- Email: [email protected]
Design of a bioprocess for metal and sulfate removal from acid mine drainage
Hydrometallurgy 180 (2018) 72–77
Contents lists available at ScienceDirect
Hydrometallurgy journal homepage: www.elsevier.com/locate/hydromet
Design of a bioprocess for metal and sulfate removal from acid mine drainage Cristian Hurtado, Pabla Viedma, Davor Cotoras
T
⁎
Universidad de Chile, Facultad de Ciencias Químicas y Farmacéuticas, Laboratorio de Biotecnología, Santos Dumont 964, 8380494 Santiago, Chile
A R T I C LE I N FO
A B S T R A C T
Keywords: Sulfate reduction Metal removal Biosorption Sulfate-reducing bacteria Acid mine drainage
The high levels of sulfate and the metals in acid mine drainages generate important environmental problems. This paper describes the synergistic combination of a biosorption process and a new sulfate removal process. The treatment for the elimination of metals by biosorption with a Bacillus strain allowed reducing the high metal concentrations that had a toxic effect on the sulfate-reducing bacteria (SRB). On the other hand, the sulfate removal process used a microbial sulfate-reducing halotolerant consortium, which was able to reduce the sulfate concentration using low-cost organic substrates such as spirulina, cellulose and industrial starch. Independent of substrate present in the culture medium, the SRB was the predominant group. The sulfate-reducing consortium was cultured on a bench-scale upflow anaerobic packed bed bioreactor filled with Celite R-635. It was possible to reduce the concentration of sulfate in the culture medium in batch or semi-continuous operation. This integrated process is an inexpensive alternative for the elimination of metals by biosortion and the elimination of sulfate using a sulfate-reducing consortium.
1. Introduction Sulfate and metals are pollutants present in acid mine drainage (AMD). AMD is the acidic metal rich water formed by the reaction between the water and rock containing sulfur-bearing minerals. The resulting acidic solution acts as a leaching agent containing dissolved metals and sulfuric acid that in contact with water bodies can contaminate those, making them unfit for use (Costa et al., 2017). This is one of the most significant environmental challenges facing the mining industry and environmental management agencies across the globe (Skousen et al., 2017; Tait et al., 2009; Wei et al., 2016). There are currently some alternatives to remove sulfate and metals from water. The most commonly used method for treating AMD is based on chemical neutralization (e.g., lime addition) resulting in the precipitation of metal hydroxides (de Godoi et al., 2017; Johnson and Hallberg, 2005; Kefeni et al., 2017). However, these alternatives pose important issues such as not reducing the concentration of sulfate to the levels required or being cost-ineffective. In recent years, several studies have evaluated different techniques such as solvent extraction, ultrafiltration, microfiltration, nanofiltration, reverse osmosis, organic and inorganic ion exchange, and adsorption (Oyewo et al., 2018). However, these treatments are too expensive to be applied at large scale. Considering the above issues the need for developing an economical and
⁎
efficient alternative for the removal of sulfate is required. The use of sulfate-reducing bacteria (SRB) is an option for the treatment of water with high levels of sulfate (Sousa et al., 2015), but is limited for two reasons: substrates of low molecular weight (i.e. lactate, pyruvate or ethanol) are very expensive and mining effluents contain high concentrations of metals that have a toxic effect on the SRB (Kaksonen and Puhakka, 2007; Utgikar et al., 2003). In this research, the use of microbial consortia capable of hydrolyzing, fermenting more economical complex substrates and producing low molecular weight metabolites as substrates for SRBs is proposed (Boshoff et al., 2004 and Hao et al., 2014). In this study, a halotolerant consortium was enriched using complex substrates such as Spirulina, cellulose and industrial starch. The halotolerance of microorganisms is an important characteristic for the treatment of mining effluents that contain high levels of salts. For metal removal was, a biosorption process previously developed by our research group used (Cotoras et al., 2009). The combined process was used to treat an AMD water.
Corresponding author. E-mail address: [email protected] (D. Cotoras).
https://doi.org/10.1016/j.hydromet.2018.07.006 Received 16 February 2018; Received in revised form 25 June 2018; Accepted 12 July 2018 Available online 17 July 2018 0304-386X/ © 2018 Published by Elsevier B.V.
