- Email: [email protected]
Derivation of neural stem cells from human teratomas
Journal Pre-proof
Derivation of Neural stem cells from Human Teratomas Kiyokazu Kim , Mayumi Higashi , Shigehisa Fumino , Tatsuro Tajiri PII: DOI: Reference:
S1873-5061(19)30263-6 https://doi.org/10.1016/j.scr.2019.101633 SCR 101633
To appear in:
Stem Cell Research
Received date: Revised date: Accepted date:
21 May 2019 2 October 2019 16 October 2019
Please cite this article as: Kiyokazu Kim , Mayumi Higashi , Shigehisa Fumino , Tatsuro Tajiri , Derivation of Neural stem cells from Human Teratomas, Stem Cell Research (2019), doi: https://doi.org/10.1016/j.scr.2019.101633
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Highlights
Spheres with the characteristics of neural stem cells (neurospheres) were obtained from the primary culture of a human infantile teratoma
Neurospheres obtained from a human infantile teratoma possess the potential to develop into various neural cells
Dissociated neurospheres form secondary spheres which possess the same characteristics as the original ones
1
Article type: Original Articles Title: Derivation of Neural stem cells from Human Teratomas
Kiyokazu Kim, Mayumi Higashi, Shigehisa Fumino, Tatsuro Tajiri
Department of Pediatric Surgery, Kyoto Prefectural University of Medicine, Kyoto, Japan
*Corresponding author: Kiyokazu Kim. Department of Pediatric Surgery, Kyoto Prefectural University of Medicine, 465 Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto, 602-8566, Japan. Tel: +81-75-251-5809 Fax: +81-75-251-5828 E-mail: [email protected]
2
number of text pages: 24 number of words: 3624 number of reference pages: 2 number of tables: 1 number of figures and legends to figures: 5
Disclosure: The authors declare no conflicts of interest in association with the present study.
Funding: This work was supported by a Grant-in-Aid for Exploratory Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant Number JP15H05000), and by the Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development, AMED (Grant Number JP18ck0106332).
3
Abstract Human teratoma is a germ cell tumor that contains normal tissues (e.g., hair, skin or cartilage) differentiated from embryonal germ layers. Because of the feature of this tumor, we hypothesized that human teratomas contain multipotent stem cells that can develop into various non-cancerous normal tissues. In this study, we cultured neurospheres originally derived from a human infantile teratoma tissue, and the sphere cells were found to possess the characteristics of neural stem cells. Tumor tissues were obtained from an infantile immature teratoma at the time of surgical resection. In the primary cell culture, colonies were formed in two weeks and were individually cultured in serum-free conditioned neural stem cell medium (NSC medium). Colonies changed into spheres and grew in smooth round forms, or attached to the bottom of the dishes and extended processes and filaments around. Sphere cells were dissociated into single cells, and new spheres (secondary spheres) were formed in NSC medium. Cell differentiation was induced by culturing cells in serum-containing medium (differentiation medium), as cells spread and attached to the bottom of dishes and changed form. The expression of Nestin, Sox2, CXCR4, and (stem cell markers), β3-tubulin (a neural marker) GFAP (a glial marker) CNPase, SOX10 (oligodendrocyte markers) and NF-L in cells was analyzed by immunofluorescence and a Q-PCR. Nestin, SOX2, CXCR4
4
were abundant in both primary and secondary spheres. Neural and glial markers (β3-tubulin and GFAP, respectively) were increased in cells cultured in differentiation medium while stem cell markers were diminished. The oligodendrocyte markers SOX10 and CNPase were also found in both spheres and differentiated cells. In conclusion, spheres with the characteristics of neural stem cells were obtained from the primary culture of a human infantile teratoma. These spheres are considered to have the potential to undergo a natural course of neural development in humans. Key words: teratoma, neural stem cell
5
1. Introduction Human teratomas (mature or immature) are the most common germ cell tumors in children. They occur in the gonadal glands, testes or ovaries, or from misplaced extragonadal germ cells, mostly in the midline of the body. Mature or immature teratomas contain various tissues developed form three germ layers, such as hair, skin or cartilage, which most frequently develop from the external germ layers. Mature and immature teratomas are quite similar, with the exception that immature teratomas contain various undeveloped tissues. Neural components are commonly found in immature teratomas in the forms of neural tubes or glia. In children, both mature and immature teratomas have benign characteristics as tumors without aggressive metastasis or recurrence; however, they sometimes grow to a massive size. The contents of the tumor usually show the normal features of mature or immature tissues with no consistent genetic aberrations or malignant transformation. Based on these specific features of teratomas, we hypothesized that human teratoma tissue contains cells with the pluripotent characteristics of stem cells. Basic research has demonstrated that teratomas develop as a consequence of fully reprogrammed iPS cells or human embryonic stem cells (Mosteiro et al., 2013)(Ohnishi et al., 2014). It has been reported that reprograming and tumorigenesis share common processes, and inadequate
6
reprogramming of iPS cells resulted in the development of tumors that resembled pediatric malignancies. However, only completely reprogramed iPS cells developed teratomas with normally differentiated tissues, and pluripotency was not found in inadequately reprogrammed cells (Ohnishi et al., 2014)(Hultman et al., 2014). The concept that pluripotent stem cells with the potential to differentiate into various tissues can develop teratomas also seems suitable for human teratomas, and we assumed that human teratomas might still possess multipotent stem cells that have the potential to develop into normal tissues. In this study, we successfully cultured spheres from cells of human infantile teratomas, and the spheres were composed of cells with the characteristics of neural stem cells. We also verified that these cells possessed the potential to develop into various neural cells.
