Depletion of bovine CD8+ T cells with chCC63, a chimaeric mouse-bovine antibody

Veterinary Immunology and Immunopathology 71 (1999) 215±231

Depletion of bovine CD8‡ T cells with chCC63, a chimaeric mouse-bovine antibody Catriona J. Brucea,1, Chris J. Howarda, Lewis H. Thomasa, Philip R. Tempestb,2, Geraldine Taylora,* a

Institute for Animal Health, Compton, Newbury, Berks RG20 7NN, UK b Scotgen Biopharmaceuticals, Aberdeen, UK

Received 2 March 1999; received in revised form 13 July 1999; accepted 21 July 1999

Abstract In order to investigate the role of T cells in immune responses to infectious pathogens, depletion of individual T cell subsets using monoclonal antibodies (mAbs) is commonly undertaken. Since most mAbs are of murine origin, such depletion studies in cattle are restricted by the bovine antimouse antibody (BAMA) response to the mouse mAbs used for the depletions. In this study, we describe the use of antibody engineering to overcome the BAMA response. The variable region cDNA from CC63, a monoclonal mouse anti-bovine CD8 antibody, has been expressed in conjunction with bovine constant region genes to produce a mouse-bovine chimaeric antibody (chCC63). Characterisation of chCC63 showed that the antibody contained a bovine constant region and specifically bound bovine CD8‡ T cells. Furthermore, chCC63 blocked the binding of the original mouse antibody, CC63, and mediated complement-dependent lysis of bovine CD8‡ cells in vitro. In vivo, chCC63 depleted calves of CD8‡ T cells as effectively as CC63 and provoked a BAMA response that was about one-tenth of that seen with the mouse antibody. # 1999 Elsevier Science B.V. All rights reserved. Keywords: CD8‡ T cells; Chimeric antibody; T cell depletion; Bovine

* Corresponding author. Tel.: ‡44-1635-578411; fax: ‡44-1635-577263 E-mail address: [email protected] (G. Taylor) 1 Present address. Division of Immunology and Cell Biology, The John Curtin School for Medical Research, The Australian National University, P.O. Box 334, Canberra, ACT 2601, Australia 2 Present address. Cambridge Antibody Technology Ltd., The Science Park, Melbourn, Cambridgeshire SG8 6JJ, UK

0165-2427/99/$ ± see front matter # 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 2 4 2 7 ( 9 9 ) 0 0 0 9 8 - 7

216

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

1. Introduction The role of T cells in resistance to infectious pathogens has been studied extensively in small animal models using adoptive transfer of lymphocytes or depletion of lymphocyte subsets. However, the relevance of such studies to the natural host is often unclear. This is exemplified by respiratory syncytial viruses (RSV), important causes of human and bovine respiratory disease with a similar epidemiology and pathogenesis (Stott and Taylor, 1985). Studies of RSV in a BALB/c mouse model have shown that although T cells are important in recovery from infection, they also contribute to the pathogenesis of disease (Graham et al., 1991; Alwan et al., 1992). Thus, prolonged RSV infection in mice depleted of both CD4‡ and CD8‡ T cells was associated with the absence of lung lesions (Graham et al., 1991). In contrast RSV respiratory disease in immunocompromised humans is severe and often fatal (Hall et al., 1986). Studies in calves selectively depleted of CD8‡, CD4‡ and WC1‡ g/d T cells using monoclonal antibodies (mAbs) (Howard et al., 1991a; Howard et al., 1991b) showed that CD8‡ T cells were important in recovery from BRSV infection (Taylor et al., 1995). Furthermore, the prolonged BRSV infection in calves depleted of CD8‡ T cells was associated with a more extensive pneumonia than that in control calves, with similar histopathology to that seen in immunocompromised humans infected with HRSV (Hall et al., 1986). Another example of a lack of correlation between a rodent model and a natural host has been seen with Trypanosoma congolese infections, where CD8‡ T cells appear to play a role in promoting parasitic infection in mice but not in cattle (Sileghem and Naessens, 1995). Murine mAbs specific for bovine T cell subsets have been used to investigate the role of T cells to other bovine pathogens (Howard et al., 1992; Oldham et al., 1993). However, the use of the mAbs to deplete T cells in cattle has been restricted by the bovine antimouse antibody (BAMA) response, evident within 10±14 days of initial administration of the mAb (Howard et al., 1989). In humans, a similar situation has been observed in which the use of mouse mAbs for therapy has led to a human anti-mouse antibody (HAMA) response (Shawler et al., 1985). In one example, a HAMA response occurred in 75% of patients, despite intense immunosuppression (Jaffers et al., 1986). Although the HAMA response may be directed against any part of the mouse antibody molecule, it is primarily focused against the constant regions (BruÈggemann et al., 1989). The HAMA response has been overcome, to some extent, by the use of recombinant DNA technology to produce chimaeric mouse-human antibody constructs comprising murine V regions and human C regions. In clinical trials in humans, the degree of HAMA response to these chimaeric antibodies varied, but was lower than that provoked by the equivalent murine mAbs (Adair, 1992). Further reduction of immunogenicity of recombinant mouse-human antibodies has been achieved by the use of humanized antibodies. In this approach only the complementarity-determining regions (CDRs) of the original mouse antibody remain, together with residues that are required to maintain antibody binding (Jones et al., 1986). In order to define further the role of individual T cell subsets in the immune response to pathogens in cattle, mAbs that do not provoke a BAMA response are needed. In this paper we describe the construction and characterisation of chCC63, a chimaeric mousebovine anti-bovine CD8 antibody. This antibody is based on the mouse anti-bovine CD8 mAb, CC63, which has been used in previous studies in cattle (Howard et al., 1992;

