- Email: [email protected]
Derivation of goat embryonic stem cell-like cell lines from in vitro produced parthenogenetic blastocysts
Small Ruminant Research 113 (2013) 145–153
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Derivation of goat embryonic stem cell-like cell lines from in vitro produced parthenogenetic blastocysts Arun Kumar De a,∗∗ , Shweta Garg a , Dinesh Kumar Singhal a , Hrudananda Malik a , Ayan Mukherjee a , Manoj Kumar Jena a , Sudarshan Kumar a , Jai Kumar Kaushik a , Ashok Kumar Mohanty a , Bikash Chandra Das b , Sadhan Bag b , Subrata Kumar Bhanja c , Dhruba Malakar a,∗ a b c
Animal Biotechnology Centre, National Dairy Research Institute, Karnal, Haryana, India Veterinary Physiology and Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly, India Central Avian Research Institute, Izatnagar, Bareilly, India
a r t i c l e
i n f o
Article history: Received 21 March 2012 Received in revised form 1 January 2013 Accepted 16 January 2013 Available online 28 February 2013 Keywords: Parthenogenesis Embryonic stem cell-like cells Blastocysts Goat
a b s t r a c t Parthenogenesis is the biological phenomenon by which embryonic development is initiated without male contribution. Parthenogenesis is a very useful method of derivation of embryonic stem cells (ESCs), which may be an important source of histocompatible cells and tissues for cell therapy. The aim of the present study was to derive and characterize goat embryonic stem cell-like cells from in vitro developed blastocysts following parthenogenetic activation of goat oocytes. Two parthenogenetic embryonic stem cell-like cell (gPESC) lines were established. The gPES cell-like cell colonies showed typical ESC morphology and expressed ESC specific markers such as alkaline phosphatase, Oct-4, Sox2, Nanog, TRA-1-60, SSEA-4 and TRA-1-81. Genetic stability of the cell lines was proven to be preserved via karyotype analysis which showed normal karyotype. In suspension culture in absence of feeder layer and without LIF, the embryonic stem cell-like cells produced embryoid bodies and following prolonged culture differentiated into several types of cells including neuron like, epithelium like and cardiac muscle cells. Cell specific markers were observed all cells expressed positive marker genes. All of these results demonstrated the feasibility to isolate and establish goat parthenogenetic ES cell-like cell lines, which provides an important tool for studying epigenetic effects in ESCs and developmental biology as well as gene targeting to produce genetically modified livestock. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The ES cells have tremendous potential applications, including the application in therapeutic medicine in
∗ Corresponding author. Tel.: +91 9416741839. ∗∗ Corresponding author. Current address: Central Agricultural Research Institute, Port Blair, A & N Islands, India. Tel.: +91 9679515260. E-mail addresses: [email protected] (A.K. De), [email protected] (D. Malakar). 0921-4488/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2013.01.018
human, study of developmental biology, analysis of the characteristics of totipotent cells and gene targeting to produce genetically modified livestock. Parthenogenetic embryonic stem cells are alternative to embryonic stem cells derived from embryos produced by somatic cell nuclear transfer or by in vitro fertilization. Parthenogenesis is the process by which an oocyte develops into an embryo without being fertilized by a spermatozoon. Such embryos lack the potential to develop to full term but they can be used to establish parthenogenetic embryonic stem (PES) cells. Successful generation
146
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
of parthenogenetic stem cell lines have been reported in mouse (Kaufman et al., 1983), non-human primate models (Cibelli et al., 2002; Vrana et al., 2003) and in humans (Revazova et al., 2007; Kim et al., 2007; Mai et al., 2007). Differentiation of PES cells into all three embryonic germ cell lines in vitro has been demonstrated in primates (Hernandez et al., 2003) and differentiation of parthenogenetic stem cells into neuronal cell in vitro was observed in a defined differentiation system in monkey (Cibelli et al., 2002). In this study, we reported the establishment of two goat embryonic stem cell-like cell lines from in vitro produced parthenogenetically activated embryos and subsequent observation of those cells over more than 15 passages. We performed characterization of the pluripotency of the lines by expression study of stem cell specific surface markers alkaline phosphatase, TRA-1-60, SSEA-4 and TRA-1-81 as well as intracellular markers Oct-4, Sox-2 and Nanog. 2. Materials and methods All the present experiments comply with all relevant institutional and national animal welfare guidelines, policies and ethics committee approval. All chemicals and media were purchased from Sigma Chemical Co. (St. Louis, MO, USA), and disposable plastic wares were from Nunc (Roskilde, Denmark) unless specified otherwise.
2.1. In vitro maturation of oocytes In vitro maturation of oocytes was performed according to the methods described by De et al. (2011). Oocytes were aspirated from ovaries collected from local slaughter house by puncturing the visible follicles with an 18-gauge needle in the oocyte collection medium (OCM) containing TCM 199 (HEPES modification), 100 g/ml l-glutamine, 10% FBS (Hyclone, Logan, UT, Cat No. CH30160.02), 50 g/ml gentamicin and 3 mg/ml BSA (Fraction-V). The cumulus-oocyte-complexes (COCs) having ≥3 layers of compact cumulus cells were picked up under stereo zoom microscope for in vitro maturation. COCs were washed 2 times with the maturation medium (De et al., 2011). Four drops of 100 l maturation medium were made in 35 mm Petri dishes and covered with mineral oil. These dishes were placed in the incubator with 5% CO2 in air at 38.5 ◦ C, 1 h prior to use for equilibration. Then 15–16 oocytes were placed in each drop of maturation medium. The Petri dishes were incubated at 38.5 ◦ C under 5% CO2 in air with maximum humidity for 24 h.
2.2. Parthenogenetic activation and embryo culture Matured oocytes with expanded cumulus cells were transferred into micro centrifuge tube containing 0.5 mg/ml hyaluronidase in T2 (T denotes TCM-199 supplemented with 2.0 mM l-glutamine, 0.2 mM sodium pyruvate, 50 g/ml gentamicin and the number denotes percentage of FBS) and incubated for 1 min at 38.5 ◦ C under 5% CO2 in air. Then vortexing was done for 2–3 min. The contents of the tube were transferred to a 35 mm Petri dish containing T2 and completely denuded oocytes were selected and washed twice in fresh T2 for removal of cumulus cells. Chemical activation of the in vitro matured oocytes was done by incubating in T20 medium (T denotes TCM-199 supplemented with 2.0 mM l-glutamine, 0.2 mM sodium pyruvate, 50 g/ml gentamicin and the number denotes percentage of FBS) containing 5 M Calcium ionophore (A23187) for 5 min at 38.5 ◦ C under 5% CO2 in air. Then the oocytes were washed thrice in T20 medium and incubated in T20 medium containing 2 mM 6-Dimethylaminopurine (6-DMAP) at 38.5 ◦ C under 5% CO2 in air for 4 h. The activated oocytes were cultured in embryo development medium (EDM) containing TCM 199 (HEPES modification), 30 g/ml sodium pyruvate, 100 g/ml l-glutamine, 50 g/ml gentamicin, 10 l/ml essential amino acids, 5 l/ml non-essential amino acids, 10 mg/ml BSA (Fraction-V) and 10% FCS under flat culture system (De et al., 2012).
