Derivation of familial iPSC lines from three patients with retinitis pigmentosa carrying an autosomal dominant RPE65 mutation (NUIGi027-A, NUIGi028-A, NUIGi029-A)

Journal Pre-proof

Derivation of familial iPSC lines from three patients with retinitis pigmentosa carrying an autosomal dominant RPE65 mutation (NUIGi027-A, NUIGi028-A, NUIGi029-A). Yicheng Ding , Eva Carvalho , Cormac Murphy , Veronica McInerney , Janusz Krawczyk , Timothy O’Brien , Linda Howard , Cai Li , Sanbing Shen PII: DOI: Reference:

S1873-5061(19)30295-8 https://doi.org/10.1016/j.scr.2019.101665 SCR 101665

To appear in:

Stem Cell Research

Received date: Revised date: Accepted date:

7 November 2019 14 November 2019 20 November 2019

Please cite this article as: Yicheng Ding , Eva Carvalho , Cormac Murphy , Veronica McInerney , Janusz Krawczyk , Timothy O’Brien , Linda Howard , Cai Li , Sanbing Shen , Derivation of familial iPSC lines from three patients with retinitis pigmentosa carrying an autosomal dominant RPE65 mutation (NUIGi027-A, NUIGi028-A, NUIGi029-A)., Stem Cell Research (2019), doi: https://doi.org/10.1016/j.scr.2019.101665

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)

Derivation of familial iPSC lines from three patients with retinitis pigmentosa carrying an autosomal dominant RPE65 mutation (NUIGi027-A, NUIGi028-A, NUIGi029-A). Yicheng Ding1, Eva Carvalho1, Cormac Murphy1, Veronica McInerney2, Janusz Krawczyk3, Timothy O’Brien1, Linda Howard1, Cai Li4,*, Sanbing Shen1,5,* Affiliations: 1

Regenerative Medicine Institute, School of Medicine, National University of Ireland (NUI) Galway, Ireland.

2

HRB Clinical Research Facility, National University of Ireland (NUI) Galway, Ireland.

3

Department of Haematology, Galway University Hospital, Ireland.

4

Department of Ophthalmology，Shenzhen University General Hospital，Shenzhen University Clinical Medical Academy，Shenzhen, China.

5

FutureNeuro Research Centre, Royal College of Surgeons in Ireland, Dublin D02, Ireland.

* To whom correspondence should be addressed: Prof.

S.

Shen,

[email protected]

and

[email protected],

Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of Ireland Galway, Upper Newcastle, Galway, Ireland. Tel: +35391494261. [email protected], Department of Ophthalmology, Shenzhen University General Hospital, Shenzhen University Clinical Medical Academy, Shenzhen, China. Tel: +8618682351706.

Abstract: Retinitis Pigmentosa (RP) is an inherited disorder of retinal degeneration with progressive loss of rod and cone photoreceptors. RPE65 is a gene encoding the trans-cis isomerase which is essential for the classical visual cycle. While most RPE65 mutations associated with RP have been reported as autosomal recessive, an Irish c.1430A>G (p.D477G) mutation is the first case reported to cause dominantly inherited RP. In this study, we used the non-integrational Sendai virus to generate induced pluripotent stem cell (iPSC) lines carrying the c.1430A>G (p.D477G) mutation from three familial RP patients.

Resource Table: Unique stem cell lines identifier

NUIGi027-A NUIGi028-A NUIGi029-A Alternative names of stem cell RP001C8 (NUIGi027-A) RP002C12 (NUIGi028-A) lines RP003C12 (NUIGi029-A) Regenerative Medicine Institute, National University of Ireland Institution Galway, H91 TK33 Galway, Ireland Contact information of Sanbing Shen [email protected] distributor Induced pluripotent stem cells (iPSCs) Type of cell lines Human Origin Dermal fibroblasts Cell Source Clonal Clonality CytoTune-iPSC 2.0 Sendai Reprogramming Kit. The Method of reprogramming reprogramming vectors include four Yamanaka factors, OCT4, SOX2, KLF4 and c-MYC. Same disease non-isogenic cell lines Multiline rationale Yes Gene modification

Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval

Hereditary Retinitis Pigmentosa (RP) c.1430A>G of RPE65 gene N/A N/A N/A June 2015 Regenerative Medicine Institute, National University of Ireland Galway The study has been approved by the Ethics Committee of Galway University Hospitals (C.A.750). Patient written informed consent were obtained for skin biopsy procedure.