7
2. Materials and Methods 2.1. Cell culture Teratoma tissue was obtained at the time of surgical resection. Informed consent for the use of tumor tissue in research had been obtained from the patient’s parents prior to the surgery. Small blocks of specimens from the solid component of the tumor and the fluid content of cysts were obtained. The tumor tissue was homogenized as much as possible using scissors and a surgical blade and incubated with the fluid contained in the cyst and 100 U/ml of penicillin/streptomycin (P/S). After the cells had attached to the bottom of the dish, colonies with neural-like processes were formed among the various shapes of cells (Fig. 1C). These colonies were picked up and cultured separately in serum-free medium containing 20 ng/mL epidermal growth factor (EGF), 20 ng/mL fibroblast growth factor-basic (FGF-basic), conditioned for neural stem cell culture (StemPro NSC SFM, Thermo Fisher Scientific, Waltham, MA, USA). Spheres formed from the colonized cells in the medium. They were washed with PBS and dissociated into single cells using Accutase (Sigma-Aldrich, St. Louis, MO, USA) for 10 minutes at room temperature. Dissociated cells were then cultured in fresh NSC medium to form new spheres from single cells. Cell differentiation was induced by culturing in serum containing RPMI 1640 medium (Nacalai Tesque, Japan) supplemented
8
with 10% fetal bovine serum and 100 U/ml of P/S. Cells and spheres were all cultured at 37 °C
in 5% CO2 and 95% humidity. Formed spheres were also preserved in completed
StemPro NSC SFM with 20% DMSO, in accordance with the manufacturer’s instructions.
2.2. Immunofluorescence staining For immunofluorescence staining, all cells and spheres were fixed in 4% paraformaldehyde for 15 minutes. Immunofluorescence staining of spheres was performed according to a previously reported method (Sasaki et al., 2010). Briefly, fixed spheres were washed with PBS and incubated with 0.025% (w/v) Triton X-100 at room temperature for 5 minutes. The spheres were then washed with PBS and incubated with the primary antibody at 4°C overnight. Spheres were washed and incubated with the secondary antibody at room temperature for 1 hour. After washing with PBS and the addition of DAPI, spheres were observed under a microscope. Immunofluorescence staining of the attached cells was performed similarly. The primary antibodies were anti-Nestin (1:500 dilution, ab6320; Abcam, Cambridge, UK), anti-β3-tubulin (1:500 dilution, #5568; Cell Signaling Technology, Danvers, MA, USA), anti-GFAP (1:500 dilution, #12389; Cell Signaling Technology), CNSase (1:500 dilution, #5664; Cell Signaling Technology), NF-L (1:500 dilution, #2837;
9
Cell Signaling Technology), SOX10 (1:500 dilution, ab212843; Abcam). Either Alexa 488- or Alexa 568-labeled secondary antibodies (A21206 or A11003; Thermo Fisher Scientific) and SlowFade Gold Antifade Mountant with DAPI (S36938; Thermo Fisher Scientific) were used for the preservation of the signal and staining of the nuclei. Stained cells were observed with a BZ-9000 fluorescence microscope (Keyence, Japan). The images were captured, and a 3D image was constructed using the BZ-Ⅱ analyzer software program (Keyence).
2.3. RNA preparation and the quantitative real-time polymerase chain reaction Total RNA was isolated using a FastGene RNA Basic Kit (NIPPON Genetics, Tokyo, Japan) and synthesized to cDNA using a ReverTra Ace (TOYOBO, Osaka, Japan). A quantitative real-time polymerase chain reaction (qRT-PCR) was performed using a StepOnePlus (Applied Biosystems, Carlsbad, CA, USA) with SYBR qPCR Mix (TOYOBO). The specific primer pairs used for amplification are shown in Table 1. The transcript levels were normalized to the GAPDH level and were calculated as the value relative to a sample of NSC medium.
10
2.4. Statistical analyses All the results are presented as the mean ± standard error of the mean. P values were generated by a one-tailed t-test (unequal variance).
2.6. Ethical approval This study was performed according to the Ethical Guidelines for Medical and Health Research Involving Human Subjects by the Ministry of Health, Labor, and Welfare of Japan in 2014 and in compliance with the Declaration of Helsinki of 1964 (revised in 2013). The protocol was approved by the local ethical committee of our institution. Since our patients were juveniles, informed consent was obtained from their parents.
11
3. Results 3.1. Derivation of sphere-forming cells from infantile immature teratoma A 4-month-old girl developed a huge retroperitoneal tumor that contained multiple cysts containing a large amount of fluid (Fig. 1A). The histological diagnosis of the tumor was immature teratoma with undeveloped neuroepithelial elements occupying 1–3 low-power fields (40×) in any slide, Norris grade 2 (Fig. 1B). Neural tube structures were observed, as well as choroid, retina, cartilage, glands, skin, brain, fat, and smooth muscle. A histological analysis revealed no malignant features, and the serum level of alpha-fetoprotein, a marker of malignant components, was within the normal range for her age. There were no signs of recurrence or metastasis during the two-year observation period. In the primary culture of homogenized tissue, colonies with neural-like processes were found among various cells during the two-to-three-week culture period (Fig. 1C), The colonies that were individualized and cultured in neural stem cell medium (NSC medium) formed spheres with smooth surfaces (Fig. 1D), which either floated in the medium or which eventually attached to the bottom of the dish. The spheres attached to the surface of the culture plate, developing projections resembling neuronal processes (Fig. 1E). Some of them generated small spheres around the attached original sphere (Fig. 1F) or formed a network
12
with each other within 42 days of culture (Fig. 1G). Single cells dissociated from each sphere using Accutase repeatedly formed spheres, and they showed the same growth patterns as the first spheres, with the neural processes extending when they were attached to the dish. Spheres were preserved with NSC medium containing DMSO at -80 °C to maintain their stemness. After the frozen spheres were thawed in NSC medium, they started to grow, and slight cell damage was observed on their surface.
3.2. Analyses of neural stemness of sphere cells. The whole-sphere immunofluorescence technique was used to examine the stemness of sphere forming cells. The spheres were positive for Nestin, a representative neural stem cell marker (Fig. 2A), but negative for β-3 tubulin, a neural differentiation marker. We also performed Nestin and β-3 tubulin staining of sphere cells attached to the dish while culturing in NSC medium. These cells also showed the strong expression of Nestin, with faint β-3 tubulin staining of the spheres but not the extended processes (Fig. 2B). These data demonstrate that sphere forming cells, either floating or attached to the dish, strongly expressed Nestin.