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

217

Oldham et al., 1993; Taylor et al., 1995) and was successfully used to achieve transient depletion of bovine CD8‡ T cells in vivo. 2. Materials and methods 2.1. CC63 variable region sequencing mAb CC63 (MacHugh et al., 1991) is an IgG2a murine antibody with a kappa light chain, which recognises both heterodimeric (a/b) and homodimeric (a/a) forms of bovine CD8. Total RNA was isolated from 107 CC63 hybridoma cells using the Ultraspec RNA Isolation System (Biotecx Laboratories, TX, USA). Heavy and light chain variable region cDNAs were prepared from 5 mg RNA by reverse transcription under the following conditions: 50 mM Tris±HCl pH 7.5, 75 mM KCl, 10 mM DTT, 3 mM MgCl2, 0.5 mM each of dATP, dCTP, dGTP and dTTP, 0.5 mM oligonucleotide and 15 units RNAsin (Promega). This mixture was heated to 708C for 10 min and cooled slowly to 378C then incubated for 1 h with 200 units of MMLV-RT (Promega) at 378. The primers used for cDNA synthesis, PCR and site directed mutagenesis are listed in Table 1. For cDNA synthesis the primers used were CG2AFOR and CK2FOR, based on constant region murine IgG2a and Igk sequences, respectively. The VH and VK cDNAs were amplified using PCR as follows: one-tenth of the reverse transcription reaction was incubated with 10 mM Tris±HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% (w/v) gelatin, 0.1% (v/v) Tween 20, 0.01% (v/v) NP-40, 0.5 mM of each dATP, dCTP, dGTP and dTTP, 0.5 mM of each oligonucleotide, 1.5 mM MgCl2 and 1 unit of Taq DNA polymerase (Gibco). The mixture was subjected to 25 cycles of amplification as follows: 948C for 30 s, 508C for Table 1 Primers used for cDNA synthesis, PCR and site-directed mutagenesis Primer

Oligonucleotide sequence

CG2AFOR CK2FOR VK8BACK B63BACK B63FOR P63BACK P63FOR VH1MFOR 63BSTBACK LJOINFOR LJOINBACK NOPVUFOR NOPVUBACK PUS1002FOR SSPBBACK SSPBFOR XHOBACK XHOFOR

50 GGAAGCTTAGACCGATGGGGCTGTT GTTTTG 50 GGAAGCTTGAAGATGGATACAGTTGGTGCAG 50 GAGAAATTCAGCTGACCCAGTCTC 50 CTGGCACTGGATTCGGCAG TTTCCAG 50 TGGAAACTGCCGAATCCAGTGCCAG 50 GTTCTTCCTGCAATTGAGTTCTGTG 50 CACAGAACTCAATTGCA GGAAGAAC 50 GGAGACCGATGGGGC TGTTTTGGCAGCAGAG 50 GGCAGCAGAGACGGTCACCAGAGTCCCTTGG 50 GGACTTGGGCTGTTTGATTTCTAG 50 CTAGAAATCAAACAGCCCAAGTCC 50 GCGTGACCTCGCAGCAGTAACTGCCTTTCG 50 CGAAAG GCAGTTACTGCTGCGAGGTCACGC 50 CCGAGGGTGGGGATCCAGGGCCCTA 50 CTCCACAGGTGTACACTCCGACATC 50 CTAGTCGGAGTGTACCCATGTGGA 50 CGGTGGAGGCACCAAACTCGAGATCAAACAGCCC 50 GGACTTGGGCTGTTTGATCTCGAGTTTGGTGCCTCCACCG

218

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

30 s and 728C for 1 min. For PCR amplification, the primers used were CG2AFOR, CK2FOR, VH1BACK and VK1BACK (Orlandi et al., 1989). As observed previously, the primer VK1BACK produced a primer-encoded frameshift `slippage' (Orlandi et al., 1989), and was replaced by VK8BACK. The resulting PCR products were cloned into both M13mp18 and M13mp19, and 12 clones were sequenced in both orientations, giving identical sequences (EMBL accession numbers are CC63 VH cDNA YO8731 and CC63 Vk cDNA YO10154). Using sequence comparisons, the mouse VH region was 76% identical to the closest known bovine VH region sequence (Clone No. 17) (Sinclair and Aitken, 1995), and the mouse Vk region was 59% identical to the closest known bovine Vl region sequence (mAb B12) (Armour et al., 1995). The CC63 VH cDNA showed two internal PstI sites and one internal BamHI site. Since these sites were required for further cloning, they were removed from the VH cDNA by PCR overlap extension mutagenesis, using the PCR conditions described above with the primers B63BACK and B63FOR to remove the BamHI site, P63BACK and P63FOR to remove the first PstI site and VH1MFOR to remove the second PstI site. This strategy gave silent mutations at the amino acid level, which was confirmed by cloning and sequencing the final PCR product. 2.2. Construction of chCC63 expression vectors In order to produce a chimaeric antibody composed of murine V regions from Mab CC63 linked to bovine constant regions, the chCC63 heavy chain expression vector, pSV2gpt
CC63VH
boIgG1 (Fig. 1) and the ChCC63 light chain expression vector pSV2neo
. CC63Vk
boCl (Fig. 1) were produced. The chCC63 heavy chain expression vector was based on the vector aLys-30 (Dr. J. Foote, unpublished, Medical Research Council Laboratory of Molecular Biology, Cambridge, UK). The mutated CC63 VH cDNA, prepared as above, was further mutated by PCR to include a 30 BstEII site using the primer 63BSTBACK, cloned into M13-VHPCR1 (Orlandi et al., 1989) as a PstIBstEII fragment and sequenced. The CC63 VH region was subsequently subcloned from this vector as a HindIII-BamHI fragment, in conjunction with upstream immunoglobulin promoter and signal sequences, into aLys-30, downstream of the immunoglobulin enhancer, from which the human constant region genes had been removed by prior digestion with BamHI. A bovine IgG1 genomic constant region gene (Symons et al., 1989) was cloned downstream of the CC63 VH region gene, as a BamHI fragment, with its orientation determined by sequencing. The chCC63 light chain expression vector was based on the vector aLys-17 (Dr. J. Foote, unpublished). The CC63 Vk cDNA was linked to a bovine Cl cDNA (Jackson et al., 1992) using PCR and simultaneously removing a PvuII site from the bovine Cl cDNA and introducing a 30 BamHI site for further cloning. The primers used for these reactions, were LJOINFOR and LJOINBACK to join the two cDNAs, NOPVUFOR and NOPVUBACK to remove the PvuII site and PUS1002FOR to introduce the 30 BamHI site. The CC63Vk-boCl PCR construct was cloned as a PvuII-BamHI fragment into M13-VKPCR1 (Orlandi et al., 1989) and sequenced. The unique restriction site SspBI was introduced into the immunoglobulin signal sequence just upstream of the CC63Vk region, and the site XhoI was introduced just before the CC63Vk-boCl junction by PCR to facilitate future cloning of murine V regions into the final expression vector. The