Resource Utility These rare iPSC lines generated from three autosomal dominant RP patients carrying c.1430A>G RPE65 can be differentiated into different retinal cell types in monolayer and/or 3D organoids [1], which can be used for disease modeling to identify molecular mechanisms of RP and for drug screening, therapeutic and toxicity tests, and gene therapy studies. Resource Details RP is a group of related eye disorders with progressive vision loss and affects one per 4000, approximately 1 million population worldwide [2]. RP is an inherited disorder of retinal degeneration with progressive loss of rod and cone photoreceptors. Patients initially experience night blindness, which becomes apparent in childhood. Later, the disease leads to the loss of vision in the peripheral area. The disease chronically progresses over years/decades to influence the central vision. Most people with RP are legally blind by the age of 40, although they still have some vision. Clinical hallmarks of the RP include visual field loss, optic disc pallor, attenuated blood vessels, bone-spicule deposits and abnormal, diminished or un-recordable electroretinograms (ERG). RPE65 is a 61 kDa protein located in the endoplasmic reticulum (ER) membranes of the retinal pigment epithelium, a layer of cells adjoining with the photoreceptor outer segments. Regeneration of visual chromophore was associated with the visual cycle and defects in the cycle will often cause retinal dystrophy. One of the critical enzymes of the visual cycle is RPE65, which is an isomerase that catalyzes cleavage and isomerization of all-trans-retinyl esters to form 11-cis-retinol [3]. Mutations of RPE65 are largely reported in RP and Leber congenital amaurosis (LCA), and these mutations are almost invariably inherited in a recessive manner. However, the novel form of RP associated with RPE65 is identified as an autosomal dominant RP in the Irish population, and all 25 of the 39 family members carrying the heterozygous

mutation suffer from RP [4]. The mutation in exon 13 of RPE65 (c.1430G>A) alters the Asp at 477 to Gly (D477G). In this study, we report the derivation of 3 rare iPSC lines by expressing four reprogramming factors, OCT4, SOX2, KLF4 and C-MYC using Sendai virus. The iPSCs were derived from three RP family members carrying dominant RPE65 c.1430A>G (p.D477G) mutation (Fig. 1L). Typical embryonic stem cell-like morphology of each iPSC line was showed (Fig. 1A). Pluripotency of the iPSC lines was validated by high levels of alkaline phosphatase activity (Fig. 1B), positive expression of the pluripotency markers OCT4, TRA-1-60, SOX2, TRA-1-81, NANOG and SSEA4 (Fig. 1C-H), and abundant mRNA expression of endogenous OCT4, SOX2 and NANOG genes (Fig. 1O). The differentiation potential of the iPSC lines into three embryonic germ layers was tested by spontaneous differentiation of embryoid bodies with positive expression for endoderm marker α-fetoprotein (AFP), mesoderm maker α-smooth muscle actin (α-SMA), and ectodermal marker βIII-tubulin (TUJ1) (Fig. 1I-K). Whole genome SNP array was carried out and demonstrated the chromosome integrity of iPSCs (Fig. P). The iPSC lines were shown to be free of Sendai reprograming vectors by RT-PCR (Fig. 1M) and free of mycoplasma contamination by PCR (Fig. 1N). The full characterization is summarized in Table 2 and Figure 1. These iPSCs lines carrying RPE65 c.1430A>G (p.D477G) mutation will become valuable resources for investigating RP pathology, molecular mechanisms, and for developing treatment of RP. Materials and Methods Cell culture and reprogramming: Skin fibroblasts were cultured at 37°C, 5% CO2, in the DMEM high glucose (Gibco), supplemented with 10% FBS (Sigma-Aldrich), 1% MEM non-essential amino acids (Gibco) and 1% penicillin-streptomycin. They were reprogrammed using Cytotune™-iPS 2.0 Sendai Reprogramming kit (ThermoFisher Scientific, Cat. A16518) under the manufacturer’s instructions. Single iPSC colonies

were picked up and subsequently cultured on Geltrex™-coated 6-well plates in Essential 8™ medium (Gibco) at 37°C, 5% CO2. iPSCs were passaged by Gentle Cell Dissociation