13
3.3. Neural differentiation of sphere cells Spheres were dissociated into single-cell suspension and cultured for one week in serum-containing medium (differentiation medium). The cells attached to the culture plate within 24 hours and showed heterogeneous morphologies. Cells were stained with a neural marker (β-3 tubulin) or a glial marker (GFAP). Each marker was positive in different shapes of cells: β-3 tubulin was mainly positive in cells with fine neural processes (Fig. 3A), while GFAP was found in broader cells (Fig. 3B). CNPase, a marker of oligodendrocytes, showed rather weak staining compared to other markers(Fig. 3C). NF-L was also positive in cells with long processes (Fig. 3D). On the other hand, nestin staining was negative in these cells (data not shown). SOX10 is a marker for oligodendrocyte progenitors, and both spheres and differentiated cells were positively stained with SOX10 antibody (Fig. 3E, 3F). However, the staining was relatively weak in differentiated cells, similar to the results of CNPase staining. These results show that in culture with serum, sphere forming cells differentiated into various cells of the nervous system.
14
3.4. Changes in markers in cells cultured with different medium conditions Spheres were cultured in NSC medium or in differentiation medium for two days, then mRNA was extracted from the cells. The expression of SOX2 and CXCR4 (neural stem cell markers) in cells was analyzed by a qRT-PCR. The expression levels of both markers in cells cultured in NSC medium were significantly higher than those in cells cultured in differentiation medium; the expression of both markers was decreased by more than one-third in cells cultured in differentiation medium (Fig. 4A, 4B). We also analyzed the expression of the Yamanaka factors OCT4, NANOG, KLF4, and c-MYC in cells. However, the expression of these factors did not show significant differences between spheres and differentiated cells (data not shown).
3.5. Self-renewal ability of spheres Single spheres were dissociated into single cells and passaged continuously in NSC medium. Over two weeks of observation, the dissociated cells proliferated and formed new spheres as secondary spheres (Fig. 5A). This passage was repeated a few times with newly formed spheres. Immunofluorescence staining revealed that the newly formed spheres and the
15
original sphere were positive for Nestin (Fig.5-B). The secondary spheres were then dissociated to a single-cell suspension and cultured for one week in differentiation medium. The cells attached to the dish and immunofluorescence staining of β-3 tubulin or GFAP was positive (Fig. 5C, D), indicating differentiation toward neurons or glia, as well as the original cells. These results show the self-renewal of cells, with maintained stemness, as well as the differentiation ability of the renewed spheres.
16
4. Discussion Recent progress in research on stem cells and pluripotent stem cells (iPS cells) has given us new insights into developmental biology and regenerative medicine. There have been various reports on the extraction of stem cells from normal tissues, and on the regeneration of new tissues from stem cells or iPS cells. Stem cells and iPS cells are powerful tools for both research and tissue engineering. Teratoma is a unique mass as a human tumor because of its mature heterogeneity. Consistent genetic anomalies are not found, or rather, most teratomas have few genetic anomalies (Surti et al., 1990). Teratomas that occur in the midline of human body, such as retroperitoneal teratomas, are considered to develop from germ cells that migrated aberrantly. Patients with immature teratomas sometimes show ectopic neural components in the peritoneum, known as gliomatosis peritonei. This is not regarded as malignant metastasis, rather it is considered to represent mass formation of migrated neural components, and is associated with a favorable outcome (Wang et al., 2016). Similarly to our spheres, the expression of Sox2 has been reported in gliomatosis tissue (Liang et al., 2015). We hypothesize that gliomatosis peritonei are caused by neural stem cells (the same as the neural stem cells we found) that migrate into the peritoneum.
17
It has been reported that iPS cells implanted within mouse tissue or human embryonic stem cells developed teratomas (Ohnishi et al., 2014)(Hultman et al., 2014)(Blum and Benvenisty, 2007)(Mosteiro et al., 2013). Ohnishi et al. generated a reprogrammable mouse model in which the expression of reprogramming factors could be controlled conditionally (Ohnishi et al., 2014). This mouse model showed the role of epigenetic alterations in tumor development: completely reprogrammed iPSCs developed into teratomas, while incompletely reprogrammed cells resulted in tumors resembling pediatric malignancies, such as Wilms’ tumor-like tumors in the kidney, hepatoblasotoma-like tumors in the liver and pancreatoblastoma-like tumors in the pancreas. This suggests that human teratomas develop from complete pluripotent cells that have the potential to develop into various normal tissues, rather than tumorous stem cells, with the exception of human teratomas that show malignant transformation. In our method, neural stem cells were obtained quite simply and relatively easily from a teratoma, and these cells possessed the potential to develop into neural tissues, which is highly similar to normal stem cells in the body that have the potential for normal neural differentiation. Our spheres and differentiated cells did not show significant differences in the expression of Yamanaka factors for iPS cells: OCT4, NANOG, KLF4, and c-MYC. This is
18
likely because our spheres had progressed rather substantially toward neural tissues rather than pure pluripotent cells. We also detected the SOX10 expression in both spheres and differentiated cells. SOX10 is a crucial factor for oligodendrocyte precursors (Pozniak et al., 2010). However, while the expression of oligodendrocyte markers CNPase and SOX10 was positive, it was rather weak in the differentiated cells, possibly because of the condition of our differentiation medium, which only contained FBS and might not have been suitable for the culture of oligodendrocytes. We attempted to apply the same methods with other mature teratomas. Even though the efficiency of sphere formation was less than that reported in this paper, we obtained spheres with the same characteristics. Furthermore, it is possible that teratomas possess multipotent stem cells that can develop into any other tissues. We only cultured neural stem cells because it seemed easier. However, experiments with different culture conditions might reveal the true origin of teratomas that can develop into various tissues. In this study, we cultured neural stem cells from human teratoma cells. Although the process was quite simple and the cells showed relatively stable growth, the cells showed neural cell differentiation. This cell could be useful for studies on normal neural differentiation.