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

219

Fig. 1. Expression vectors. These expression vectors were co-expressed to produce chCC63. E, P and S represent immunoglobulin enhancer, promoter and signal sequences, respectively. A represents the SV40 poly A site.

primers used, giving silent mutations at the amino acid level, were SSPBBACK and SSPBFOR to introduce the SspBI site, and XHOBACK and XHOFOR to introduce the XhoI site. The vector pSV2neo
was prepared by removing the unique HindIII site by digesting with HindIII, filling in the overhanging ends with the Klenow fragment of DNA polymerase I (Promega) and ligating the subsequent blunt ends, giving an NheI site. The immunoglobulin enhancer and human Vk DNA from the vector aLys-17 were subcloned into the modified pSV2neo as a PvuI-BamHI fragment, giving pSV2neo
. The CC63VkboCl-M13VKPCR1 PCR product was assembled as a whole and cloned as a HindIIIBamHI fragment, containing upstream immunoglobulin promoter and signal sequences, into pSV2neo
, replacing the human Vk DNA and giving the final chCC63 light chain expression vector. Both expression vectors were sequenced in both orientations through the cDNA regions prior to use for expression. 2.3. Mammalian cell lines Mammalian cells were propagated in RPMI 1640 medium containing 10% fetal bovine serum (FBS) at 378C, in 5% CO2 in humidified air, at cell densities of between 105 and

220

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

106 cells per ml in static culture, or at higher cell densities in the Miniperm (Heraeus) or Tecnomouse (Integra Biosciences) hollow fibre systems for large scale growth of hybridomas, as appropriate. The cell lines used were chCC63 (as described below), CC63 hybridoma (MacHugh et al., 1991) (ECACC No: 91080603), NS0 mouse myeloma (Galfre and Milstein, 1981) (ECACC No: 85110503), L-929 mouse fibroblasts (ECACC No: 85011425) and IL4.4 cells (MacHugh et al., 1991) (transfected L-929 cells expressing the bovine CD8 a chain). Cell lines and sera were free from mycoplasmas, as detected using Hoechst reagents, and free from BVDV, as detected by immunofluorescence using polyclonal anti-BVDV serum. chCC63 cells were continuously grown in selective medium containing 0.008% (w/v) mycophenolic acid and 0.25% (w/v) xanthine. IL 44 cells were continuously grown in selective medium containing 0.1 mM hypoxanthine, 16 mM thymidine and 0.04 mM aminopterin. 2.4. chCC63 expression The expression vectors pSV2neo

CC63Vk
boCl and pSV2gpt
CC63VH
boIgG1 were linearised by digestion with PvuI and 20 mg of each were co-transfected into 107 NS0 cells growing in log phase by electroporation using two pulses of 1.5 kV, 3 mF (GenePulser, BioRad) in 4 mm wide foil-lined electroporation cuvettes (BioRad). The cells were allowed to recover for 24 h in non-selective medium, after which they were distributed into ten 96-well plates in 200 ml of gpt-selective medium per well. After 8±10 days, growing colonies were seen in 80% of the wells. Supernatants were screened by flow cytometry for binding to IL4.4 cells, and cells from the three wells that gave the highest fluorescence intensity were cloned by limiting dilution and screened again by flow cytometry. The clone that expressed chCC63 at the highest level was chosen for expansion. Some of these cells were grown to saturation in medium with FBS depleted of bovine IgG1 using protein-G sepharose chromatography, producing 1±2 mg of chCC63 per ml in static culture, as determined by ELISA. Twenty mg/ml of chCC63 was produced in Miniperm (Heraeus) cultures and 40 mg/ml was produced in Tecnomouse (Integra Biosciences) hollow-fibre cultures. However, cell growth was not sustained in this media following passage. Despite excellent growth of cells in medium containing horse serum (HS), chCC63 expression was undetectable in the presence of even minute amounts of HS and this effect was not reversed by continued passage in HS. However, chCC63 expression was resumed whenever the cells were washed thoroughly and cultured in FBS. Therefore, to produce antibody for treatment of calves, cells were grown in medium containing 10% FBS. Quantification of purified chCC63 was achieved, prior to its use in vivo, by flow cytometry with a titration against known concentrations of CC63 determined by radial immunodiffusion assay kit (The Binding Site, Birmingham, UK). 2.5. mAbs The following mouse mAbs were used: B37 (anti-bovine IgG1; Veterinary School, University of Bristol); BG-18 (anti-bovine IgG1, Sigma); TRT1 (IgG1) and TRT3 (IgG2a) (anti-turkey rhinotracheitis virus), AV55 (IgG2a) and AV56 (IgG2a) (anti-avian