Reagent

(STEMCELL)

for

generally

15

passage

for

further

characterization (Table 1). Transgene-free confirmation: Total RNA was extracted from iPSCs using RNeasy Mini Kit (Qiagen). SensiFAST cDNA Synthesis Kit (Sigma-Aldrich) was used to reversely transcribe RNA into cDNA. PCR analysis was performed on 1:10 diluted resulting cDNAs using TopTaq® Master Mix (Qiagen) under standard conditions using 5 sets of transgene-specific primers (Table 3). DNA fingerprinting analysis: STR analysis was performed by PCR using six sets of loci-specific primers to confirm the source of iPSC lines (primers listed in Table 3). Pluripotency validation: Alkaline phosphatase staining was performed using Alkaline Phosphatase Staining Kit II (Stemgent). For immunofluorescence staining, iPSCs were fixed in 4% PFA for 20 min, permeabilized with 0.1% Triton X-100 (Sigma) for 15 min, and blocked for 1h in 1% BSA-DPBS. Cells were stained with primary antibodies against OCT4, TRA-1-60, SOX2, TRA-1-81, NANOG or SSEA4 (Table 2) at 4°C overnight.

Alexa Fluor 488- or 555-conjugated secondary antibodies (Cell signaling

Technology) were then applied for 1h at room temperature. Cell nuclei were labeled with Hoechst 33342 (Life Technologies). Cells were imaged using a Confocal Microscope (Olympus FluoView 1000 system). To assess RNA expression level of endogenous pluripotency markers, quantitative RT-PCR was performed with the StepOne Plus Real Time PCR System using Fast SYBR™ Green Master Mix (Applied Biosystems) and specific primers (Table 3). The relative expression levels of OCT4, SOX2 and NANOG from qRT-PCR were adjusted with an internal control (GAPDH) and compared with fibroblast mRNA. Three germ layer differentiation: Embryonic bodies (EB) were formed by scraping iPSC colonies and shaking in uncoated 6-well plates on an orbital shaker at 50 rpm in

a 37°C incubator. EBs were cultured in suspension for 5 days in DMEM/F12 supplemented with 20% FBS, 1% L-Glutamine (200 mM), 1% MEM non-essential amino acids, 1% penicillin-streptomycin and 0.2% β-mercaptoethanol. EBs were collected and plated onto Geltrex-coated 8-well chambers (iBiDi) for 3-4 weeks and stained with antibodies against AFP, α-SMA and TUJ1 (Table 3). Karyotyping: The iPSC lines for molecular karyotype were around passage 20 and they were analyzed with 990k SNP genotyping by Beijing Hyslar Biotech Limited Corporation (Beijing, China). SNP data were analyzed by Axiom Analysis software (Thermo Fisher, USA) which generated B allele plots and LogR ratio, using 95 samples to create an internal control. The molecular karyotyping of fibroblasts and derived iPSC lines were examined by IGV software. The mutation was validated by sequencing of the PCR products containing exons 13 of the RPE65. Mycoplasma detection: The absence of mycoplasma contamination was confirmed by PCR using the MycoSensor PCR Assay Kit (Agilent), following manufacturer’s instructions. Acknowledgments We would like to thank three volunteers for participating in this study. This work was supported by Science Foundation Ireland, Investigator award (13/IA/1787) and FutureNeuro Centre grant (16/RC/3948) to SS, and China Scholarship Council to YD. The authors acknowledge the facilities as well as the scientific and technical assistance of the NCBES Genomics Facility at the NUI Galway, which is funded by NUI Galway and the Irish Government’s Programme for Research in Third Level Institutions, Cycles 4 and 5, National Development Plan 2007-2013. References (Max 5 references)

1. Eiraku M, Takata N, Ishibashi H, Kawada M, Sakakura E, Okuda S, Sekiguchi K, Adachi

T,

Sasai

Y.