2.3. Embryonic stem cells isolation and culture Embryos developed to blastocyst stage after 7 days of culture and hatched blastocysts were observed after 8 days of culture. For isolation of inner cell masses (ICMs) from blastocysts and hatched blastocysts mechanical isolation was performed. The zona pellucida of blastocysts was removed by treatment of 1% pronase in DPBS (w/v). Then to inhibit further action of pronase, the blastocysts were immediately given 4–5 washing in DPBS. The ICM cells were dissected out with the help of two fine glass needles under zoom stereomicroscope (Olympus SZ 61, Japan) (De et al., 2011). The ICM cells of hatched blastocysts were easily isolated mechanically as they were clearly visible under zoom stereomicroscope. The isolated ICMs were seeded on mitomycin-C (10 g/ml) inactivated goat fetal fibroblast feeder layers in ES cell medium containing DMEM supplemented with 20% FCS, 1000 IU/ml murine leukemia inhibitory factor (mLIF), 1% nonessential amino acids, 0.1 mM -mercaptoethanol, and 2 mM l-glutamine. The medium was changed every 48 h interval and the formation of colony was observed routinely under inverted microscope (Nikon, Japan). The primary colonies were cultured for 5–9 days and the ES cell-like cells were selected, picked up, and replated on new feeder layer cells. When the ES cell-like cells appeared to proliferate stably, the ES cell-like cell colonies were dissociated every 4–5 days by mechanical methods. 2.4. Characterization of goat parthenogenetic ES cell-like cells The putative embryonic stem cell-like cells were characterized by expression study of surface markers like alkaline phosphatase, TRA-1-60, SSEA-4, TRA-1-81 and intracellular markers Oct-4, Sox-2 and Nanog. 2.4.1. Alkaline phosphatase (AP) staining For alkaline phosphatase staining, the medium was removed and the colonies were fixed in 3.7% paraformaldehyde in DPBS for 15 min. Then the fixed colonies were washed 4–5 times with DPBS and incubated in AP substrate solution containing 25 mM Tris–maleate (pH 9.5), 8 mM MgCl2 , 0.4 mg/ml sodium alphanaphthyl phosphate and 1 mg/ml Fast red for 30 min. The cells were washed 2–3 times in DPBS and response of the cells to AP staining was observed under inverted microscope. 2.4.2. Gene expression profile analysis Passage 10 and passage 15 parthenogenetic embryonic stem cell-like cells were used for gene expression studies. Total RNA was isolated from putative goat ES cell colonies according to methods reported by De et al. (2011). Then cDNA was prepared by taking 10 l of the cell lysate using random primers. The PCR cycle included denaturation (94 ◦ C for 2 min) followed by repeated cycles of denaturation (94 ◦ C for 30 s), annealing (for 30 s at temperature 58 ◦ C) and extension (72 ◦ C for 45 s) followed by a final extension (at 72 ◦ C for 10 min). A negative RT reaction (i.e., RT reaction but without MMLV enzyme) was set up. A house keeping marker gene  actin was also amplified at each stage of PCR. The PCR primers used for the study were same as reported by De et al. (2011). Similarly neuron like, epithelium like and cardiac muscle cells specific markers were studied specific primers of respective marker genes. Primer
Sequences
Annealing/cycles
Size
Nestin
AGTGTGAAGGCAAAGATAGC TCTGTCAGGATTGGGATGGG
58/34
245 bp
Keratin CACCCAATCCACCTTCTCCAA GGTCTTGCATGGTCTCCTTCT
58/35
287 bp
2.4.3. Immunofluorescence staining of putative ES cells The expression of surface markers TRA-1-60, SSEA-4 and TRA-1-81 as well as intracellular marker oct-4 was examined by immunofluorescence staining of colonies of goat PES cell-like cells. The ES cell colonies of passage 10 were fixed in 4% paraformaldehyde in DPBS for 30 min, washed 3 times with DPBS and then permeabilized by treatment with 0.1% Triton X-100 in DPBS for 30 min. After thorough washing with DPBS, goat ES cell-like cell colonies were incubated with the blocking solution (4% normal goat serum) for 30 min and then with the primary antibody (Millipore, USA) at a dilution of 1:10–1:20 for 1 h. After washing 3 times with DPBS, ES cell colonies were incubated with the appropriate FITC-labeled secondary antibody goat anti-mouse IgG (Millipore, USA) diluted 1:100–1:200 for
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
147
Table 1 Development of parthenogenetic goat embryos. Oocytes
Cleaved (n) %
Morulae (n) %
Blastocyst (n) %
Hatched blastocyst (n) %
154
75.31 ± 0.842 (116)
42.09 ± 2.57 (65)
17.49 ± 0.95 (27)
6.45 ± 1.187 (10)
Data from 4 trials. 2 h. The goat ES cell colonies were then examined under a fluorescence microscope (Nikon, Tokyo, Japan). 2.5. Karyotyping The cells were subjected to chromosomal analysis according to the method described by Dyban (1983) with slight modifications. Briefly, passage 10 parthenogenetic embryonic stem cell-like cell colonies were incubated in DMEM supplemented with 0.1 mg/ml colcemid at 38.5 ◦ C for 4 h. The cells were then washed, trypsinized and resuspended in hypotonic solution (75 mM KCl) for 30 min at 38.5 ◦ C. They were washed and then fixed in chilled fixative (3:1 methanol/glacial acetic acid) for 30 min at room temperature and centrifuged at 200 × g for 8 min. The pellets were resuspended in 5 ml of ice-chilled fixative for another 10 min and then centrifuged again. The metaphase spreads were prepared by dropping the cells onto ice cold glass slides. Chromosomes were stained with 2% Giemsa for 6 min and observed under oil immersion (1000×) using a compound microscope (Nikon, Microphot-FXA, Japan). 2.6. Evaluation of in vitro differentiation
colonies which were not used to establish ES cell-like cell lines were lost to differentiation. Parthenogenetic embryonic stem (PES) cell-like cells showed stem cell morphology and displayed traits of normal stem cells. The ES cell-like cell colonies were densely packed, flat and had higher nucleus: cytoplasm ratio with prominent nucleus and clear boarder (Fig. 2C and D). These colonies showed expression of AP activity (Fig. 3) and expressed stem cell positive markers TRA-1-81 (Fig. 5A), TRA-1-60 (Fig. 5B), SSEA-4 (Fig. 5C) and Oct4 (Fig. 5D). Expression of important pluripotency related genes was detected by RT-PCR and positive signals for Oct-4, Sox2 and Nanog were observed (Fig. 4A and B). Normal chromosomal profile was observed by karyotype analysis (Fig. 6). Suspension culture of ES cells of passage 13 without mLIF and in the absence of feeder layer resulted in embryoid body (EBs) formation within 3 days (Fig. 7A). These EBs when cultured in 0.1% gelatin coated
For in vitro differentiation, passage 12 goat parthenogenetic ES cell colonies were removed from the feeder layer as small clumps and were transferred to suspension culture dishes containing ES medium without mLIF and in the absence of feeder layer. After 3 days, embryoid bodies were produced and subsequently seeded in a 4-well gelatin (0.1%)-coated tissue culture dish in differentiation medium (ES cell medium without LIF and feeder layer) for spontaneous in vitro differentiation. For directed differentiation of ES cell-like cells to cardiomyocetes, the ES cells were cultured in ES cell medium containing 100 ng/ml Activin-A, 10 ng/ml FGF2 and 100 ng/ml BMP-4. 2.7. Statistical analysis The differences in the number of embryos giving rise to primary cell colony were revealed by Chi-square (2 ) test. A value of P < 0.05 was considered to be statistically significant.
3. Results Cleavage was found after 36–48 h post activation. Morula (Fig. 1A), blastocysts (Fig. 1B) and hatched blastocysts (Fig. 1C and D) were obtained on day 5, day 7 and day 8 post activation respectively. Cleavage percentage was 75.31 ± 0.842% (Mean ± SEM) and blastocyst and hatched blastocyst development rate was 17.49 ± 0.95% and 6.45 ± 1.187% respectively (Table 1). 27 blastocysts and 10 hatched blastocysts were used for isolation of ICMs (Fig. 2A). Primary ES cell-like cell colonies (Fig. 2B) formed after 5 days of seeding of ICMs on feeder layers. Primary colony formation rate was significantly higher when ICMs were isolated from hatched blastocysts (60.00%) than when isolated from blastocysts (40.74%) (Table 2). Confluent layer of PES cell-like cell colonies (Fig. 2C and D) was found after 10 days of culture. The colonies were passaged by mechanical disaggregation method and two parthenogenetic ES cell-like cell lines (gPES-1, gPES-2) were established which maintained their undifferentiated state up to 15th successive passages. The other primary
Fig. 1. Morphology of in vitro produced parthenogenetic goat embryos: (A) Morula stage goat embryo (400×). (B) Blastocysts of goat (200×). (C) Blastocyst just before hatching (400×). (D) Hatched blastocyst of goat (400×). Table 2 Primary colony formation from goat parthenogenetic blastocysts and hatched blastocysts. ICM source
Number of embryos
No of primary ES cell colonies, n (%)
Blastocysts Hatched blastocysts
27 10
11 (40.74%)a 6 (60.00%)b
Data from 4 trials. Values within the same column with different superscripts (a and b) differ significantly (P < 0.05).
148
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 2. Morphology of goat parthenogenetic embryonic stem cell-like cells: (A) ICMs isolated from parthenogenetically activated hatched blastocyst (400×). (B) Attachment of ICMs after 4 days of culture (100×). (C) Parthenogenetic ES cell-like cells after 7 days of culture (200×). (D) Parthenogenetic ES cell-like cells after 10 days of culture (400×).
tissue culture dishes without feeder layer and mLIF spontaneously differentiated into epithelium like and neuron like cells (Fig. 7C and D). Epithelium cells and neuron cells specific marker genes Nestin and Keratin were expressed
respectively during their growth and confirmed by PCR (Fig. 9A and B). When ES cell-like cells were cultured in differentiation medium containing 100 ng/ml Activin-A, 10 ng/ml FGF-2
Fig. 3. Expression of alkaline phosphatase in parthenogenetic ES cell-like cells (200×): (A) On 10th passages. (B) On 15th passages.