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

221

thymocyte, Dr. T.F. Davison, Institiute for Animal Health, Compton, UK) and AV29 (IgG2b) (anti-avian CD4 from Dr. T.F. Davison) were used as isotype-matched control antibodies; CC1 (IgG1) (anti-bovine CD45) (Howard and Naessens, 1993); CC8 (IgG2a), CC26 (IgG2) and CC30 (IgG1) (anti-bovine CD4) (Howard et al., 1989; Morrison et al., 1994); CC58 (IgG1) (anti-bovine CD8 a/b) (MacHugh et al., 1991);CC63 (IgG2a) (antibovine CD8 a/b and a/a chain) (MacHugh et al., 1991); 38±65 (IgG2a) (anti-bovine CD8) (Howard and Naessens, 1993); IL-A65 (IgG2a) and CC21 (IgG1) (anti-bovine CD21) (Howard and Naessens, 1993); CCG33 (IgG1) (anti-bovine CD14) (Sopp et al., 1996); CC15 (IgG2a) (anti-bovine WC1) (Howard et al., 1989); GB21A (IgG2b) (antibovine g/d TCR) (Davis et al., 1996) and bovine mAb B4 (IgG1) (anti-RSV) (Kennedy et al., 1988). When required, mAbs were purified using a MAbTrap G kit, with a Protein G Sepharose 4 FF column (Pharmacia), dialysed overnight against phosphate buffered saline (PBS) and filter sterilised. 2.6. Animals and experimental design Six conventionally-reared Channel Islands calves aged between 6 and 13 days were inoculated intravenously with 100 mg of the nonsteroidal anti-inflammatory drug Flunixin megulimine (Finadyne, Schering-Plough Animal Health) on Day 0 only and with 4 mg of mAb on each of Days 0, 1 and 2. Flunixin megulimine, which is active for only 24±36 h, was used to reduce the occasional adverse reaction observed in some calves following the first inoculation with anti-CD8 mAb. Two calves (1073 and 1074) were inoculated with murine CC63, two calves (1075 and 1076) were inoculated with chCC63 and two calves (1077 and 1078) were inoculated with a mixture of AV55 and AV56, as an irrelevant mouse IgG2a antibody control group. During the course of the experiment, both heparinised blood and sera were taken from each calf daily from Day 1 to Day 8 and every 2±3 days, thereafter, until the end of the experiment at Day 42. 2.7. Preparation of mononuclear cells from blood Peripheral blood mononuclear cells (PBMC) were isolated from heparinised blood by centrifugation at 1200g for 40 min at 208C over Histopaque 1083 (Sigma) as described previously (Taylor et al., 1995). 2.8. Flow cytometry PBMC were stained with mAbs as described previously (Howard et al., 1989), except that fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated anti-mouse or anti-bovine antibodies (Sigma) were used. Alternatively, biotinylated-BG18 (Sigma), a mouse anti-bovine IgG1 antibody was used, and after washing, was detected using PE conjugated to streptavidin (Sigma). When necessary, dead cells were stained with propidium iodide. Cells were analysed using a fluorescence-activated cell scanner (FACScan, Becton Dickinson) with PC-LYSIS II (Becton Dickinson) and WIN-MDI Version 2.1.3 software (Joseph Trotter, The Scripps Research Institute).

222

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

2.9. ELISA Bovine IgG1 concentrations were determined in supernatants from chCC63 cells grown in medium containing FBS depleted of bovine IgG, by a capture ELISA using purified mAb B37 to coat the plates and biotinylated BG18 to detect bound bovine IgG1, followed by streptavidin-horseradish peroxidase (SA-HRP) (Sigma) and 3,30 ,5,50 ,tetramethylbenzidine (TMB) (ICN Immunobiologicals). Between each step, plates were washed 3±4 times with PBSa containing 0.05% (v/v) Tween-20 (PBS-T). PBS-T with 5% (v/v) pig serum was used as a blocking agent. A known concentration of purified mAb B4 was used as a standard. The BAMA response was measured employing a similar ELISA protocol using purified mAb CC63 to coat the plates and HRPconjugated rabbit anti-bovine antibody (Serotec) for detection. The optical density (OD) values at both 450 and 690 nm were read for each well on a Titertek Multiscan MCC340 plate reader at dual wavelength. BAMA ELISA titres were calculated by plotting the OD against log10 sample dilution. Regression analysis of the linear part of this curve allowed calculation of the endpoint titre with an OD of 1.5 times the background. 2.10. In vitro complement-mediated cell lysis 1  107 bovine PBMC were incubated at 48C for 30 min with 5 mg of the test antibody or of isotype-matched control antibodies, in RPMI containing 2% (v/v) FBS. The cells were washed three times with pre-warmed RPMI, containing no FBS, and rolled at 37oC for 1 h with RPMI containing a 1 in 10 dilution of rabbit complement (Sigma). Control cells were incubated with complement that had been inactivated by heating at 56oC for 1 h. The cells were then washed three times with ice-cold PBS, 1% (w/v) BSA and stained for flow cytometric analysis. 3. Results 3.1. chCC63 stains bovine CD8‡ T cells chCC63, a recombinant chimaeric antibody composed of mouse variable regions, VH and Vk, from the anti-bovine CD8 mAb CC63 and bovine IgG1 and Igl constant regions, was constructed and expressed in vitro. This chimaeric antibody was used with a panel of mouse anti-bovine antibodies (anti-CD8, anti-CD4, anti-WC1, anti-CD21, anti-CD14) to stain bovine PBMC. chCC63 stained cells that were also recognised by the anti-bovine CD8 antibodies CC63 and 38±65 (Fig. 2C and D), but not by any of the other mAbs tested (data not shown), suggesting that the chimaeric antibody was correctly assembled and retained the antigenic specificity of the original mouse antibody. CD21‡ B cells stained at a low level with the control mAb B4 and biotinylated anti-bovine IgG1 mAb (Fig. 2B). This staining probably represents binding to the FcR on B cells and did not interfere with the analysis of chCC63 binding.