Self-organizing

optic-cup

morphogenesis

in

three-dimensional culture. Nature, 472 (2011), pp. 51-56. 2. Hartong D. T., Berson D.T., Dryja T.D. Retinitis pigmentosa. Lancet, 368 (2006), pp. 1795-1809 3. Moiseyev G., Chen Y., Takahashi Y., Wu B.X., Ma J.X. (2005) RPE65 is the isomerohydrolase in the retinoid visual cycle. Proc. Natl. Acad. Sci. U.S.A., 102, 12413–12418 4. Bowne SJ, Humphries MM, Sullivan LS, Kenna PF, Tam LC, Kiang AS, Campbell M, Weinstock GM, Koboldt DC, Ding L, Fulton RS, Sodergren EJ, Allman D, Millington-Ward S, Palfi A, McKee A, Blanton SH, Slifer S, Konidari I, Farrar GJ, Daiger SP, Humphries P. A dominant mutation in RPE65 identified by whole-exome sequencing causes retinitis pigmentosa with choroidal involvement. Eur J Hum Genet. 2011 Oct;19(10):1074-81.

AUTHOR DECLARATION We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us. We confirm that we have given due consideration to the protection of intellectual property associated with this work and that there are no impediments to publication, including the timing of publication, with respect to intellectual property. In so doing we confirm that we have followed the regulations of our institutions concerning intellectual property. We further confirm that any aspect of the work covered in this manuscript that has involved human patients has been conducted with the ethical approval of all relevant bodies and that such approvals are acknowledged within the manuscript.

Table 1: Summary of lines

iPSC line names

Abbreviation in figures

Gender

Age

Ethnicity

Genotype of locus

Disease

NUIGi027-A NUIGi028-A NUIGi029-A

RP001C8 RP002C12 RP003C12

Male Male Male

69 70 70

Caucasian Caucasian Caucasian

c.1430G>A on RPE65 gene c.1430G>A on RPE65 gene c.1430G>A on RPE65 gene

RP RP RP

Table 2: Characterization and validation

Classification Morphology Phenotype

Test Photography Alkaline phosphatase staining Immunocytochemistr y qRT-PCR RT-PCR

Genotype

Single Nucleotide Polymorphism

Identity

Fingerprinting (STR analysis)

Mutation analysis Microbiology and virology Differentiatio n potential

Sanger sequence Mycoplasma Embryonic body formation

Result Normal morphology Positive staining

Data Fig. 1A Fig. 1B

Positive for OCT4, SOX2, NANOG, SSEA4, TRA-1-60 and TRA-1-81. Positive for SOX2, OCT4 and NANOG Negative for Sendai vectors No gross chromosomal alteration by reprogramming detected Tested 6 sites (D1S1656, D3S1358, D5S818, D7S796,D8S1179, D10S1214,and D16S539 ), all matched c.1430G>A on RPE65 gene Detection by PCR, negative alpha-fetoprotein (AFP) for endoderm, alpha smooth muscle actin (α-SMA) for mesoderm, and beta-III tubulin (TUJ1) for ectoderm

Fig. 1C-H

Fig. 1O Fig. 1M Fig. 1P

Fig. 1L Fig. 1N Fig. 1I-K

Table 3: Reagents details

Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Pluripotency Markers Rabbit antiG-OCT4 1:1000 Pluripotency Markers