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
149
Fig. 4. Expression of intracellular markers Oct-4, Sox-2 and Nanog in parthenogenetic goat embryonic stem cell-like cells: (A) On 10th passages. (B) On 15th passages.
and 100 ng/ml BMP-4 cardiac muscle cells were obtained (Fig. 7B). Expression of a cardiac muscle specific marker cardiac alpha actinin in induced differentiated cardiac muscle cells (Fig. 8) was confirmed by PCR.
4. Discussion Two goat parthenogenetic stem cell-like cell lines were successfully derived from parthenogenetic blastocysts.
Fig. 5. Immunofluorescence staining of goat parthenogenetic ES cell-like cells: (A) TRA-1-81. (B) TRA-1-60. (C) SSEA-4. (D) Oct-4.
150
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 6. Chromosomal profile of goat parthenogenetic ES cell-like cells: (A) Normal no. of metaphase chromosome in passage 8 parthenogenetic ES cell-like cells (1000×). (B) Normal karyotyping.
After chemical activation, 27 out of 154 oocytes developed into blastocysts and among 27 blastocysts 10 hatched. The primary colony formation was 60.00% when ICMs were isolated from hatched blastocysts and 40.74% when ICMs
were isolated from blastocysts (Table 2). Primary colony formation was higher from hatched blastocysts because the ICM was more clearly visible in case of hatched blastocysts than early or expanded blastocysts. The gPES cell-like
Fig. 7. In vitro differentiation of goat parthenogenetic ES cell-like cells: (A) Embryoid body formation (400×). (B) Cardiac muscle cells (200×). (C) Neuron like cells (400×). (D) Epithelium like cells (400×).
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 8. Expression of cardiac specific marker in in vitro differentiated cells.
cell colonies showed embryonic stem cell morphology and expressed embryonic stem cell specific markers alkaline phosphatase, Oct-4, Sox-2, Nanog, TRA-1-60, SSEA-4 and TRA-1-81 (Figs. 2–5). Genetic stability of the cell lines was proven to be preserved via karyotype analysis which showed normal karyotype (Fig. 6). In the present study it was found that most of the colonies were flat shaped with clear boundaries which is in consistent with the morphology of embryonic stem cell colonies reported in human (Revazova et al., 2007). Dome shaped embryonic stem cell colonies were reported in mouse (Evans and Kaufman, 1981; Martin, 1981), porcine (Chen et al., 1999; Gerfen and Wheeler, 1994) and buffalo (Verma et al., 2007). One of the important features of embryonic stem cells is pluripotency. RT-PCR results showed the expression of pluripotency related genes Oct4, Sox-2 and Nanog. Expression of Oct-4 in ES cells was also reported in mouse (Evans and Kaufman, 1981; Martin, 1981), human (Chen et al., 1999; Gerfen and Wheeler,
Fig. 9. (A) Epithelial cells expressed specific marker Keratin gene. M, molecular marker; lane-1, negative control; lane-2, Keratin; lane-3, GAPDH. (B) Neuron cells expressed specific marker Nestin. M, molecular marker; lane-1, GAPDH; and lane 2, Nestin.
151
1994), cattle (Yadav et al., 2005) and buffalo (Verma et al., 2007). The expression of Sox-2 was detected in human (Boyer et al., 2005), rhesus monkey (Navara et al., 2007) and porcine ES cells (Klassen et al., 2007; Hall, 2008). Oct4 plays a critical role in maintaining pluripotency and self-renewal of ES cells (Niwa et al., 2000; Pesce and Scholer, 2001), but its utility as a marker of pluripotency has been challenged recently by studies suggesting that it is expressed in a variety of differentiated cells, including peripheral blood mononuclear cells (PBMCs) (Tai et al., 2005; Zangrossi et al., 2007). The expression of Oct-4 and Nanog is strictly restricted to the ICM in mouse and human blastocysts (Boiani and Sholer, 2005; Cauffman et al., 2005). In case of goat, the expression of Oct-4 was reported in both ICM and trophectoderm of blastocyst (He et al., 2006). While the expression of SSEA1 and SSEA4 proteins were not strictly restricted to the ICM of goat blastocysts but NANOG protein was localized to the nucleoplasm and nucleoli in ICM cells and strictly to nucleoli in TE (He et al., 2006). Since oct-4 pseudo gene exists (Liedtke et al., 2007), PCR expression of Oct-4 was further confirmed by immunostaining experiments (Fig. 5D). Isolation of goat embryonic stem cell-like cells from ICMs was earlier reported by Tian et al. (2006). Immunosurgery was used for isolation of ICMs. The ES cell-like cells were cultured on mouse embryo fibroblasts feeder layer supplemented with mouse ES cell conditioned medium, remained undifferentiated state for 8 passages, expressed alkaline phosphatase, showed normal karyotype and upon differentiation formed fibroblast like and neuron like cells (Fig. 7C and D). In the present study, mechanical isolation was used for isolation of ICMs from goat blastocysts. ES celllike cells were cultured on goat fetal fibroblast feeder layer and remained undifferentiated state up to 15 passages. Feeder layer and leukemia inhibitory factor (LIF) play important role in maintaining the embryonic stem cells in undifferentiated state and help in their unlimited proliferation. Bovine fetal fibroblast, bovine uterus epithelial cells, mouse embryonic fibroblast (MEF), human lung fibroblast has been used for ES cell culturing in bovines (First et al., 1994; Yadav et al., 2005; Stekenburg-Hamers et al., 1995; Cibelli et al., 1998; Talbot et al., 1995; Iwasaki et al., 2000) and buffalo fetal fibroblast has been used in buffalo (Chauhan et al., 2005). In the present study, goat fetal fibroblast cells were used as feeder layer. Although LIF was routinely added but the dependence of ES cell-like cells on LIF has not yet been ascertained. Formation of embryoid body is another crucial function of ESCs. In our study when ES cell-like cells were cultured in suspension culture without LIF in absence of LIF, they formed embryoid bodies (Fig. 7A). In prolonged culture gPES cells spontaneously differentiated into epithelium like and neuron like cells (Fig. 7C and D). Induced differentiation of ES cell-like cells to cardiomyocytes (Fig. 7B) was obtained. In vitro differentiation of goat parthenogenetic ES cell-like cells to cardiac muscle cells were confirmed by expression of cardiac muscle specific marker (cardiac alpha actinin) by PCR (Fig. 8). In mouse, it was reported that the development rate to morula/blastocyst of parthenogenetic (98.6% ± 1.4%)
152
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
groups was significantly higher than nuclear transferred oocytes (27.9% ± 5.9%) and the embryonic stem cell line establishment rate was also higher from parthenogenetically activated oocytes (15.7%) than nuclear transferred (4.3%) oocytes (Ju et al., 2008). Cell colonies displayed typical morphology of mice embryonic stem cells and could be maintained successfully with undifferentiated morphology after continuous proliferation for more than 120 passages still maintaining normal karyotype (Ju et al., 2008). In the present study the efficiency of embryonic stem cell derivation was not compared with any other sources but morphologically the PES cell-like cell colonies showed embryonic stem cell specific morphology, expressed embryonic stem cell specific markers and was maintained successfully for more than 15 passages with undifferentiated state maintaining normal karyotype. Teratoma formation and germ-line transmission are important characteristics of ES cell-like cells. A caprine chimera produced by injection of embryonic germ cells into blastocysts was reported by Jia et al. (2008). Successful isolation and culture of goat primodial germ cells, their pluripotency and differentiation potency into three germ layers were reported (Jia et al., 2008). In conclusion, we report the production of embryonic stem cell-like cell lines from in vitro produced parthenogenetic blastocysts. Several properties associated with undifferentiated state and pluripotency of ES cells like AP, TRA-1-60, TRA-1-81, Oct-4, Sox-2 and Nanog expression, EBs formation and in vitro differentiation were demonstrated. Acknowledgement Authors are very thankful to NAIP, Indian Council of Agricultural Research (ICAR), India for supporting the work. References Boiani, M., Sholer, H., 2005. Regulatory networks in embryo-derived pluripotent stem cells. Nat. Rev. Mol. Cell Biol. 6, 872–884. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.S., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., Young, R.A., 2005. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947–956. Cauffman, G., Van de Velde, H., Liebaers, I., Van Steirteghem, A., 2005. Oct-4 mRNA and protein expression during human preimplantation development. Mol. Hum. Reprod. 11, 173–181. Chauhan, M.S., Verma, V., Manik, R.S., Palta, P., Singla, S.K., Goswami, S.L., 2005. Development of inner cell mass and formation of embroid bodies on a gelatin coated dish and on the feeder layer in buffalo (Bubalus bubalis). Reprod. Fertil. Dev. 18, 205–206. Chen, L.R., Shiue, Y.L., Bertolini, L., Medrano, J.F., BonDurant, R.H., Anderson, G.B., 1999. Establishment of pluripotent cell lines from porcine preimplantation embryos. Theriogenology 52, 195–212. Cibelli, J.B., Stice, S.L., Golueke, P.J., Kane, J.J., Jerry, J., Blackwell, C., Ponce de Leon, F.A., Robl, J.M., 1998. Transgenic bovine chimeric offspring produced from somatic cell-derived stem-like cells. Nat. Biotechnol. 16 (7), 642–646. Cibelli, J.B., Grant, K.A., Chapman, K.B., Cunniff, K., Worst, T., Green, H.L., Walker, S.J., Gutin, P.H., Vilner, L., Tabar, V., Dominko, T., Kane, J., Wettstein, P.J., Lanza, R.P., Studer, L., Vrana, K.E., West, M.D., 2002. Parthenogenetic stem cells in nonhuman primates. Science 295, 779–780. De, A.K., Malakar, D., Akshey, Y.S., Jena, M.K., Dutta, R., 2011. Isolation and characterization of embryonic stem cell-like cells from in vitro produced goat (Capra hircus) embryos. Anim. Biotechnol. 22 (4), 181–196.