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

223

Fig. 2. Two-colour flow cytometric analysis of chCC63. Binding of murine mAbs to bovine PBM cells was detected with FITC-rabbit anti-mouse IgG2a (x-axes) and binding of bovine mAbs was detected with biotinylated anti-bovine IgG1 followed by PE-streptavidin (y-axes). Bovine mAb B4 is the isotype matched control antibody for chCC63 and mAb TRT3 is the isotype-matched control antibody for the murine antibodies. Staining on the x-axis is as follows: A: TRT3; B: CD21 (mAb ILA-65); C: CD8 (mAb CC63) and D: CD8 (mAb 38-65).

224

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

Fig. 3. Blocking of chCC63 binding to IL4.4 cells by CC63. Binding of chCC63 (grey line) to IL4.4 cells, which express CD8, detected with biotinylated anti-bovine IgG1 followed by PE-streptavidin. Inhibition of binding of chCC63 by mAb CC63 (black line). Filled histogram shows binding of B4, isotype-matched control bovine mAb, to IL4.4 cells.

3.2. Binding of chCC63 to CD8‡ T cells is blocked by CC63 Single colour flow cytometry was used to investigate the ability of chCC63 to block the binding of CC63, and vice versa, when applied sequentially, to IL4.4 cells (Fig. 3) or to bovine PBMC (data not shown). Binding of CC63 to either IL4.4 cells, or to bovine PBMC, was reduced by prior incubation of the cells with chCC63. Similarly, binding of chCC63 to IL4.4 cells was reduced by the prior incubation of these cells with CC63 and the binding of chCC63 to bovine PBM cells was completely blocked by prior incubation of the cells with CC63. Thus, CC63 and chCC63 appear to be binding to the same, or a closely related, epitope on the target cell population. 3.3. CD8‡ T cells are lysed by chCC63 and complement Following incubation with either CC63 or chCC63 and rabbit complement, the proportion of CD8‡ bovine PBMC, as analysed by binding of mAb CC58, was reduced from 9% (in untreated PBMC) to <1% (Fig. 4). Incubation with either complement alone (Fig. 4B), isotype-matched control antibodies, or heat-inactivated complement in conjunction with CC63 or chCC63 had no effect on the proportion of CD8‡ T cells (results not shown). A reduction in CD4‡ cell staining was not observed following treatment with either CC63 or chCC63 and rabbit complement (data not shown). These results indicate that chCC63 and CC63 are equally able to specifically lyse bovine CD8‡ PBMC in the presence of rabbit complement. However, a proportion (2±3%) of PBMC that stained at a low intensity with mAb CC58 were not lysed by either CC63 or chCC63 and rabbit complement (Fig. 4C and D). This low intensity staining is analysed in more detail below. 3.4. Treatment of calves with chCC63 depletes CD8‡ T cells in peripheral blood PBMC from each of two calves treated with chCC63, CC63 or a mixture of two mouse IgG2a control antibodies were stained with mAbs to CD45, CD4, CD8, WC1, CD21 and CD14. The results of CD8 staining are shown in Fig. 5. There was a reduction in the number of CD8‡ T cells in peripheral blood from calves treated with chCC63 or with

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

225

Fig. 4. In vitro complement-mediated cell lysis. Binding of mAb CC58 (anti-CD8) to bovine PBM cells was detected with FITC-anti-mouse IgG1. A: untreated PBMC; B: PBMC and rabbit complement; C: PBMC treated with CC63 and rabbit complement; D: PBMC treated with chCC63 and rabbit complement. M1 shows the percentage of CD8‡ stained cells. M2 shows low-intensity staining of cells.

CC63. In contrast, there were no changes in the numbers of CD8‡ T cell in peripheral blood from control calves. One calf (1074), that was treated with chCC63, had a higher proportion of CD8‡ cells prior to mAb treatment than the other calves (15% compared with 6±8% of total PBMC). This calf showed an incomplete depletion of CD8‡ cells, compared with the other calf in this group (1073). Similarly, only one (1075) of two calves showed complete depletion of CD8‡ cells following treatment with CC63. In all four calves depleted of CD8‡ T cells, CD8‡ T cell numbers had not returned to original levels by the end of the experiment (Day 42). In contrast, there was an increase in CD8‡ cell numbers over time in the control calves. PBMC that expressed low levels of CD8 were not depleted by mAb treatment. Thus, cells from calf 1074 expressing high levels of CD8 decreased from 15 to 4%, 4 days after mAb treatment, whereas cells from this animal that expressed low levels of CD8 remained at 3 to 4% throughout the course of the experiment. Following treatment with mAbs CC63 or chCC63, the number of CD4‡ and WC1‡ T cells together with the number of B cells (CD21‡ cells) and monocytes (CD14‡ cells) accounted for all of the mononuclear cells in the peripheral blood (results not shown). Thus, there was no evidence for the presence of a CD8ÿ T cell population, which would be present if the CD8 molecule was capped following antibody treatment, indicating that the CD8‡ T cells had been removed from the circulation. As seen previously, there were discrepancies in the staining of CD4‡ cells between calves due to polymporphism of bovine CD4 (Morrison et al., 1991). Thus, cells from calves 1073, 1075 and 1078 stained equally well with the panel of anti-CD4 mAbs used (CC8, CC26 and CC30), whereas those from calves 1074 and 1076 did not stain with

