursor to a 26 kDa form, by encystation-specific cysteine protease activity (ESCP) in the lysosome-like peripheral vacuoles (PV) [33], and that the 26 kDa fragment is incorporated into cyst wall [21]. Inhibition of total ESCP activity prevented cleavage of CWP2 and blocked cyst formation. TGase action might be directly or indirectly needed for this processing. Touz et al. [33] proposed that ESCP in the PV compartment must interact with the ESV in order to process the CWP2 cargo. This could entail cytoskeletal or endomembrane rearrangement that requires TGase action. 3.5. PDIs localize to ESV and outer cell surface in encysting cells The notion that gPDIs might be targeted to the ESV and the cell surface where they could participate in cyst wall maturation was suggested by our finding that gPDI-2 has an N-terminal signal peptide and a C-terminal membrane spanning region [14]. gPDIs 1 and 3 have a predicted signal peptide but no KDEL-type ER-retention–retrieval signal suggesting that they may be secreted by a default pathway. In certain mammalian cells, active PDI is specifically se-

178

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

creted, although it has a KDEL signal [34]. In our earlier study, we immunolocalized gPDIs 1–3 in vegetative trophozoites and showed that each enzyme is in the ER and PV [14]. Also, we did not detect staining at the cell surface of vegetative trophozoites in our previous work, which is consistent with our live-cell immuno-staining assays in the current study (data not shown). We now show that during encystation, these PDIs also localize to the ESV; and for

PDI-2, increased amounts appear on the outer cell surface (Fig. 5). Finding this bifunctional enzyme on the surface of encysting cells and not on trophozoites is further evidence of a novel role for PDIs in encystation. Recent studies showed the importance of disulfide bonding in CWPs for formation and transport of ESVs [11]. Our current localization of three PDIs in the ESVs is consistent with their importance in disulfide crosslinking. This localization is also consistent

Fig. 5. Immune localization of gPDI to ESV and cell surface. The 21 h encysting cells were labeled with polyclonal anti-gPDI 2 (A), anti-gPDI 1 (B), or anti-gPDI 3 (C) followed by goat anti-rabbit gold. gPDIs 1–3 were found in the ESV (A–C). Bars for the immuno EMs represent 0.1 ␮M. Live-cell immunofluorescent assays showed that pre-immune PDI-2 antiserum did not stain encysting trophozoites (D) while immune antiserum to PDI-2 stained the cell surface (E). Bars for immunofluorescent assays represent 10 ␮M. Abbreviations: er, endoplamic reticulum; esv, encystation secretory vesicle; and pv, peripheral vacuole.

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

with our finding that isopeptide crosslinking by these bifunctional enzymes appear to be important for encystation. Studies such as these greatly increase our understanding of the formation of the cyst wall, which is required for giardial survival in the environment and ability to infect a new host. Many other parasites differentiate within the human intestinal tract [35,36] by pathways that are poorly understood [37]. Therefore, our findings and approaches may generate important hypotheses to investigate differentiation of other parasites, whose life cycles have not been completed in vitro including Entamoeba, Cryptosporidium, Microsporidia, Cyclospora, and Toxoplasma. Drugs that interfere with cyst wall formation would interrupt transmission of disease. In the “post-genomic era”, the next forefront is understanding the assembly of supramolecular structures. The giardial cyst wall provides a valuable model for studies of the evolution of assembly pathways and tactics for formation of extracellular matrix in higher eukaryotic organisms.

Acknowledgements We thank Dr. Gaetan Faubert for providing the monoclonal antibody to CWP. We are grateful to Larry Ocanas and Noemi Kedei for technical assistance. This work was funded by NIH grants 5T32DK0720223, GM61896, GM63792, AI51687, AI42488, and DK35108.

References [1] Chandrashekar R, Mehta K. Transglutaminase-catalyzed reactions in the growth, maturation and development of parasitic nematodes. Parasitol Today 2000;16:11–7. [2] Chen JS, Mehta K. Tissue transglutaminase: an enzyme with a split personality. Int J Biochem Cell Biol 1999;31:817–36. [3] Lorand L, Graham RM. Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 2003;4:140–56. [4] Waffenschmidt S, Kusch T, Woessner JP. A transglutaminase immunologically related to tissue transglutaminase catalyzes crosslinking of cell wall proteins in Chlamydomonas reinhardtii. Plant Physiol 1999;121:1003–15. [5] Aeschlimann D, Thomazy V. Protein crosslinking in assembly and remodelling of extracellular matrices: the role of transglutaminases. Connect Tissue Res 2000;41:1–27. [6] Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev 2001;14:447–75. [7] Meng TC, Hetsko ML, Gillin FD. Inhibition of Giardia lamblia excystation by antibodies against cyst walls and by wheat germ agglutinin. Infect Immun 1996;64:2151–7. [8] Hetsko ML, McCaffery JM, Svard SG, et al. Cellular and transcriptional changes during excystation of Giardia lamblia in vitro. Exp Parasitol 1998;88:172–83. [9] Reiner DS, Douglas H, Gillin FD. Identification and localization of cyst-specific antigens of Giardia lamblia. Infect Immun 1989;57:963– 8. [10] Reiner DS, McCaffery M, Gillin FD. Sorting of cyst wall proteins to a regulated secretory pathway during differentiation of the primitive eukaryote, Giardia lamblia. Eur J Cell Biol 1990;53:142–53.