De, A.K., Malakar, D., Akshey, Y.S., Jena, M.K., Dutta, R., 2012. Zona-free and with zona parthenogenetic 1 embryo production in goat (Capra hircus) – effect of activation methods, culture systems and culture media. Livest. Sci. 143, 35–42. Dyban, A.P., 1983. An improved method for chromosome preparation from preimplantation mammalian embryos, oocytes or isolated blastomeres. Stain Technol. 58, 69–72. Evans, M.J., Kaufman, M., 1981. Establishment in culture of pluripotent cells from mouse embryos. Nature 292, 154–156. First, N.L., Sims, M.M., Park, S.P., Kent-First, M.J., 1994. Systems for production of calves from cultured embryonic cells. Reprod. Fertil. Dev. 6, 533–562. Gerfen, R.W., Wheeler, M.B., 1994. Isolation of embryo cell lines from procine blastocysts. Anim. Biotechnol. 6, 1–14. Hall, V., 2008. Porcine embryonic stem cells: a possible source for cell replacement therapy. Stem Cell Rev. Rep. 4 (4), 275–282. He, S., Pant, D., Schiffmacher, A., Bischoff, S., Melican, D., Gavin, W., Keefer, C., 2006. Developmental expression of pluripotency determining factors in caprine embryos: novel pattern of NANOG protein localization in the nucleolus. Mol. Reprod. Dev. 73 (12), 1512–1522. Hernandez, L., Kozlov, S., Piras, G., Stewart, C.L., 2003. Paternal and maternal genomes confer opposite effects on proliferation, cellcycle length, senescence, and tumor formation. Proc. Natl. Acad. Sci. U.S.A. 100, 13344–13349. Iwasaki, S., Campbell, K.H., Gallic, A.K., Akiyama, K., 2000. Production of live calves derived from embryonic stem-like cells aggregated with tetraploid embryos. Biol. Reprod. 62, 470–475. Jia, W., Yang, W., Lei, A., Gao, Z., Yang, C., Hua, J., Huang, W., Ma, X., Wang, H., Dou, Z., 2008. A caprine chimera produced by injection of embryonic germ cells into a blastocyst. Theriogenology 69, 340–348. Ju, J.Y., Park, C.Y., Gupta, M.K., Uhm, S.J., Paik, E.C., Ryoo, Z.Y., Cho, Y.H., Chung, K.S., Lee, H.T., 2008. Establishment of stem cell lines from nuclear transferred and parthenogenetically activated mouse oocytes for therapeutic cloning. Fertil. Steril. 89, 1314–1323. Kaufman, M.H., Robertson, E.J., Handyside, A.H., Evans, M.J., 1983. Establishment of pluripotential cell lines from haploid mouse embryos. J. Embryol. Exp. Morphol. 73, 249–261. Kim, K., Ng, K., Rugg-Gunn, P.J., Shieh, J.H., Jaenisch, R., Wakayama, T., Moore, M.A., Pedersen, R.A., Daley, G.Q., 2007. Recombination signatures distinguish embryonic stem cells derived by parthenogenesis and somatic cell nuclear transfer. Cell Stem Cell 1, 346–352. Klassen, H., Kiilgaard, J.F., Zahir, T., Ziaeian, B., Kirov, I., Scherfig, E., Warfvinge, K., Young, M.J., 2007. Progenitor cells from the porcine neural retina express photoreceptor markers after transplantation to the subretinal space of allorecipients. Stem Cells 25 (5), 1222–1230. Liedtke, S., Enczmann, J., Waclawczyk, S., Wernet, P., Kögler, G., 2007. Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 1 (4), 364–366. Mai, Q., Yu, Y., Li, T., Wang, L., Chen, M.J., Huang, S.Z., Zhou, C., Zhou, Q., 2007. Derivation of human embryonic stem cell lines from parthenogenetic blastocysts. Cell Res. 17, 1008–1019. Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U.S.A. 78, 7634–7638. Navara, C.S., Mich-Basso, J.D., Redinger, C.J., Ben-Yehudah, A., Jacoby, E., Kovkarova-Naumovski, E., Sukhwani, M., Orwig, K., Kaminski, N., Castro, C.A., Simerly, C.R., Schatten, G., 2007. Pedigreed primate embryonic stem cells express homogeneous familial gene profiles. Stem Cells 25 (11), 2695–2704. Niwa, H., Miyazaki, J., Smith, A.G., 2000. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372–376. Pesce, M., Scholer, H.R., 2001. Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells 19, 271–278. Revazova, E.S., Turovets, N.A., Kochetkova, O.D., Kindarova, L.B., Kuzmichev, L.N., Janus, J.D., Pryzhkova, M.V., 2007. Patient-specific stem cell lines derived from human parthenogenetic blastocysts. Cloning Stem Cells 9, 1–9. Stekenburg-Hamers, A.E., Van Achterberg, T.A., Rebel, H.G., Flechon, J.E., Campbell, K.H., Weima, S.M., Mummery, C.L., 1995. Isolation and characterization of permanent cell lines from inner cell mass cells of bovine blastocysts. Mol. Reprod. Dev. 40, 444–454. Tai, M.H., Chang, C.C., Kiupel, M., Webster, J.D., Olson, L.K., Trosko, J.E., 2005. Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis 26, 495–502. Talbot, N.C., Powell, A.M., Rexroad, C.E., 1995. In vitro pluripotency of epiblasts derived from bovine blastocysts. Mol. Reprod. Dev. 42, 35–52.
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153 Tian, H.B., Wang, H., Sha, H.Y., Xu, X.J., Zhu, M., Wu, Y.B., Cheng, S.H., Chen, J.Q., Shi, Y.X., Bai, Z.L., Cheng, G.X., 2006. Factors derived from mouse embryonic stem cells promote self-renewal of goat embryonic stemlike cells. Cell Biol. Int. 30, 452–458. Verma, V., Gautam, S.K., Singh, B., Manik, R.S., Palta, P., Singla, S.K., Goswami, S.L., Chauhan, M.S., 2007. Isolation and characterization of embryonic stem cell-like cells from in vitro-produced buffalo (Bubalus bubalis) embryos. Mol. Reprod. Dev. 74, 520–529. Vrana, K.E., Hipp, J.D., Goss, A.M., McCool, B.A., Riddle, D.R., Walker, S.J., Wettstein, P.J., Studer, L.P., Tabar, V., Cunniff, K., Chapman,
153
K., Vilner, L., West, M.D., Grant, K.A., Cibelli, J.B., 2003. Nonhuman primate parthenogenetic stem cells. Proc. Natl. Acad. Sci. U.S.A. 100, 11911–11916. Yadav, P.S., Wilfried, A.K., Herrmann, D., Carnwath, J.W., Niemann, H., 2005. Bovine ICM derived cells express Oct4 ortholog. Mol. Reprod. Dev. 72 (2), 182–190. Zangrossi, S., Marabese, M., Broggini, M., Giordano, R., D’Erasmo, M., Montelatici, E., Intini, D., Neri, A., Pesce, M., Rebulla, P., Lazzari, L., 2007. Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker. Stem Cells 25, 1675–1680.