226

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

Fig. 5. Effect of mAbs on CD8‡ cells in vivo. Bovine PBM cells were stained with mAb CC58 (anti-CD8) and FITC anti-mouse IgG, to monitor effect of 4 mg doses of mAb administered intravenously to each calf on Days 0, 1 and 2. A: chCC63 treatment of calves 1073 (*) and 1074 (*). B: CC63 treatment of calves 1075 (*) and 1076 (*). C: mouse IgG2a control antibody (AV55/56) treatment of calves 1077 (*) and 1078 (*).

CC8 and those from calf 1077 did not stain with CC26. The percentage of CD21‡ cells increased with time in all groups from 5±10% at Day 0 to 20±30% at Day 42 (data not shown). 3.5. CD8 low cells are g/ d TCR‡ A population of cells was identified, which stained at a low intensity with mAbs to CD8, were not lysed by either CC63 or chCC63 and rabbit complement in vitro, and were not depleted by treatment of calves with these mAbs. Two-colour flow cytometry was used to further characterise the CD8 low population. Cells from each of the calves, at Day 42 after initial mAb treatment, were stained with a panel of mAbs. The CD8 low population co-stained with a mAb specific for the g/d TCR‡. This staining pattern was similar in all six calves and the data from calf 1076, the calf with the highest proportion of CD8 low cells, are shown in Fig. 6. CD8 low cells did not stain with mAbs to CD4, CD21 or CD14 (data not shown).

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

227

Fig. 6. CD8‡ low intensity staining cells react with GB21A, an anti-g/d T cell antibody. At Day 42 following CC63 treatment, PBMC from calf 1076 were stained with: A: isotype-matched control antibodies AV29 and AV55; B: AV29 and mAb CC63 (anti-CD8); C: mAb GB21A (anti-g/d TCR) and AV55; or D: mAb CC63 (antiCD8) and mAb GB21A (anti-g/d TCR) followed by PE anti-mouse IgG2b (y-axes) and FITC anti-mouse IgG2a (x-axes).

Fig. 7. BAMA response. Antibodies to CC63 were measured by ELISA in Calves 1073 (*) and 1074 (*) treated with chCC63 (A) and calves 1075 (*) and 1076 (*) treated with CC63 (B).

228

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

3.6. BAMA response The BAMA response to CC63 was determined by ELISA at intervals after mAb treatment (Fig. 7). Although the BAMA response was slower to develop in only one of the chCC63-treated calves when compared with calves treated with CC63, chCC63 provoked a reduced BAMA response. Thus, the mean peak anti-mouse IgG titre in chCC63-treated calves was log10 3.1  0.3 compared with a mean peak titre of log10 4.2  0.1 in CC63-treated calves. Calves treated with control mAbs (AV55/56) did not develop a detectable BAMA response (data not shown). 4. Discussion This study was successful in producing a chimaeric mAb composed of murine heavy and k light chain variable regions linked to bovine g heavy and l light chain constant regions, respectively. The recombinant mouse-bovine antibody, chCC63, retained it's original antigenic specificity and depleted calves of CD8‡ cells as effectively as the parent mAb CC63. Furthermore, the BAMA response was reduced following treatment with chCC63 when compared with CC63. The successful expression of the recombinant chimeric antibody demonstrated that a bovine Cl region could associate with a murine Vk region. Although cattle appear to have both Ck and Cl genes (J. Butler, University of Iowa; B. Osbourne, University of Massachusetts, pers. commun.), and expression of k versus l mRNA is not significantly different (B. Osbourne, University of Massachusetts, pers. commun.), only the Cl gene appears to be expressed at the protein level (Butler, 1986). Other studies have shown that chimeric antibodies can be produced from a combination of k and l light chains, for example a rat Vl region can associate correctly with a human Ck region (Gorman et al., 1991). A population of g/d T cells was identified, which expressed CD8 at a low intensity, and were resistant to complement-mediated depletion using antibodies to CD8, both in vitro and in vivo. CD8‡ g/d T cells were first reported following in vitro culture of mouse thymocytes and express CD8 as an a chain homodimer (MacDonald et al., 1990; Leclercq et al., 1991). However, the CD8 low g/d T cells reported in this study express heterodimeric CD8 as mAb CC58 is specific for either the b chain or a determinant generated by the association of both chains of the CD8 molecule (MacHugh et al., 1993). It has been reported previously that there is a small number of bovine g/d T cells in peripheral blood and large numbers in the spleen and intestine that are WC1ÿ, some of which express CD2 together with CD8 (MacHugh et al., 1997). It is possible that low density of CD8 expression makes the cells less sensitive to antibody-dependent complement-mediated lysis. Although chCC63 appeared to be less immunogenic than the original murine antibody, it provoked a significant BAMA response. In order to reduce the immunogenicity of chCC63 further, it may be necessary to graft the mouse CDR regions onto bovine variable framework regions, using homology matching, followed by ordered replacement of framework residues to improve any binding affinity lost as a result of this process (Jones et al., 1986; Tempest et al., 1991). Another approach to engineering antibodies is known