19
Acknowledgments This work was supported by a Grant-in-Aid for Exploratory Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant Number JP15H05000), and by the Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development, AMED (Grant Number JP18ck0106332).
The English used in this manuscript was reviewed by Brian Quinn (Japan Medical Communication, Inc.).
Disclosure The authors declare no conflicts of interest in association with the present study.
Author contribution K.K. and M.H. conceptualized and designed the study, acquired data. K.K., M.H., and S.F. analyzed data. K.K. drafted the initial manuscript, and T.T. reviewed and revised the manuscript. All other authors critically reviewed the manuscript. All authors approved the
20
final version of the manuscript and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
21
Figure legends
Fig. 1. Sphere-forming cells derived from infantile immature teratoma tissue. (A) A macroscopic image of the surgically resected teratoma. (B) The histology of a teratoma with
22
differentiating neural components: neural tubes (black arrows) and rosette forming cells (yellow arrows). (C) One of the colonies formed in the primary culture of the teratoma tissue. (D-G) Spheres formed in NSC medium. Spheres were either floating (D) or attached to the bottom of the dish (E). Attached spheres formed daughter spheres (F) or extended neural processes (G).
Fig. 2. Immunofluorescence staining of the NSC marker protein Nestin in sphere-forming cells. (A) Bright field (left) and fluorescence (right) images. (B) 3D images of an attached sphere stained with Nestin (red) and β-3 tubulin (green).
23
Fig. 3. Immunofluorescent staining of neural differentiation markers β-3 tubulin and GFAP. Immunofluorescence staining of β-3 tubulin (A), GFAP (B), CNPase (C), and NF-L (D) was positive in different cells. SOX10 was stained both in spheres (E) and in differentiated cells (F).
24
Fig. 4. The qRT-PCR to detect the stem cell markers SOX2 (A) and CXCR4 (B) in spheres cultured in NSC medium and in cells cultured in differentiation medium. The expression was calculated as the value relative to the sample of NSC medium. *p < 0.05.
Fig. 5. The analyses of secondary spheres. (A) A bright field view of one of the secondary 25
spheres. (B) Immunofluorescence staining of Nestin in one of the secondary spheres. (C, D) Immunofluorescence staining of neural cell marker proteins in cells dissociated form the secondary sphere and cultured with differentiation medium. β-3 tubulin (a neural marker) (C) and GFAP (a glial marker) (D).
26
References Blum, B., Benvenisty, N., 2007. Clonal Analysis of Human Embryonic Stem Cell Differentiation into Teratomas. Stem Cells 25, 1924–1930. https://doi.org/10.1634/stemcells.2007-0073 Hultman, I., Björk, L., Blomberg, E., Sandstedt, B., Ährlund-richter, L., 2014. Experimental teratoma : At the crossroad of fetal- and. Semin. Cancer Biol. 29, 75–79. https://doi.org/10.1016/j.semcancer.2014.08.005 Liang, L., Zhang, Y., Malpica, A., Ramalingam, P., Euscher, E.D., Fuller, G.N., Liu, J., 2015. Gliomatosis peritonei : a clinicopathologic and immunohistochemical study of 21 cases 28, 1613–1620. https://doi.org/10.1038/modpathol.2015.116 Mosteiro, L., Manzanares, M., Martínez, D., Ortega, S., Ors, I., Abad, M., Serrano, M., Cañamero, M., Rayon, T., Megías, D., Domínguez, O., Pantoja, C., Graña, O., 2013. Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature 502, 340–345. https://doi.org/10.1038/nature12586 Ohnishi, K., Semi, K., Yamamoto, T., Shimizu, M., Tanaka, A., Mitsunaga, K., Okita, K., Osafune, K., Arioka, Y., Maeda, T., Soejima, H., Moriwaki, H., 2014. Premature Termination of Reprogramming In Vivo Leads to Cancer Development through Altered
27
Epigenetic Regulation. Cell 156, 663–677. https://doi.org/10.1016/j.cell.2014.01.005 Pozniak, C.D., Langseth, A.J., Dijkgraaf, G.J.P., Choe, Y., Werb, Z., 2010. Sox10 directs neural stem cells toward the oligodendrocyte lineage by decreasing Suppressor of Fused expression. PNAS 107, 21795–21800. https://doi.org/10.1073/pnas.1016485107 Sasaki, R., Aoki, S., Yamato, M., Uchiyama, H., Wada, K., Ogiuchi, H., Okano, T., Ando, T., 2010. A protocol for immunofluorescence staining of floating neurospheres. Neurosci. Lett. 479, 126–127. https://doi.org/10.1016/j.neulet.2010.05.042 Surti, U., Hoffner, L., Chakravartit, A., Ferrellt, R.E., 1990. Genetics and Biology of Human Ovarian Teratomas . 1 . Cytogenetic Analysis and Mechanism of Origin 635–643. Wang, D., Jia, C., Feng, R., Shi, H., Sun, J., 2016. Gliomatosis peritonei : a series of eight cases and review of the literature. J. Ovarian Res. 1–7. https://doi.org/10.1186/s13048-016-0256-5
28
Table 1: The primer sequences used for the qRT-PCR Gene
Primers
SOX2
Forward
5’ - GCTACAGCATGATGCAGGACCA - 3’
Reverse
5’ - TCTGCGAGCTGGTCATGGAGTT - 3’
Forward
5’ - CTCCTCTTTGTCATCACGCTTCC - 3’
Reverse
5’ - GGATGAGGACACTGCTGTAGAG - 3’
Forward
5’ - GTCTCCTCTGACTTCAACAGCG - 3’
Reverse
5’ - ACCACCCTGTTGCTGTAGCCAA - 3’
CXCR4 GAPDH
Primer sequence
qRT-PCR, quantitative real-time polymerase chain reaction
29
Derivation of Neural stem cells from Human Teratomas Kiyokazu Kim , Mayumi Higashi , Shigehisa Fumino , Tatsuro Tajiri PII: DOI: Reference:
S1873-5061(19)30263-6 https://doi.org/10.1016/j.scr.2019.101633 SCR 101633
To appear in:
Stem Cell Research
Received date: Revised date: Accepted date:
21 May 2019 2 October 2019 16 October 2019
Please cite this article as: Kiyokazu Kim , Mayumi Higashi , Shigehisa Fumino , Tatsuro Tajiri , Derivation of Neural stem cells from Human Teratomas, Stem Cell Research (2019), doi: https://doi.org/10.1016/j.scr.2019.101633
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Highlights
Spheres with the characteristics of neural stem cells (neurospheres) were obtained from the primary culture of a human infantile teratoma
Neurospheres obtained from a human infantile teratoma possess the potential to develop into various neural cells
Dissociated neurospheres form secondary spheres which possess the same characteristics as the original ones
1
Article type: Original Articles Title: Derivation of Neural stem cells from Human Teratomas
Kiyokazu Kim, Mayumi Higashi, Shigehisa Fumino, Tatsuro Tajiri
Department of Pediatric Surgery, Kyoto Prefectural University of Medicine, Kyoto, Japan
*Corresponding author: Kiyokazu Kim. Department of Pediatric Surgery, Kyoto Prefectural University of Medicine, 465 Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto, 602-8566, Japan. Tel: +81-75-251-5809 Fax: +81-75-251-5828 E-mail: [email protected]
2
number of text pages: 24 number of words: 3624 number of reference pages: 2 number of tables: 1 number of figures and legends to figures: 5
Disclosure: The authors declare no conflicts of interest in association with the present study.