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Derivation of goat embryonic stem cell-like cell lines from in vitro produced parthenogenetic blastocysts Arun Kumar De a,∗∗ , Shweta Garg a , Dinesh Kumar Singhal a , Hrudananda Malik a , Ayan Mukherjee a , Manoj Kumar Jena a , Sudarshan Kumar a , Jai Kumar Kaushik a , Ashok Kumar Mohanty a , Bikash Chandra Das b , Sadhan Bag b , Subrata Kumar Bhanja c , Dhruba Malakar a,∗ a b c
Animal Biotechnology Centre, National Dairy Research Institute, Karnal, Haryana, India Veterinary Physiology and Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly, India Central Avian Research Institute, Izatnagar, Bareilly, India
a r t i c l e
i n f o
Article history: Received 21 March 2012 Received in revised form 1 January 2013 Accepted 16 January 2013 Available online 28 February 2013 Keywords: Parthenogenesis Embryonic stem cell-like cells Blastocysts Goat
a b s t r a c t Parthenogenesis is the biological phenomenon by which embryonic development is initiated without male contribution. Parthenogenesis is a very useful method of derivation of embryonic stem cells (ESCs), which may be an important source of histocompatible cells and tissues for cell therapy. The aim of the present study was to derive and characterize goat embryonic stem cell-like cells from in vitro developed blastocysts following parthenogenetic activation of goat oocytes. Two parthenogenetic embryonic stem cell-like cell (gPESC) lines were established. The gPES cell-like cell colonies showed typical ESC morphology and expressed ESC specific markers such as alkaline phosphatase, Oct-4, Sox2, Nanog, TRA-1-60, SSEA-4 and TRA-1-81. Genetic stability of the cell lines was proven to be preserved via karyotype analysis which showed normal karyotype. In suspension culture in absence of feeder layer and without LIF, the embryonic stem cell-like cells produced embryoid bodies and following prolonged culture differentiated into several types of cells including neuron like, epithelium like and cardiac muscle cells. Cell specific markers were observed all cells expressed positive marker genes. All of these results demonstrated the feasibility to isolate and establish goat parthenogenetic ES cell-like cell lines, which provides an important tool for studying epigenetic effects in ESCs and developmental biology as well as gene targeting to produce genetically modified livestock. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The ES cells have tremendous potential applications, including the application in therapeutic medicine in
∗ Corresponding author. Tel.: +91 9416741839. ∗∗ Corresponding author. Current address: Central Agricultural Research Institute, Port Blair, A & N Islands, India. Tel.: +91 9679515260. E-mail addresses: [email protected] (A.K. De), [email protected] (D. Malakar). 0921-4488/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2013.01.018
human, study of developmental biology, analysis of the characteristics of totipotent cells and gene targeting to produce genetically modified livestock. Parthenogenetic embryonic stem cells are alternative to embryonic stem cells derived from embryos produced by somatic cell nuclear transfer or by in vitro fertilization. Parthenogenesis is the process by which an oocyte develops into an embryo without being fertilized by a spermatozoon. Such embryos lack the potential to develop to full term but they can be used to establish parthenogenetic embryonic stem (PES) cells. Successful generation
146
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
of parthenogenetic stem cell lines have been reported in mouse (Kaufman et al., 1983), non-human primate models (Cibelli et al., 2002; Vrana et al., 2003) and in humans (Revazova et al., 2007; Kim et al., 2007; Mai et al., 2007). Differentiation of PES cells into all three embryonic germ cell lines in vitro has been demonstrated in primates (Hernandez et al., 2003) and differentiation of parthenogenetic stem cells into neuronal cell in vitro was observed in a defined differentiation system in monkey (Cibelli et al., 2002). In this study, we reported the establishment of two goat embryonic stem cell-like cell lines from in vitro produced parthenogenetically activated embryos and subsequent observation of those cells over more than 15 passages. We performed characterization of the pluripotency of the lines by expression study of stem cell specific surface markers alkaline phosphatase, TRA-1-60, SSEA-4 and TRA-1-81 as well as intracellular markers Oct-4, Sox-2 and Nanog. 2. Materials and methods All the present experiments comply with all relevant institutional and national animal welfare guidelines, policies and ethics committee approval. All chemicals and media were purchased from Sigma Chemical Co. (St. Louis, MO, USA), and disposable plastic wares were from Nunc (Roskilde, Denmark) unless specified otherwise.
2.1. In vitro maturation of oocytes In vitro maturation of oocytes was performed according to the methods described by De et al. (2011). Oocytes were aspirated from ovaries collected from local slaughter house by puncturing the visible follicles with an 18-gauge needle in the oocyte collection medium (OCM) containing TCM 199 (HEPES modification), 100 g/ml l-glutamine, 10% FBS (Hyclone, Logan, UT, Cat No. CH30160.02), 50 g/ml gentamicin and 3 mg/ml BSA (Fraction-V). The cumulus-oocyte-complexes (COCs) having ≥3 layers of compact cumulus cells were picked up under stereo zoom microscope for in vitro maturation. COCs were washed 2 times with the maturation medium (De et al., 2011). Four drops of 100 l maturation medium were made in 35 mm Petri dishes and covered with mineral oil. These dishes were placed in the incubator with 5% CO2 in air at 38.5 ◦ C, 1 h prior to use for equilibration. Then 15–16 oocytes were placed in each drop of maturation medium. The Petri dishes were incubated at 38.5 ◦ C under 5% CO2 in air with maximum humidity for 24 h.
2.2. Parthenogenetic activation and embryo culture Matured oocytes with expanded cumulus cells were transferred into micro centrifuge tube containing 0.5 mg/ml hyaluronidase in T2 (T denotes TCM-199 supplemented with 2.0 mM l-glutamine, 0.2 mM sodium pyruvate, 50 g/ml gentamicin and the number denotes percentage of FBS) and incubated for 1 min at 38.5 ◦ C under 5% CO2 in air. Then vortexing was done for 2–3 min. The contents of the tube were transferred to a 35 mm Petri dish containing T2 and completely denuded oocytes were selected and washed twice in fresh T2 for removal of cumulus cells. Chemical activation of the in vitro matured oocytes was done by incubating in T20 medium (T denotes TCM-199 supplemented with 2.0 mM l-glutamine, 0.2 mM sodium pyruvate, 50 g/ml gentamicin and the number denotes percentage of FBS) containing 5 M Calcium ionophore (A23187) for 5 min at 38.5 ◦ C under 5% CO2 in air. Then the oocytes were washed thrice in T20 medium and incubated in T20 medium containing 2 mM 6-Dimethylaminopurine (6-DMAP) at 38.5 ◦ C under 5% CO2 in air for 4 h. The activated oocytes were cultured in embryo development medium (EDM) containing TCM 199 (HEPES modification), 30 g/ml sodium pyruvate, 100 g/ml l-glutamine, 50 g/ml gentamicin, 10 l/ml essential amino acids, 5 l/ml non-essential amino acids, 10 mg/ml BSA (Fraction-V) and 10% FCS under flat culture system (De et al., 2012).