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

229

as `resurfacing' (Roguska et al., 1994) which does not lead to a loss of affinity as observed in CDR-grafted antibodies (Roguska et al., 1996). In this approach, most of the antibody remains of murine origin, with only the surface-accessible amino acid residues being replaced by bovine residues. However, the immunogenicity of resurfaced antibodies has not been evaluated in vivo. Furthermore, since the murine CC63 VH framework regions are over 70% identical to three different known bovine VH regions, `bovinisation' may not reduce immunogenicity greatly. In conclusion, a chimaeric antibody, specific for bovine CD8‡ T cells, which is composed of mouse variable regions and bovine constant regions, has been produced that was as effective at depleting calves of CD8‡ T cells as the original mouse antibody. Although the chimaeric antibody induced a BAMA response, it was less than that induced by the original mouse antibody. However, the BAMA response may be sufficient to interfere with the prolonged use of chCC63. Although a small population of CD8low cells were not lysed by either chCC63 or CC63, this should not compromise studies to examine the function of CD8‡ a/b T cells as the CD8‡ low cells were shown to g/d T cells.

Acknowledgements This work was funded by the BBSRC and MAFF. We thank Sara Wyld for testing the cell cultures for mycoplasma, Michael Clark for testing for BVDV, Scotgen Biopharmaceuticals Inc., Kathryn Armour (Cambridge University) and Paul Yeo (University of Glasgow) for helpful advice. The vectors M13-VHPCR1, M13-VKPCR1, aLys-17 and aLys30 were supplied by the Medical Research Council Laboratory of Molecular Biology, Cambridge. The bovine IgG1 genomic constant region gene was supplied by Dr. Derek Symons, Institute of Animal Physiology and Genetics Research, Babraham. The bovine Igl constant region cDNA was supplied by Dr. Pete Sanders, University of Surrey.

References Adair, J.R., 1992. Engineering antibodies for therapy. Immunol. Rev. 130, 5±40. Alwan, W.H., Record, F.M., Openshaw, P.J.M., 1992. CD4‡ T-cells clear virus but augment disease in mice infected with respiratory syncytial virus. Comparison with the effects of CD8‡ T-cells. Clin. Exp. Immunol. 88, 527±536. Armour, K.L., Tempest, P.R., Fawcett, P.H., King, S.L., White, P., Taylor, G., Harris, W.J., 1995. Sequences of heavy and light chain variable regions from bovine immunoglobulins. Mol. Immunol. 31, 1369±1372. BruÈggemann, M., Winter, G., Waldmann, H., Neuberger, M.S., 1989. The immunogenicity of chimeric antibodies. J. Exp. Med. 170, 2153±2157. Butler, J.E., 1986. Biochemistry and biology of ruminant immunoglobulins. In: Pandey, R. (Ed.), Veterinary Microbiology: Molecular and Clinical Perspectives. Karger, Basel, pp. 1±53 Davis, W.C., Brown, W.C., Hamilton, M.J., Wyatt, C.R., Orden, J.A., Khalid, A.M., Naessens, J., 1996. Analysis of monoclonal antibodies specific for the gamma delta TcR. Vet. Immunol. Immunopathol. 52, 275± 283. Gorman, S.D., Clark, M.R., Routledge, E.G., Cobbold, S.P., Waldmann, H., 1991. Reshaping a therapeutic CD4 antibody. PNAS 88, 4181±4185.