Funding: This work was supported by a Grant-in-Aid for Exploratory Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant Number JP15H05000), and by the Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development, AMED (Grant Number JP18ck0106332).
3
Abstract Human teratoma is a germ cell tumor that contains normal tissues (e.g., hair, skin or cartilage) differentiated from embryonal germ layers. Because of the feature of this tumor, we hypothesized that human teratomas contain multipotent stem cells that can develop into various non-cancerous normal tissues. In this study, we cultured neurospheres originally derived from a human infantile teratoma tissue, and the sphere cells were found to possess the characteristics of neural stem cells. Tumor tissues were obtained from an infantile immature teratoma at the time of surgical resection. In the primary cell culture, colonies were formed in two weeks and were individually cultured in serum-free conditioned neural stem cell medium (NSC medium). Colonies changed into spheres and grew in smooth round forms, or attached to the bottom of the dishes and extended processes and filaments around. Sphere cells were dissociated into single cells, and new spheres (secondary spheres) were formed in NSC medium. Cell differentiation was induced by culturing cells in serum-containing medium (differentiation medium), as cells spread and attached to the bottom of dishes and changed form. The expression of Nestin, Sox2, CXCR4, and (stem cell markers), β3-tubulin (a neural marker) GFAP (a glial marker) CNPase, SOX10 (oligodendrocyte markers) and NF-L in cells was analyzed by immunofluorescence and a Q-PCR. Nestin, SOX2, CXCR4
4
were abundant in both primary and secondary spheres. Neural and glial markers (β3-tubulin and GFAP, respectively) were increased in cells cultured in differentiation medium while stem cell markers were diminished. The oligodendrocyte markers SOX10 and CNPase were also found in both spheres and differentiated cells. In conclusion, spheres with the characteristics of neural stem cells were obtained from the primary culture of a human infantile teratoma. These spheres are considered to have the potential to undergo a natural course of neural development in humans. Key words: teratoma, neural stem cell
5
1. Introduction Human teratomas (mature or immature) are the most common germ cell tumors in children. They occur in the gonadal glands, testes or ovaries, or from misplaced extragonadal germ cells, mostly in the midline of the body. Mature or immature teratomas contain various tissues developed form three germ layers, such as hair, skin or cartilage, which most frequently develop from the external germ layers. Mature and immature teratomas are quite similar, with the exception that immature teratomas contain various undeveloped tissues. Neural components are commonly found in immature teratomas in the forms of neural tubes or glia. In children, both mature and immature teratomas have benign characteristics as tumors without aggressive metastasis or recurrence; however, they sometimes grow to a massive size. The contents of the tumor usually show the normal features of mature or immature tissues with no consistent genetic aberrations or malignant transformation. Based on these specific features of teratomas, we hypothesized that human teratoma tissue contains cells with the pluripotent characteristics of stem cells. Basic research has demonstrated that teratomas develop as a consequence of fully reprogrammed iPS cells or human embryonic stem cells (Mosteiro et al., 2013)(Ohnishi et al., 2014). It has been reported that reprograming and tumorigenesis share common processes, and inadequate
6
reprogramming of iPS cells resulted in the development of tumors that resembled pediatric malignancies. However, only completely reprogramed iPS cells developed teratomas with normally differentiated tissues, and pluripotency was not found in inadequately reprogrammed cells (Ohnishi et al., 2014)(Hultman et al., 2014). The concept that pluripotent stem cells with the potential to differentiate into various tissues can develop teratomas also seems suitable for human teratomas, and we assumed that human teratomas might still possess multipotent stem cells that have the potential to develop into normal tissues. In this study, we successfully cultured spheres from cells of human infantile teratomas, and the spheres were composed of cells with the characteristics of neural stem cells. We also verified that these cells possessed the potential to develop into various neural cells.