179

[11] Reiner DS, McCaffery JM, Gillin FD. Reversible interruption of Giardia lamblia cyst wall protein transport in a novel regulated secretory pathway. Cell Microbiol 2001;3:459–72. [12] Chandrashekar R, Tsuji N, Morales T, et al. An ERp60-like protein from the filarial parasite Dirofilaria immitis has both transglutaminase and protein disulfide isomerase activity. Proc Natl Acad Sci USA 1998;95:531–6. [13] Natsuka S, Takubo R, Seki R, Ikura K. Molecular cloning and expression of Caenorhabditis elegans ERp57-homologue with transglutaminase activity. J Biochem (Tokyo) 2001;130:731–5. [14] Knodler LA, Noiva R, Mehta K, et al. Novel protein-disulfide isomerases from the early-diverging protist Giardia lamblia. J Biol Chem 1999;274:29805–11. [15] McArthur AG, Knodler LA, Silberman JD, et al. The evolutionary origins of eukaryotic protein disulfide isomerase domains: new evidence from the amitochondriate protist Giardia lamblia. Mol Biol Evol 2001;18:1455–63. [16] Blasko B, Madi A, Fesus L. Thioredoxin motif of Caenorhabditis elegans PDI-3 provides Cys and His catalytic residues for transglutaminase activity. Biochem Biophys Res Commun 2003;303:1142–7. [17] Okudo H, Kito M, Moriyama T, et al. Transglutaminase activity of human ER-60. Biosci Biotechnol Biochem 2002;66:1423–6. [18] Mehta K, Chandrashekar R, Rao UR. Transglutaminase-catalyzed incorporation of host proteins in Brugia malayi microfilariae. Mol Biochem Parasitol 1996;76:105–14. [19] Adini A, Krugliak M, Ginsburg H, et al. Transglutaminase in Plasmodium parasites: activity and putative role in oocysts and blood stages. Mol Biochem Parasitol 2001;117:161–8. [20] Mowatt MR, Lujan HD, Cotten DB, et al. Developmentally regulated expression of a Giardia lamblia cyst wall protein gene. Mol Microbiol 1995;15:955–63. [21] Lujan HD, Mowatt MR, Conrad JT, et al. Identification of a novel Giardia lamblia cyst wall protein with leucine-rich repeats. Implications for secretory granule formation and protein assembly into the cyst wall. J Biol Chem 1995;270:29307–13. [22] Sun CH, McCaffery JM, Reiner DS, Gillin FD. Mining the Giardia lamblia genome for new cyst wall proteins. J Biol Chem 2003;278:21701–8. [23] Sun CH, Palm D, McArthur AG, et al. A novel Myb-related protein involved in transcriptional activation of encystation genes in Giardia lamblia. Mol Microbiol 2002;46:971–84. [24] Tarcsa E, Fesus L. Determination of epsilon (gamma-glutamyl)lysine crosslink in proteins using phenylisothiocyanate derivatization and high-pressure liquid chromatographic separation. Anal Biochem 1990;186:135–40. [25] Campbell JD, Faubert GM. Recognition of Giardia lamblia cystspecific antigens by monoclonal antibodies. Parasite Immunol 1994;16:211–9. [26] Mehta K, Rao UR, Vickery AC, Fesus L. Identification of a novel transglutaminase from the filarial parasite Brugia malayi and its role in growth and development. Mol Biochem Parasitol 1992;53:1–15. [27] Gerwig GJ, van Kuik JA, Leeflang BR, et al. The Giardia intestinalis filamentous cyst wall contains a novel beta(1-3)-N-acetyl-dgalactosamine polymer: a structural and conformational study. Glycobiology 2002;12:499–505. [28] Parameswaran KN, Cheng XF, Chen EC, et al. Hydrolysis of gamma:epsilon isopeptides by cytosolic transglutaminases and by coagulation factor XIIIa. J Biol Chem 1997;272:10311–7. [29] Mehta K, Rao UR, Vickery AC, Birckbichler PJ. Significance of transglutaminase-catalyzed reactions in growth and development of filarial parasite, Brugia malayi. Biochem Biophys Res Commun 1990;173:1051–7. [30] Rao UR, Mehta K, Subrahmanyam D, Vickery AC. Brugia malayi and Acanthocheilonema viteae: antifilarial activity of transglutaminase inhibitors in vitro. Antimicrob Agents Chemother 1991;35:2219–24. [31] Keister DB. Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 1983;77:487–8.

180

B.J. Davids et al. / Molecular & Biochemical Parasitology 136 (2004) 173–180

[32] Diamond LS, Harlow D, Cunnick CC. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg 1978;77:431–2. [33] Touz MC, Nores MJ, Slavin I, et al. The activity of a developmentally regulated cysteine proteinase is required for cyst wall formation in the primitive eukaryote Giardia lamblia. J Biol Chem 2002;277:8474– 81. [34] Jiang XM, Fitzgerald M, Grant CM, Hogg PJ. Redox control of exofacial protein thiols/disulfides by protein disulfide isomerase. J Biol Chem 1999;274:2416–23.

[35] Despommier DD, Karapelou JW. Paraiste life cycles. New York: Springer-Verlag; 1987, pp. 3–39. [36] Frisardi M, Ghosh SK, Field J, et al. The most abundant glycoprotein of amebic cyst walls (Jacob) is a lectin with five Cys-rich, chitinbinding domains. Infect Immun 2000;68:4217–24. [37] Eichinger D. Encystation in parasitic protozoa. Curr Opin Microbiol 2001;4:421–6. [38] Lujan HD, Mowatt MR, Conrad JT, Nash TE. Increased expression of the molecular chaperone BiP/GRP78 during the differentiation of a primitive eukaryote. Biol Cell 1996;86:11–8.