2.3. Embryonic stem cells isolation and culture Embryos developed to blastocyst stage after 7 days of culture and hatched blastocysts were observed after 8 days of culture. For isolation of inner cell masses (ICMs) from blastocysts and hatched blastocysts mechanical isolation was performed. The zona pellucida of blastocysts was removed by treatment of 1% pronase in DPBS (w/v). Then to inhibit further action of pronase, the blastocysts were immediately given 4–5 washing in DPBS. The ICM cells were dissected out with the help of two fine glass needles under zoom stereomicroscope (Olympus SZ 61, Japan) (De et al., 2011). The ICM cells of hatched blastocysts were easily isolated mechanically as they were clearly visible under zoom stereomicroscope. The isolated ICMs were seeded on mitomycin-C (10 g/ml) inactivated goat fetal fibroblast feeder layers in ES cell medium containing DMEM supplemented with 20% FCS, 1000 IU/ml murine leukemia inhibitory factor (mLIF), 1% nonessential amino acids, 0.1 mM -mercaptoethanol, and 2 mM l-glutamine. The medium was changed every 48 h interval and the formation of colony was observed routinely under inverted microscope (Nikon, Japan). The primary colonies were cultured for 5–9 days and the ES cell-like cells were selected, picked up, and replated on new feeder layer cells. When the ES cell-like cells appeared to proliferate stably, the ES cell-like cell colonies were dissociated every 4–5 days by mechanical methods. 2.4. Characterization of goat parthenogenetic ES cell-like cells The putative embryonic stem cell-like cells were characterized by expression study of surface markers like alkaline phosphatase, TRA-1-60, SSEA-4, TRA-1-81 and intracellular markers Oct-4, Sox-2 and Nanog. 2.4.1. Alkaline phosphatase (AP) staining For alkaline phosphatase staining, the medium was removed and the colonies were fixed in 3.7% paraformaldehyde in DPBS for 15 min. Then the fixed colonies were washed 4–5 times with DPBS and incubated in AP substrate solution containing 25 mM Tris–maleate (pH 9.5), 8 mM MgCl2 , 0.4 mg/ml sodium alphanaphthyl phosphate and 1 mg/ml Fast red for 30 min. The cells were washed 2–3 times in DPBS and response of the cells to AP staining was observed under inverted microscope. 2.4.2. Gene expression profile analysis Passage 10 and passage 15 parthenogenetic embryonic stem cell-like cells were used for gene expression studies. Total RNA was isolated from putative goat ES cell colonies according to methods reported by De et al. (2011). Then cDNA was prepared by taking 10 l of the cell lysate using random primers. The PCR cycle included denaturation (94 ◦ C for 2 min) followed by repeated cycles of denaturation (94 ◦ C for 30 s), annealing (for 30 s at temperature 58 ◦ C) and extension (72 ◦ C for 45 s) followed by a final extension (at 72 ◦ C for 10 min). A negative RT reaction (i.e., RT reaction but without MMLV enzyme) was set up. A house keeping marker gene  actin was also amplified at each stage of PCR. The PCR primers used for the study were same as reported by De et al. (2011). Similarly neuron like, epithelium like and cardiac muscle cells specific markers were studied specific primers of respective marker genes. Primer
Sequences
Annealing/cycles
Size
Nestin
AGTGTGAAGGCAAAGATAGC TCTGTCAGGATTGGGATGGG
58/34
245 bp
Keratin CACCCAATCCACCTTCTCCAA GGTCTTGCATGGTCTCCTTCT
58/35
287 bp
2.4.3. Immunofluorescence staining of putative ES cells The expression of surface markers TRA-1-60, SSEA-4 and TRA-1-81 as well as intracellular marker oct-4 was examined by immunofluorescence staining of colonies of goat PES cell-like cells. The ES cell colonies of passage 10 were fixed in 4% paraformaldehyde in DPBS for 30 min, washed 3 times with DPBS and then permeabilized by treatment with 0.1% Triton X-100 in DPBS for 30 min. After thorough washing with DPBS, goat ES cell-like cell colonies were incubated with the blocking solution (4% normal goat serum) for 30 min and then with the primary antibody (Millipore, USA) at a dilution of 1:10–1:20 for 1 h. After washing 3 times with DPBS, ES cell colonies were incubated with the appropriate FITC-labeled secondary antibody goat anti-mouse IgG (Millipore, USA) diluted 1:100–1:200 for
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
147
Table 1 Development of parthenogenetic goat embryos. Oocytes
Cleaved (n) %
Morulae (n) %
Blastocyst (n) %
Hatched blastocyst (n) %
154
75.31 ± 0.842 (116)
42.09 ± 2.57 (65)
17.49 ± 0.95 (27)
6.45 ± 1.187 (10)
Data from 4 trials. 2 h. The goat ES cell colonies were then examined under a fluorescence microscope (Nikon, Tokyo, Japan). 2.5. Karyotyping The cells were subjected to chromosomal analysis according to the method described by Dyban (1983) with slight modifications. Briefly, passage 10 parthenogenetic embryonic stem cell-like cell colonies were incubated in DMEM supplemented with 0.1 mg/ml colcemid at 38.5 ◦ C for 4 h. The cells were then washed, trypsinized and resuspended in hypotonic solution (75 mM KCl) for 30 min at 38.5 ◦ C. They were washed and then fixed in chilled fixative (3:1 methanol/glacial acetic acid) for 30 min at room temperature and centrifuged at 200 × g for 8 min. The pellets were resuspended in 5 ml of ice-chilled fixative for another 10 min and then centrifuged again. The metaphase spreads were prepared by dropping the cells onto ice cold glass slides. Chromosomes were stained with 2% Giemsa for 6 min and observed under oil immersion (1000×) using a compound microscope (Nikon, Microphot-FXA, Japan). 2.6. Evaluation of in vitro differentiation
colonies which were not used to establish ES cell-like cell lines were lost to differentiation. Parthenogenetic embryonic stem (PES) cell-like cells showed stem cell morphology and displayed traits of normal stem cells. The ES cell-like cell colonies were densely packed, flat and had higher nucleus: cytoplasm ratio with prominent nucleus and clear boarder (Fig. 2C and D). These colonies showed expression of AP activity (Fig. 3) and expressed stem cell positive markers TRA-1-81 (Fig. 5A), TRA-1-60 (Fig. 5B), SSEA-4 (Fig. 5C) and Oct4 (Fig. 5D). Expression of important pluripotency related genes was detected by RT-PCR and positive signals for Oct-4, Sox2 and Nanog were observed (Fig. 4A and B). Normal chromosomal profile was observed by karyotype analysis (Fig. 6). Suspension culture of ES cells of passage 13 without mLIF and in the absence of feeder layer resulted in embryoid body (EBs) formation within 3 days (Fig. 7A). These EBs when cultured in 0.1% gelatin coated
For in vitro differentiation, passage 12 goat parthenogenetic ES cell colonies were removed from the feeder layer as small clumps and were transferred to suspension culture dishes containing ES medium without mLIF and in the absence of feeder layer. After 3 days, embryoid bodies were produced and subsequently seeded in a 4-well gelatin (0.1%)-coated tissue culture dish in differentiation medium (ES cell medium without LIF and feeder layer) for spontaneous in vitro differentiation. For directed differentiation of ES cell-like cells to cardiomyocetes, the ES cells were cultured in ES cell medium containing 100 ng/ml Activin-A, 10 ng/ml FGF2 and 100 ng/ml BMP-4. 2.7. Statistical analysis The differences in the number of embryos giving rise to primary cell colony were revealed by Chi-square (2 ) test. A value of P < 0.05 was considered to be statistically significant.
3. Results Cleavage was found after 36–48 h post activation. Morula (Fig. 1A), blastocysts (Fig. 1B) and hatched blastocysts (Fig. 1C and D) were obtained on day 5, day 7 and day 8 post activation respectively. Cleavage percentage was 75.31 ± 0.842% (Mean ± SEM) and blastocyst and hatched blastocyst development rate was 17.49 ± 0.95% and 6.45 ± 1.187% respectively (Table 1). 27 blastocysts and 10 hatched blastocysts were used for isolation of ICMs (Fig. 2A). Primary ES cell-like cell colonies (Fig. 2B) formed after 5 days of seeding of ICMs on feeder layers. Primary colony formation rate was significantly higher when ICMs were isolated from hatched blastocysts (60.00%) than when isolated from blastocysts (40.74%) (Table 2). Confluent layer of PES cell-like cell colonies (Fig. 2C and D) was found after 10 days of culture. The colonies were passaged by mechanical disaggregation method and two parthenogenetic ES cell-like cell lines (gPES-1, gPES-2) were established which maintained their undifferentiated state up to 15th successive passages. The other primary
Fig. 1. Morphology of in vitro produced parthenogenetic goat embryos: (A) Morula stage goat embryo (400×). (B) Blastocysts of goat (200×). (C) Blastocyst just before hatching (400×). (D) Hatched blastocyst of goat (400×). Table 2 Primary colony formation from goat parthenogenetic blastocysts and hatched blastocysts. ICM source
Number of embryos
No of primary ES cell colonies, n (%)
Blastocysts Hatched blastocysts
27 10
11 (40.74%)a 6 (60.00%)b
Data from 4 trials. Values within the same column with different superscripts (a and b) differ significantly (P < 0.05).
148
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 2. Morphology of goat parthenogenetic embryonic stem cell-like cells: (A) ICMs isolated from parthenogenetically activated hatched blastocyst (400×). (B) Attachment of ICMs after 4 days of culture (100×). (C) Parthenogenetic ES cell-like cells after 7 days of culture (200×). (D) Parthenogenetic ES cell-like cells after 10 days of culture (400×).
tissue culture dishes without feeder layer and mLIF spontaneously differentiated into epithelium like and neuron like cells (Fig. 7C and D). Epithelium cells and neuron cells specific marker genes Nestin and Keratin were expressed
respectively during their growth and confirmed by PCR (Fig. 9A and B). When ES cell-like cells were cultured in differentiation medium containing 100 ng/ml Activin-A, 10 ng/ml FGF-2
Fig. 3. Expression of alkaline phosphatase in parthenogenetic ES cell-like cells (200×): (A) On 10th passages. (B) On 15th passages.