7
2. Materials and Methods 2.1. Cell culture Teratoma tissue was obtained at the time of surgical resection. Informed consent for the use of tumor tissue in research had been obtained from the patient’s parents prior to the surgery. Small blocks of specimens from the solid component of the tumor and the fluid content of cysts were obtained. The tumor tissue was homogenized as much as possible using scissors and a surgical blade and incubated with the fluid contained in the cyst and 100 U/ml of penicillin/streptomycin (P/S). After the cells had attached to the bottom of the dish, colonies with neural-like processes were formed among the various shapes of cells (Fig. 1C). These colonies were picked up and cultured separately in serum-free medium containing 20 ng/mL epidermal growth factor (EGF), 20 ng/mL fibroblast growth factor-basic (FGF-basic), conditioned for neural stem cell culture (StemPro NSC SFM, Thermo Fisher Scientific, Waltham, MA, USA). Spheres formed from the colonized cells in the medium. They were washed with PBS and dissociated into single cells using Accutase (Sigma-Aldrich, St. Louis, MO, USA) for 10 minutes at room temperature. Dissociated cells were then cultured in fresh NSC medium to form new spheres from single cells. Cell differentiation was induced by culturing in serum containing RPMI 1640 medium (Nacalai Tesque, Japan) supplemented
8
with 10% fetal bovine serum and 100 U/ml of P/S. Cells and spheres were all cultured at 37 °C
in 5% CO2 and 95% humidity. Formed spheres were also preserved in completed
StemPro NSC SFM with 20% DMSO, in accordance with the manufacturer’s instructions.
2.2. Immunofluorescence staining For immunofluorescence staining, all cells and spheres were fixed in 4% paraformaldehyde for 15 minutes. Immunofluorescence staining of spheres was performed according to a previously reported method (Sasaki et al., 2010). Briefly, fixed spheres were washed with PBS and incubated with 0.025% (w/v) Triton X-100 at room temperature for 5 minutes. The spheres were then washed with PBS and incubated with the primary antibody at 4°C overnight. Spheres were washed and incubated with the secondary antibody at room temperature for 1 hour. After washing with PBS and the addition of DAPI, spheres were observed under a microscope. Immunofluorescence staining of the attached cells was performed similarly. The primary antibodies were anti-Nestin (1:500 dilution, ab6320; Abcam, Cambridge, UK), anti-β3-tubulin (1:500 dilution, #5568; Cell Signaling Technology, Danvers, MA, USA), anti-GFAP (1:500 dilution, #12389; Cell Signaling Technology), CNSase (1:500 dilution, #5664; Cell Signaling Technology), NF-L (1:500 dilution, #2837;
9
Cell Signaling Technology), SOX10 (1:500 dilution, ab212843; Abcam). Either Alexa 488- or Alexa 568-labeled secondary antibodies (A21206 or A11003; Thermo Fisher Scientific) and SlowFade Gold Antifade Mountant with DAPI (S36938; Thermo Fisher Scientific) were used for the preservation of the signal and staining of the nuclei. Stained cells were observed with a BZ-9000 fluorescence microscope (Keyence, Japan). The images were captured, and a 3D image was constructed using the BZ-Ⅱ analyzer software program (Keyence).
2.3. RNA preparation and the quantitative real-time polymerase chain reaction Total RNA was isolated using a FastGene RNA Basic Kit (NIPPON Genetics, Tokyo, Japan) and synthesized to cDNA using a ReverTra Ace (TOYOBO, Osaka, Japan). A quantitative real-time polymerase chain reaction (qRT-PCR) was performed using a StepOnePlus (Applied Biosystems, Carlsbad, CA, USA) with SYBR qPCR Mix (TOYOBO). The specific primer pairs used for amplification are shown in Table 1. The transcript levels were normalized to the GAPDH level and were calculated as the value relative to a sample of NSC medium.
10
2.4. Statistical analyses All the results are presented as the mean ± standard error of the mean. P values were generated by a one-tailed t-test (unequal variance).
2.6. Ethical approval This study was performed according to the Ethical Guidelines for Medical and Health Research Involving Human Subjects by the Ministry of Health, Labor, and Welfare of Japan in 2014 and in compliance with the Declaration of Helsinki of 1964 (revised in 2013). The protocol was approved by the local ethical committee of our institution. Since our patients were juveniles, informed consent was obtained from their parents.
11
3. Results 3.1. Derivation of sphere-forming cells from infantile immature teratoma A 4-month-old girl developed a huge retroperitoneal tumor that contained multiple cysts containing a large amount of fluid (Fig. 1A). The histological diagnosis of the tumor was immature teratoma with undeveloped neuroepithelial elements occupying 1–3 low-power fields (40×) in any slide, Norris grade 2 (Fig. 1B). Neural tube structures were observed, as well as choroid, retina, cartilage, glands, skin, brain, fat, and smooth muscle. A histological analysis revealed no malignant features, and the serum level of alpha-fetoprotein, a marker of malignant components, was within the normal range for her age. There were no signs of recurrence or metastasis during the two-year observation period. In the primary culture of homogenized tissue, colonies with neural-like processes were found among various cells during the two-to-three-week culture period (Fig. 1C), The colonies that were individualized and cultured in neural stem cell medium (NSC medium) formed spheres with smooth surfaces (Fig. 1D), which either floated in the medium or which eventually attached to the bottom of the dish. The spheres attached to the surface of the culture plate, developing projections resembling neuronal processes (Fig. 1E). Some of them generated small spheres around the attached original sphere (Fig. 1F) or formed a network
12
with each other within 42 days of culture (Fig. 1G). Single cells dissociated from each sphere using Accutase repeatedly formed spheres, and they showed the same growth patterns as the first spheres, with the neural processes extending when they were attached to the dish. Spheres were preserved with NSC medium containing DMSO at -80 °C to maintain their stemness. After the frozen spheres were thawed in NSC medium, they started to grow, and slight cell damage was observed on their surface.
3.2. Analyses of neural stemness of sphere cells. The whole-sphere immunofluorescence technique was used to examine the stemness of sphere forming cells. The spheres were positive for Nestin, a representative neural stem cell marker (Fig. 2A), but negative for β-3 tubulin, a neural differentiation marker. We also performed Nestin and β-3 tubulin staining of sphere cells attached to the dish while culturing in NSC medium. These cells also showed the strong expression of Nestin, with faint β-3 tubulin staining of the spheres but not the extended processes (Fig. 2B). These data demonstrate that sphere forming cells, either floating or attached to the dish, strongly expressed Nestin.