Company Cat # and RRID Cell Signaling Technology Cat# 2840, RRID:AB_2167691 Cell Signaling Technology Cat# 4746, RRID: AB_2119059 Cell Signaling Technology Cat# 3579, RRID:AB_2195767 Cell Signaling Technology Cat# 2840, RRID:AB_2119060 Cell Signaling Technology Cat# 3580, RRID: AB_2150399 Cell Signaling Technology Cat# 4755, RRID:AB_1264259 Sigma-Aldrich Cat# A8452, RRID:AB_258392 Abcam Cat# ab78078, RRID:AB_2256751 Cell Marque Corp Cat# 202M-96, RRID:AB_1157940 Cell Signaling Technology Cat# 4412, RRID:AB_1904025 Cell Signaling Technology Cat# 4412, RRID:AB_1904022 Cell Signaling Technology Cat# 4412, RRID:AB_1904025 Cell Signaling Technology Cat# 4412, RRID:AB_1904022

1:500

Pluripotency Markers

Mouse anti-TRA-1-60 (IgM) Rabbit anti-SOX2

Pluripotency Markers

Mouse anti-TRA-1-81

1:500

Pluripotency Markers

Rabbit anti-NANOG

1:500

Pluripotency Markers

Mouse anti-SSEA4

1:500

Differentiation Markers

Mouse anti-AFP

1:200

Differentiation Markers

Mouse anti-TUJ1

1:500

Differentiation Markers

Mouse anti-SMA

1:500

Secondary antibodies

AF488 Goat Anti-Rabbit IgG AF555 Goat Anti-Mouse IgG AF488 Goat Anti-Rabbit IgG AF555 Goat Anti-Mouse IgG

1:1000

Target

Forward/Reverse primer (5′-3′) For: GTGCTTTGAGTATATGCAAGTC Rev: TGGTAATCAACAAGACCTGATC For: GGATCACTAGGTGATATCGAGC Rev: ACCAGACAAGAGTTTAAGAGATATGTATC

Secondary antibodies Secondary antibodies Secondary antibodies

1:1000

1:1000 1:1000 1:1000

Primers Mutation sequence

RPE65

Sendai Reprogramming Vector (RT-PCR)

SeV/181 bp

Sendai Reprogramming Vector (RT-PCR)

KOS (KLF4, OCT3/4, SOX2) /528 bp

For: ATGCACCGCTACGACGTGAGCGC Rev: ACCTTGACAATCCTGATGTGG

Sendai Reprogramming Vector (RT-PCR)

KLF4/410 bp

For: TTCCTGCATGCCAGAGGAGCCC Rev: AATGTATCGAAGGTGCTCAA

Sendai Reprogramming

C-MYC/532 bp

For: TAACTGACTAGCAGGCTTGTCG

Rev: TCCACATACAGTCCTGGATGATGATG

Vector (RT-PCR) Pluripotency Markers (qPCR)

NANOG/149bp

For: ATAACCTTGGCTGCCGTCTC Rev: AGCCTCCCAATCCCAAACAA

Pluripotency Markers (qPCR)

OCT4/229bp

For: AACTTCACTGCACTGTACTCCTC Rev: CACCCTTTGTGTTCCCAATTCC

Pluripotency Markers (qPCR)

SOX2/187bp

For: AGACTTCACATGTCCCAGCACT Rev: CGGGTTTTCTCCATGCTGTTTC

House-Keeping Genes (qPCR)

GAPDH/206bp

For: AGGGCTGCTTTTAACTCTGGT Rev: CCCCACTTGATTTTGGAGGGA

STR analysis (PCR)

D1S1656

STR analysis (PCR)

D3S1358

STR analysis (PCR)

D5S818

STR analysis (PCR)

D7S796

STR analysis (PCR)

D8S1179

STR analysis (PCR)

D10S1214

For: GTGTTGCTCAAGGGTCAACT Rev: GAGAAATAGAATCACTAGGGAACC For: ACTGCAGTCCAATCTGGGT Rev: ATGAAATCAACAGAGGCTTGC For: GGGTGATTTTCCTCTTTGGT Rev: TTCCAATCATAGCCACA For: TTTTGGTATTGGCCATCCTA Rev: GAAAGGAACAGAGAGACAGGG For: TTTTTGTATTTCATGTGTACATTCG Rev: TTTTTGTATTTCATGTGTACATTCG For: TGCATAAAATATTGCCCCAAAAC Rev: TTGAAGACCAGTCTGGGAAG

fig. 1