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
149
Fig. 4. Expression of intracellular markers Oct-4, Sox-2 and Nanog in parthenogenetic goat embryonic stem cell-like cells: (A) On 10th passages. (B) On 15th passages.
and 100 ng/ml BMP-4 cardiac muscle cells were obtained (Fig. 7B). Expression of a cardiac muscle specific marker cardiac alpha actinin in induced differentiated cardiac muscle cells (Fig. 8) was confirmed by PCR.
4. Discussion Two goat parthenogenetic stem cell-like cell lines were successfully derived from parthenogenetic blastocysts.
Fig. 5. Immunofluorescence staining of goat parthenogenetic ES cell-like cells: (A) TRA-1-81. (B) TRA-1-60. (C) SSEA-4. (D) Oct-4.
150
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 6. Chromosomal profile of goat parthenogenetic ES cell-like cells: (A) Normal no. of metaphase chromosome in passage 8 parthenogenetic ES cell-like cells (1000×). (B) Normal karyotyping.
After chemical activation, 27 out of 154 oocytes developed into blastocysts and among 27 blastocysts 10 hatched. The primary colony formation was 60.00% when ICMs were isolated from hatched blastocysts and 40.74% when ICMs
were isolated from blastocysts (Table 2). Primary colony formation was higher from hatched blastocysts because the ICM was more clearly visible in case of hatched blastocysts than early or expanded blastocysts. The gPES cell-like
Fig. 7. In vitro differentiation of goat parthenogenetic ES cell-like cells: (A) Embryoid body formation (400×). (B) Cardiac muscle cells (200×). (C) Neuron like cells (400×). (D) Epithelium like cells (400×).
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
Fig. 8. Expression of cardiac specific marker in in vitro differentiated cells.
cell colonies showed embryonic stem cell morphology and expressed embryonic stem cell specific markers alkaline phosphatase, Oct-4, Sox-2, Nanog, TRA-1-60, SSEA-4 and TRA-1-81 (Figs. 2–5). Genetic stability of the cell lines was proven to be preserved via karyotype analysis which showed normal karyotype (Fig. 6). In the present study it was found that most of the colonies were flat shaped with clear boundaries which is in consistent with the morphology of embryonic stem cell colonies reported in human (Revazova et al., 2007). Dome shaped embryonic stem cell colonies were reported in mouse (Evans and Kaufman, 1981; Martin, 1981), porcine (Chen et al., 1999; Gerfen and Wheeler, 1994) and buffalo (Verma et al., 2007). One of the important features of embryonic stem cells is pluripotency. RT-PCR results showed the expression of pluripotency related genes Oct4, Sox-2 and Nanog. Expression of Oct-4 in ES cells was also reported in mouse (Evans and Kaufman, 1981; Martin, 1981), human (Chen et al., 1999; Gerfen and Wheeler,
Fig. 9. (A) Epithelial cells expressed specific marker Keratin gene. M, molecular marker; lane-1, negative control; lane-2, Keratin; lane-3, GAPDH. (B) Neuron cells expressed specific marker Nestin. M, molecular marker; lane-1, GAPDH; and lane 2, Nestin.
151
1994), cattle (Yadav et al., 2005) and buffalo (Verma et al., 2007). The expression of Sox-2 was detected in human (Boyer et al., 2005), rhesus monkey (Navara et al., 2007) and porcine ES cells (Klassen et al., 2007; Hall, 2008). Oct4 plays a critical role in maintaining pluripotency and self-renewal of ES cells (Niwa et al., 2000; Pesce and Scholer, 2001), but its utility as a marker of pluripotency has been challenged recently by studies suggesting that it is expressed in a variety of differentiated cells, including peripheral blood mononuclear cells (PBMCs) (Tai et al., 2005; Zangrossi et al., 2007). The expression of Oct-4 and Nanog is strictly restricted to the ICM in mouse and human blastocysts (Boiani and Sholer, 2005; Cauffman et al., 2005). In case of goat, the expression of Oct-4 was reported in both ICM and trophectoderm of blastocyst (He et al., 2006). While the expression of SSEA1 and SSEA4 proteins were not strictly restricted to the ICM of goat blastocysts but NANOG protein was localized to the nucleoplasm and nucleoli in ICM cells and strictly to nucleoli in TE (He et al., 2006). Since oct-4 pseudo gene exists (Liedtke et al., 2007), PCR expression of Oct-4 was further confirmed by immunostaining experiments (Fig. 5D). Isolation of goat embryonic stem cell-like cells from ICMs was earlier reported by Tian et al. (2006). Immunosurgery was used for isolation of ICMs. The ES cell-like cells were cultured on mouse embryo fibroblasts feeder layer supplemented with mouse ES cell conditioned medium, remained undifferentiated state for 8 passages, expressed alkaline phosphatase, showed normal karyotype and upon differentiation formed fibroblast like and neuron like cells (Fig. 7C and D). In the present study, mechanical isolation was used for isolation of ICMs from goat blastocysts. ES celllike cells were cultured on goat fetal fibroblast feeder layer and remained undifferentiated state up to 15 passages. Feeder layer and leukemia inhibitory factor (LIF) play important role in maintaining the embryonic stem cells in undifferentiated state and help in their unlimited proliferation. Bovine fetal fibroblast, bovine uterus epithelial cells, mouse embryonic fibroblast (MEF), human lung fibroblast has been used for ES cell culturing in bovines (First et al., 1994; Yadav et al., 2005; Stekenburg-Hamers et al., 1995; Cibelli et al., 1998; Talbot et al., 1995; Iwasaki et al., 2000) and buffalo fetal fibroblast has been used in buffalo (Chauhan et al., 2005). In the present study, goat fetal fibroblast cells were used as feeder layer. Although LIF was routinely added but the dependence of ES cell-like cells on LIF has not yet been ascertained. Formation of embryoid body is another crucial function of ESCs. In our study when ES cell-like cells were cultured in suspension culture without LIF in absence of LIF, they formed embryoid bodies (Fig. 7A). In prolonged culture gPES cells spontaneously differentiated into epithelium like and neuron like cells (Fig. 7C and D). Induced differentiation of ES cell-like cells to cardiomyocytes (Fig. 7B) was obtained. In vitro differentiation of goat parthenogenetic ES cell-like cells to cardiac muscle cells were confirmed by expression of cardiac muscle specific marker (cardiac alpha actinin) by PCR (Fig. 8). In mouse, it was reported that the development rate to morula/blastocyst of parthenogenetic (98.6% ± 1.4%)
152
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153
groups was significantly higher than nuclear transferred oocytes (27.9% ± 5.9%) and the embryonic stem cell line establishment rate was also higher from parthenogenetically activated oocytes (15.7%) than nuclear transferred (4.3%) oocytes (Ju et al., 2008). Cell colonies displayed typical morphology of mice embryonic stem cells and could be maintained successfully with undifferentiated morphology after continuous proliferation for more than 120 passages still maintaining normal karyotype (Ju et al., 2008). In the present study the efficiency of embryonic stem cell derivation was not compared with any other sources but morphologically the PES cell-like cell colonies showed embryonic stem cell specific morphology, expressed embryonic stem cell specific markers and was maintained successfully for more than 15 passages with undifferentiated state maintaining normal karyotype. Teratoma formation and germ-line transmission are important characteristics of ES cell-like cells. A caprine chimera produced by injection of embryonic germ cells into blastocysts was reported by Jia et al. (2008). Successful isolation and culture of goat primodial germ cells, their pluripotency and differentiation potency into three germ layers were reported (Jia et al., 2008). In conclusion, we report the production of embryonic stem cell-like cell lines from in vitro produced parthenogenetic blastocysts. Several properties associated with undifferentiated state and pluripotency of ES cells like AP, TRA-1-60, TRA-1-81, Oct-4, Sox-2 and Nanog expression, EBs formation and in vitro differentiation were demonstrated. Acknowledgement Authors are very thankful to NAIP, Indian Council of Agricultural Research (ICAR), India for supporting the work. References Boiani, M., Sholer, H., 2005. Regulatory networks in embryo-derived pluripotent stem cells. Nat. Rev. Mol. Cell Biol. 6, 872–884. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.S., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., Young, R.A., 2005. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947–956. Cauffman, G., Van de Velde, H., Liebaers, I., Van Steirteghem, A., 2005. Oct-4 mRNA and protein expression during human preimplantation development. Mol. Hum. Reprod. 11, 173–181. Chauhan, M.S., Verma, V., Manik, R.S., Palta, P., Singla, S.K., Goswami, S.L., 2005. Development of inner cell mass and formation of embroid bodies on a gelatin coated dish and on the feeder layer in buffalo (Bubalus bubalis). Reprod. Fertil. Dev. 18, 205–206. Chen, L.R., Shiue, Y.L., Bertolini, L., Medrano, J.F., BonDurant, R.H., Anderson, G.B., 1999. Establishment of pluripotent cell lines from porcine preimplantation embryos. Theriogenology 52, 195–212. Cibelli, J.B., Stice, S.L., Golueke, P.J., Kane, J.J., Jerry, J., Blackwell, C., Ponce de Leon, F.A., Robl, J.M., 1998. Transgenic bovine chimeric offspring produced from somatic cell-derived stem-like cells. Nat. Biotechnol. 16 (7), 642–646. Cibelli, J.B., Grant, K.A., Chapman, K.B., Cunniff, K., Worst, T., Green, H.L., Walker, S.J., Gutin, P.H., Vilner, L., Tabar, V., Dominko, T., Kane, J., Wettstein, P.J., Lanza, R.P., Studer, L., Vrana, K.E., West, M.D., 2002. Parthenogenetic stem cells in nonhuman primates. Science 295, 779–780. De, A.K., Malakar, D., Akshey, Y.S., Jena, M.K., Dutta, R., 2011. Isolation and characterization of embryonic stem cell-like cells from in vitro produced goat (Capra hircus) embryos. Anim. Biotechnol. 22 (4), 181–196.