13
3.3. Neural differentiation of sphere cells Spheres were dissociated into single-cell suspension and cultured for one week in serum-containing medium (differentiation medium). The cells attached to the culture plate within 24 hours and showed heterogeneous morphologies. Cells were stained with a neural marker (β-3 tubulin) or a glial marker (GFAP). Each marker was positive in different shapes of cells: β-3 tubulin was mainly positive in cells with fine neural processes (Fig. 3A), while GFAP was found in broader cells (Fig. 3B). CNPase, a marker of oligodendrocytes, showed rather weak staining compared to other markers(Fig. 3C). NF-L was also positive in cells with long processes (Fig. 3D). On the other hand, nestin staining was negative in these cells (data not shown). SOX10 is a marker for oligodendrocyte progenitors, and both spheres and differentiated cells were positively stained with SOX10 antibody (Fig. 3E, 3F). However, the staining was relatively weak in differentiated cells, similar to the results of CNPase staining. These results show that in culture with serum, sphere forming cells differentiated into various cells of the nervous system.
14
3.4. Changes in markers in cells cultured with different medium conditions Spheres were cultured in NSC medium or in differentiation medium for two days, then mRNA was extracted from the cells. The expression of SOX2 and CXCR4 (neural stem cell markers) in cells was analyzed by a qRT-PCR. The expression levels of both markers in cells cultured in NSC medium were significantly higher than those in cells cultured in differentiation medium; the expression of both markers was decreased by more than one-third in cells cultured in differentiation medium (Fig. 4A, 4B). We also analyzed the expression of the Yamanaka factors OCT4, NANOG, KLF4, and c-MYC in cells. However, the expression of these factors did not show significant differences between spheres and differentiated cells (data not shown).
3.5. Self-renewal ability of spheres Single spheres were dissociated into single cells and passaged continuously in NSC medium. Over two weeks of observation, the dissociated cells proliferated and formed new spheres as secondary spheres (Fig. 5A). This passage was repeated a few times with newly formed spheres. Immunofluorescence staining revealed that the newly formed spheres and the
15
original sphere were positive for Nestin (Fig.5-B). The secondary spheres were then dissociated to a single-cell suspension and cultured for one week in differentiation medium. The cells attached to the dish and immunofluorescence staining of β-3 tubulin or GFAP was positive (Fig. 5C, D), indicating differentiation toward neurons or glia, as well as the original cells. These results show the self-renewal of cells, with maintained stemness, as well as the differentiation ability of the renewed spheres.
16
4. Discussion Recent progress in research on stem cells and pluripotent stem cells (iPS cells) has given us new insights into developmental biology and regenerative medicine. There have been various reports on the extraction of stem cells from normal tissues, and on the regeneration of new tissues from stem cells or iPS cells. Stem cells and iPS cells are powerful tools for both research and tissue engineering. Teratoma is a unique mass as a human tumor because of its mature heterogeneity. Consistent genetic anomalies are not found, or rather, most teratomas have few genetic anomalies (Surti et al., 1990). Teratomas that occur in the midline of human body, such as retroperitoneal teratomas, are considered to develop from germ cells that migrated aberrantly. Patients with immature teratomas sometimes show ectopic neural components in the peritoneum, known as gliomatosis peritonei. This is not regarded as malignant metastasis, rather it is considered to represent mass formation of migrated neural components, and is associated with a favorable outcome (Wang et al., 2016). Similarly to our spheres, the expression of Sox2 has been reported in gliomatosis tissue (Liang et al., 2015). We hypothesize that gliomatosis peritonei are caused by neural stem cells (the same as the neural stem cells we found) that migrate into the peritoneum.
17
It has been reported that iPS cells implanted within mouse tissue or human embryonic stem cells developed teratomas (Ohnishi et al., 2014)(Hultman et al., 2014)(Blum and Benvenisty, 2007)(Mosteiro et al., 2013). Ohnishi et al. generated a reprogrammable mouse model in which the expression of reprogramming factors could be controlled conditionally (Ohnishi et al., 2014). This mouse model showed the role of epigenetic alterations in tumor development: completely reprogrammed iPSCs developed into teratomas, while incompletely reprogrammed cells resulted in tumors resembling pediatric malignancies, such as Wilms’ tumor-like tumors in the kidney, hepatoblasotoma-like tumors in the liver and pancreatoblastoma-like tumors in the pancreas. This suggests that human teratomas develop from complete pluripotent cells that have the potential to develop into various normal tissues, rather than tumorous stem cells, with the exception of human teratomas that show malignant transformation. In our method, neural stem cells were obtained quite simply and relatively easily from a teratoma, and these cells possessed the potential to develop into neural tissues, which is highly similar to normal stem cells in the body that have the potential for normal neural differentiation. Our spheres and differentiated cells did not show significant differences in the expression of Yamanaka factors for iPS cells: OCT4, NANOG, KLF4, and c-MYC. This is
18
likely because our spheres had progressed rather substantially toward neural tissues rather than pure pluripotent cells. We also detected the SOX10 expression in both spheres and differentiated cells. SOX10 is a crucial factor for oligodendrocyte precursors (Pozniak et al., 2010). However, while the expression of oligodendrocyte markers CNPase and SOX10 was positive, it was rather weak in the differentiated cells, possibly because of the condition of our differentiation medium, which only contained FBS and might not have been suitable for the culture of oligodendrocytes. We attempted to apply the same methods with other mature teratomas. Even though the efficiency of sphere formation was less than that reported in this paper, we obtained spheres with the same characteristics. Furthermore, it is possible that teratomas possess multipotent stem cells that can develop into any other tissues. We only cultured neural stem cells because it seemed easier. However, experiments with different culture conditions might reveal the true origin of teratomas that can develop into various tissues. In this study, we cultured neural stem cells from human teratoma cells. Although the process was quite simple and the cells showed relatively stable growth, the cells showed neural cell differentiation. This cell could be useful for studies on normal neural differentiation.