230

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

Graham, B.S., Bunton, L.A., Wright, P.F., Karzon, D.T., 1991. Role of T-lymphocyte subsets in the pathogenesis of primary infection and rechallenge with respiratory syncytial virus in mice. J. Clin. Inv. 88, 1026± 1033. Hall, C.B., Powell, K.R., MacDonald, N.E., Gala, C.L., Mengus, M.E., Suffin, S.C., Cohen, H.J., 1986. Respiratory syncytial virus infection in children with compromised immune function. N. Eng. J. Med. 315, 77±81. Howard, C.J., Clarke, M.C., Sopp, P., Brownlie, J., 1992. Immunity to bovine virus diarrhoea virus in calves: the role of different T-cell subpopulations analysed by specific depletion in vivo with monoclonal antibodies. Vet. Immunol. Immunopathol. 32, 303±314. Howard, C.J., Morrison, W.I., Bensaid, A., Davis, W., Eskra, L., Gerdes, J., Hadam, M., Hurley, D., Leibold, W., Letesson, J.-J., MacHugh, N., Naessens, J., O'Reilly, K., Parsons, K.R., Schlote, D., Sopp, P., Splitter, G., Wilson, R., 1991a. Summary of workshop findings for leukocyte antigens of cattle. Vet. Immunol. Immunopathol. 27, 21±27. Howard, C.J., Morrison, W.I., Mackay, C.R., Splitter, G.A., 1991b. Leukocyte antigens in cattle, sheep and goats. Vet. Immunol. Immunopathol. 27, 1±276. Howard, C.J., Naessens, J., 1993. General summary of workshop findings for cattle 4.1 Summary of workshop findings for cattle. Vet. Immunol. Immunopathol. 39, 25±48. Howard, C.J., Sopp, P., Parsons, K.R., Finch, J., 1989. In vivo depletion of BoT4 (CD4) and of non-T4/T8 lymphocyte subsets in cattle with monclonal antibodies. Eur. J. Immunol. 19, 757±764. Jackson, T., Morris, B.A., Sanders, P.G., 1992. Nucleotide sequences and expression of cDNAs for a bovine antitestosterone monoclonal IgG1 antibody. Mol. Immunol. 29, 667±676. Jaffers, G.J., Fuller, T.C., Cosimi, A.B., Russell, P.S., Winn, H.J., Colvin, R.B., 1986. Monoclonal antibody therapy: anti-idiotypic and non-anti-idiotypic antibodies to OKT3 arising despite intense immunosuppression. Transplant 41, 572±578. Jones, P.T., Dear, P.H., Foote, J., Neuberger, M.S., Winter, G., 1986. Replacing the complementarity-determining regions in a human antibody with those from a mouse. Nature 321, 522±525. Kennedy, H.E., Jones, B.V., Tucker, E.M., Ford, N.J., Clarke, S.W., Furze, J.M., Thomas, L.H., Stott, E.J., 1988. Production and characterisation of bovine monoclonal antibodies to respiratory syncytial virus. J. Gen. Virol. 69, 3023±3032. Leclercq, G., De Smedt, M., Plum, J., 1991. Interleukin-4 induces CD8 alpha expression on T cell receptor V gamma 5 thymocytes. Eur. J. Immunol. 21, 1751±1754. MacDonald, H.R., Schrayer, M., Howe, R.C., Bron, C., 1990. Selective expression of CD8 alpha (Ly-2) subunit on activated thymic gamma/delta cells. Eur. J. Immunol. 20, 927±930. MacHugh, N.D., Bensaid, A., Howard, C.J., Davis, W.C., Morrison, W.I., 1991. Analysis of the reactivity of anti-bovine CD8 monoclonal antibodies with cloned T cell lines and mouse L-cells transfected with bovine CD8. Vet. Immol. Immunopathol. 27, 167±172. MacHugh, N.D., Mburu, J.K., Carol, M.J., Wyatt, C.R., Orden, J.A., Davis, W.C., 1997. Identification of two distinct subsets of bovine gd T cells with unique cell surface phenotype. Immunology 92, 340±345. MacHugh, N.D., Taracha, E.L., Toye, P.G., 1993. Reactivity of workshop antibodies on L cell and COS cell transfectants expressing bovine CD antigens. Vet. Immunol. Immunopathol. 39, 61±67. Morrison, W.I., Howard, C.J., Hinson, C.A., 1991. Polymorphism of the CD4 and CD5 differentiation antigens in cattle. Vet. Immunol. Immunopathol. 27, 235±238. Morrison, W.I., Howard, C.J., Hinson, C.J., MacHugh, N.D., Sopp, P., 1994. Identification of three distinct forms of bovine CD4. Immunology 83, 589±594. Oldham, G., Bridger, J.C., Howard, C.J., Parsons, K.R., 1993. In vivo role of lymphocyte subpopulations in the control of virus excretion and mucosal antibody responses of cattle infected with rotavirus. J. Virol. 67, 5012±5019. Orlandi, R., GuÈssow, D.H., Jones, P.T., Winter, G., 1989. Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. PNAS 86, 3833±3837. Roguska, M.A., Pedersen, J.T., Henry, A.H., Searle, S.M.J., Roja, C.M., Avery, B., Hofee, M., Cook, S., Lambert, J.M., BlaÈttler, W.A., Rees, A.R., Guild, B.C., 1996. A comparison of two murine monoclonal antibodies humanized by CDR-grafting and variable domain resurfacing. Protein Engineering 9, 895± 904.

C.J. Bruce et al. / Veterinary Immunology and Immunopathology 71 (1999) 215±231

231

Roguska, M.A., Pedersen, J.T., Keddy, C.A., Henry, A.H., Searle, S.M.J., Lambert, J.M., Goldmacher, V.S., Blather, W.A., Rees, A.R., Guild, B.C., 1994. Humanization of murine monoclonal antibodies through variable domain resurfacing. PNAS 91, 969±973. Shawler, D.L., Bartholomew, R.M., Smith, L.M., Dillman, R.O., 1985. Human immune response to multiple injections of murine monoclonal IgG. J. Immunol. 35, 1530±1535. Sileghem, M., Naessens, J., 1995. Are CD8 T cells involved in control of Africian trypanosomiasis in a natural host environment?. Eur. J. Immunol. 25, 1965±1971. Sinclair, M.C., Aitken, R., 1995. PCR strategies for isolation of the 50 end of an immunoglobulin-encoding bovine cDNA. Gene 167, 285±289. Sopp, P., Kwong, L.S., Howard, C.J., 1996. Identification of bovine CD14. Vet. Immunol. Immunopathol. 52, 323±328. Stott, E.J., Taylor, G., 1985. Respiratory syncytial virus: brief review. Arch. Virol. 84, 1±52. Symons, D.M.A., Clarkson, C.A., Beale, D., 1989. Structure of bovine immunoglobulin constant region heavy chain gamma 1 and gamma 2 genes. Mol. Immunol. 26, 841±850. Taylor, G., Thomas, L.H., Wyld, S.G., Furze, J., Sopp, P., Howard, C.J., 1995. Role of T-lymphocyte subsets in recovery from respiratory syncytial virus infection in calves. J. Virol. 69, 6658±6664. Tempest, P.R., Bremner, P., Lambert, M., Taylor, G., Furze, J.M., Carr, F.J., Harris, W.J., 1991. Reshaping a human monoclonal antibody to inhibit human respiratory syncytial virus infection in vivo. Bio/Technology 9, 266±271.