De, A.K., Malakar, D., Akshey, Y.S., Jena, M.K., Dutta, R., 2012. Zona-free and with zona parthenogenetic 1 embryo production in goat (Capra hircus) – effect of activation methods, culture systems and culture media. Livest. Sci. 143, 35–42. Dyban, A.P., 1983. An improved method for chromosome preparation from preimplantation mammalian embryos, oocytes or isolated blastomeres. Stain Technol. 58, 69–72. Evans, M.J., Kaufman, M., 1981. Establishment in culture of pluripotent cells from mouse embryos. Nature 292, 154–156. First, N.L., Sims, M.M., Park, S.P., Kent-First, M.J., 1994. Systems for production of calves from cultured embryonic cells. Reprod. Fertil. Dev. 6, 533–562. Gerfen, R.W., Wheeler, M.B., 1994. Isolation of embryo cell lines from procine blastocysts. Anim. Biotechnol. 6, 1–14. Hall, V., 2008. Porcine embryonic stem cells: a possible source for cell replacement therapy. Stem Cell Rev. Rep. 4 (4), 275–282. He, S., Pant, D., Schiffmacher, A., Bischoff, S., Melican, D., Gavin, W., Keefer, C., 2006. Developmental expression of pluripotency determining factors in caprine embryos: novel pattern of NANOG protein localization in the nucleolus. Mol. Reprod. Dev. 73 (12), 1512–1522. Hernandez, L., Kozlov, S., Piras, G., Stewart, C.L., 2003. Paternal and maternal genomes confer opposite effects on proliferation, cellcycle length, senescence, and tumor formation. Proc. Natl. Acad. Sci. U.S.A. 100, 13344–13349. Iwasaki, S., Campbell, K.H., Gallic, A.K., Akiyama, K., 2000. Production of live calves derived from embryonic stem-like cells aggregated with tetraploid embryos. Biol. Reprod. 62, 470–475. Jia, W., Yang, W., Lei, A., Gao, Z., Yang, C., Hua, J., Huang, W., Ma, X., Wang, H., Dou, Z., 2008. A caprine chimera produced by injection of embryonic germ cells into a blastocyst. Theriogenology 69, 340–348. Ju, J.Y., Park, C.Y., Gupta, M.K., Uhm, S.J., Paik, E.C., Ryoo, Z.Y., Cho, Y.H., Chung, K.S., Lee, H.T., 2008. Establishment of stem cell lines from nuclear transferred and parthenogenetically activated mouse oocytes for therapeutic cloning. Fertil. Steril. 89, 1314–1323. Kaufman, M.H., Robertson, E.J., Handyside, A.H., Evans, M.J., 1983. Establishment of pluripotential cell lines from haploid mouse embryos. J. Embryol. Exp. Morphol. 73, 249–261. Kim, K., Ng, K., Rugg-Gunn, P.J., Shieh, J.H., Jaenisch, R., Wakayama, T., Moore, M.A., Pedersen, R.A., Daley, G.Q., 2007. Recombination signatures distinguish embryonic stem cells derived by parthenogenesis and somatic cell nuclear transfer. Cell Stem Cell 1, 346–352. Klassen, H., Kiilgaard, J.F., Zahir, T., Ziaeian, B., Kirov, I., Scherfig, E., Warfvinge, K., Young, M.J., 2007. Progenitor cells from the porcine neural retina express photoreceptor markers after transplantation to the subretinal space of allorecipients. Stem Cells 25 (5), 1222–1230. Liedtke, S., Enczmann, J., Waclawczyk, S., Wernet, P., Kögler, G., 2007. Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 1 (4), 364–366. Mai, Q., Yu, Y., Li, T., Wang, L., Chen, M.J., Huang, S.Z., Zhou, C., Zhou, Q., 2007. Derivation of human embryonic stem cell lines from parthenogenetic blastocysts. Cell Res. 17, 1008–1019. Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U.S.A. 78, 7634–7638. Navara, C.S., Mich-Basso, J.D., Redinger, C.J., Ben-Yehudah, A., Jacoby, E., Kovkarova-Naumovski, E., Sukhwani, M., Orwig, K., Kaminski, N., Castro, C.A., Simerly, C.R., Schatten, G., 2007. Pedigreed primate embryonic stem cells express homogeneous familial gene profiles. Stem Cells 25 (11), 2695–2704. Niwa, H., Miyazaki, J., Smith, A.G., 2000. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372–376. Pesce, M., Scholer, H.R., 2001. Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells 19, 271–278. Revazova, E.S., Turovets, N.A., Kochetkova, O.D., Kindarova, L.B., Kuzmichev, L.N., Janus, J.D., Pryzhkova, M.V., 2007. Patient-specific stem cell lines derived from human parthenogenetic blastocysts. Cloning Stem Cells 9, 1–9. Stekenburg-Hamers, A.E., Van Achterberg, T.A., Rebel, H.G., Flechon, J.E., Campbell, K.H., Weima, S.M., Mummery, C.L., 1995. Isolation and characterization of permanent cell lines from inner cell mass cells of bovine blastocysts. Mol. Reprod. Dev. 40, 444–454. Tai, M.H., Chang, C.C., Kiupel, M., Webster, J.D., Olson, L.K., Trosko, J.E., 2005. Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis 26, 495–502. Talbot, N.C., Powell, A.M., Rexroad, C.E., 1995. In vitro pluripotency of epiblasts derived from bovine blastocysts. Mol. Reprod. Dev. 42, 35–52.
A.K. De et al. / Small Ruminant Research 113 (2013) 145–153 Tian, H.B., Wang, H., Sha, H.Y., Xu, X.J., Zhu, M., Wu, Y.B., Cheng, S.H., Chen, J.Q., Shi, Y.X., Bai, Z.L., Cheng, G.X., 2006. Factors derived from mouse embryonic stem cells promote self-renewal of goat embryonic stemlike cells. Cell Biol. Int. 30, 452–458. Verma, V., Gautam, S.K., Singh, B., Manik, R.S., Palta, P., Singla, S.K., Goswami, S.L., Chauhan, M.S., 2007. Isolation and characterization of embryonic stem cell-like cells from in vitro-produced buffalo (Bubalus bubalis) embryos. Mol. Reprod. Dev. 74, 520–529. Vrana, K.E., Hipp, J.D., Goss, A.M., McCool, B.A., Riddle, D.R., Walker, S.J., Wettstein, P.J., Studer, L.P., Tabar, V., Cunniff, K., Chapman,
153
K., Vilner, L., West, M.D., Grant, K.A., Cibelli, J.B., 2003. Nonhuman primate parthenogenetic stem cells. Proc. Natl. Acad. Sci. U.S.A. 100, 11911–11916. Yadav, P.S., Wilfried, A.K., Herrmann, D., Carnwath, J.W., Niemann, H., 2005. Bovine ICM derived cells express Oct4 ortholog. Mol. Reprod. Dev. 72 (2), 182–190. Zangrossi, S., Marabese, M., Broggini, M., Giordano, R., D’Erasmo, M., Montelatici, E., Intini, D., Neri, A., Pesce, M., Rebulla, P., Lazzari, L., 2007. Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker. Stem Cells 25, 1675–1680.