19
Acknowledgments This work was supported by a Grant-in-Aid for Exploratory Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant Number JP15H05000), and by the Practical Research for Innovative Cancer Control from the Japan Agency for Medical Research and Development, AMED (Grant Number JP18ck0106332).
The English used in this manuscript was reviewed by Brian Quinn (Japan Medical Communication, Inc.).
Disclosure The authors declare no conflicts of interest in association with the present study.
Author contribution K.K. and M.H. conceptualized and designed the study, acquired data. K.K., M.H., and S.F. analyzed data. K.K. drafted the initial manuscript, and T.T. reviewed and revised the manuscript. All other authors critically reviewed the manuscript. All authors approved the
20
final version of the manuscript and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
21
Figure legends
Fig. 1. Sphere-forming cells derived from infantile immature teratoma tissue. (A) A macroscopic image of the surgically resected teratoma. (B) The histology of a teratoma with
22
differentiating neural components: neural tubes (black arrows) and rosette forming cells (yellow arrows). (C) One of the colonies formed in the primary culture of the teratoma tissue. (D-G) Spheres formed in NSC medium. Spheres were either floating (D) or attached to the bottom of the dish (E). Attached spheres formed daughter spheres (F) or extended neural processes (G).
Fig. 2. Immunofluorescence staining of the NSC marker protein Nestin in sphere-forming cells. (A) Bright field (left) and fluorescence (right) images. (B) 3D images of an attached sphere stained with Nestin (red) and β-3 tubulin (green).
23
Fig. 3. Immunofluorescent staining of neural differentiation markers β-3 tubulin and GFAP. Immunofluorescence staining of β-3 tubulin (A), GFAP (B), CNPase (C), and NF-L (D) was positive in different cells. SOX10 was stained both in spheres (E) and in differentiated cells (F).
24
Fig. 4. The qRT-PCR to detect the stem cell markers SOX2 (A) and CXCR4 (B) in spheres cultured in NSC medium and in cells cultured in differentiation medium. The expression was calculated as the value relative to the sample of NSC medium. *p < 0.05.
Fig. 5. The analyses of secondary spheres. (A) A bright field view of one of the secondary 25
spheres. (B) Immunofluorescence staining of Nestin in one of the secondary spheres. (C, D) Immunofluorescence staining of neural cell marker proteins in cells dissociated form the secondary sphere and cultured with differentiation medium. β-3 tubulin (a neural marker) (C) and GFAP (a glial marker) (D).
26
References Blum, B., Benvenisty, N., 2007. Clonal Analysis of Human Embryonic Stem Cell Differentiation into Teratomas. Stem Cells 25, 1924–1930. https://doi.org/10.1634/stemcells.2007-0073 Hultman, I., Björk, L., Blomberg, E., Sandstedt, B., Ährlund-richter, L., 2014. Experimental teratoma : At the crossroad of fetal- and. Semin. Cancer Biol. 29, 75–79. https://doi.org/10.1016/j.semcancer.2014.08.005 Liang, L., Zhang, Y., Malpica, A., Ramalingam, P., Euscher, E.D., Fuller, G.N., Liu, J., 2015. Gliomatosis peritonei : a clinicopathologic and immunohistochemical study of 21 cases 28, 1613–1620. https://doi.org/10.1038/modpathol.2015.116 Mosteiro, L., Manzanares, M., Martínez, D., Ortega, S., Ors, I., Abad, M., Serrano, M., Cañamero, M., Rayon, T., Megías, D., Domínguez, O., Pantoja, C., Graña, O., 2013. Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature 502, 340–345. https://doi.org/10.1038/nature12586 Ohnishi, K., Semi, K., Yamamoto, T., Shimizu, M., Tanaka, A., Mitsunaga, K., Okita, K., Osafune, K., Arioka, Y., Maeda, T., Soejima, H., Moriwaki, H., 2014. Premature Termination of Reprogramming In Vivo Leads to Cancer Development through Altered
27
Epigenetic Regulation. Cell 156, 663–677. https://doi.org/10.1016/j.cell.2014.01.005 Pozniak, C.D., Langseth, A.J., Dijkgraaf, G.J.P., Choe, Y., Werb, Z., 2010. Sox10 directs neural stem cells toward the oligodendrocyte lineage by decreasing Suppressor of Fused expression. PNAS 107, 21795–21800. https://doi.org/10.1073/pnas.1016485107 Sasaki, R., Aoki, S., Yamato, M., Uchiyama, H., Wada, K., Ogiuchi, H., Okano, T., Ando, T., 2010. A protocol for immunofluorescence staining of floating neurospheres. Neurosci. Lett. 479, 126–127. https://doi.org/10.1016/j.neulet.2010.05.042 Surti, U., Hoffner, L., Chakravartit, A., Ferrellt, R.E., 1990. Genetics and Biology of Human Ovarian Teratomas . 1 . Cytogenetic Analysis and Mechanism of Origin 635–643. Wang, D., Jia, C., Feng, R., Shi, H., Sun, J., 2016. Gliomatosis peritonei : a series of eight cases and review of the literature. J. Ovarian Res. 1–7. https://doi.org/10.1186/s13048-016-0256-5
28
Table 1: The primer sequences used for the qRT-PCR Gene
Primers
SOX2
Forward
5’ - GCTACAGCATGATGCAGGACCA - 3’
Reverse
5’ - TCTGCGAGCTGGTCATGGAGTT - 3’
Forward
5’ - CTCCTCTTTGTCATCACGCTTCC - 3’
Reverse
5’ - GGATGAGGACACTGCTGTAGAG - 3’
Forward
5’ - GTCTCCTCTGACTTCAACAGCG - 3’
Reverse
5’ - ACCACCCTGTTGCTGTAGCCAA - 3’
CXCR4 GAPDH
Primer sequence
qRT-PCR, quantitative real-time polymerase chain reaction
29