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Table 1 Sequences, position in the target rRNA and specificity of the probes used in the fluorescence “in situ” hybridization. Probe
Sequence (5′–3′) of probe
Specificity
rRNA type
Reference
EUB338 ALFlb BET42a GAM42a SRB385 CF319a ARCH915
GCTGCCTCCCGTAGGAGT CGTTCGYTCTGAGCCAG GCCTTCCCACTTCGTTT GCCTTCCCACATCGTTT CGGCGTCGCTGCGTCAGG TGGTCCGTGTCTCAGTAC GTGCTCCCCCGCCAATTCCT
Most bacteria α-Proteobacteria β-Proteobacteria γ-Proteobacteria δ-Proteobacteria Cytophaga-Flavobacterium Archaea
16S 16S 23S 23S 16S 16S 16S
Amann et al., 1990 Manz et al., 1992 Manz et al., 1992 Manz et al., 1992 Amann et al., 1995 Manz et al., 1996 Amann et al., 1995
2. Materials and methods
2.5. Bacterial strain and culture medium for metal biosorption
2.1. Reagents
The bacterial strain Bacillus sp. NRRL-B-30881 was used in this study (Cotoras and Viedma, 2011). All growth experiments were performed in the following culture medium (in grams per liter of distilled water): D-glucose, 10; Na2HPO4, 1.0; KH2PO4, 0.3; K2SO4, 0.1; NaCl, 0.1; MgSO4·7H2O, 0.02; CaCl2, 0.01; FeSO4·7H2O, 0.001; yeast extract, 1.0 and casein hydrolysate, 1.0 (Cotoras and Viedma, 2011).
N,N-Dimethyl-1,4-phenylenediamine oxalate, 4′,6-Diamidino-2phenylindole (DAPI) and microcrystalline cellulose were purchased from Sigma-Aldrich (USA). NH4Cl, Na2SO4, CaCl2·6H2O, MgSO4·7H2O, FeSO4·7H2O, H3PO4, ZnCl2, CuCl2·2H2O, (NH4)2HPO4, Na2HPO4·2H2O, acetamide, thioglycolic acid, ethanol, formaldehyde (37%), yeast extract, starch were purchased from Merck (Germany). K2HPO4, BaCl2·2H2O, NaCl, Tris, SDS, EDTA, NaOH, formamide and H2SO4 were purchased from Winkler (Chile). Dry Spirulina, casein hydrolysate and mineral oil for microbiology were supplied by General Nutrition Centers (USA), Difco (USA) and Biomérieux (France), respectively. Industrial starch was kindly provided by Corn Products (Chile).
2.6. Metals biosorption of a pretreated acid mine drainage An amount of lime necessary to reach a pH equal to 6.3 to pre-treat the AMD was used. Bacillus sp., NRRL-B-30881 was cultured at 28 °C for 16 h in a fermenter (Multigen F-1000, New Brunswick Scientific, USA) with a capacity of 2 L, with aeration (0.75 vvm) and stirring (200 rpm). The obtained aggregate biomass was left to decant and the supernatant was discarded. This biomass was used for the biosorption of the metals present in the AMD. 2 l of AMD were contacted with the biomass in the bioreactor for 1 h with stirring (75 rpm). After the biosorption stage, the biomass was separated by decantation and a solution with low metal concentration was obtained.
2.2. Acid mine drainage A sample of AMD was collected from a copper mine located in the Andean Mountains of Central Chile. This AMD had a pH value of 2.95, a sulfate concentration of 3602 mg/L and following concentrations of heavy metals (in mg/L): copper, 1400; iron, 27.9; zinc, 20.4 and nickel 0.60.
2.7. Fluorescence in situ hybridization (FISH)
2.3. Sulfate-reducing microbial consortium and culture medium
The characterization of the microbial populations enriched in the different complex organic compounds was done using the in situ hybridization technique. The specific oligonucleotide sequences of CY3labeled probes and the hybridization conditions are summarized in the Table 1. To perform the microbial consortium in situ hybridization, 100 μL of culture was taken and placed in 900 μL PBS and centrifuged for 5 min at 4724 x g. Once the centrifuging was done the supernatant was discarded and the pellet was re-suspended in 900 μL PBS, then centrifuged for 3 min at 112 x g. A sample of 50 μL was placed on a glass slide and was fixed with heat. Once fixed, 20 μL 37% formaldehyde was added on each sample for 20 min. Then, 50 μL of the hybridization solution was added to each sample (see Table 2) containing 20 mg of a CY3-labeled probe on each of the samples. They were incubated at 46 °C for 90 min in an equilibrated chamber. Probes BET42a and GAM42a were used with competitor oligonucleotides as described previously (Manz et al., 1992). Then the glass slides were incubated in a prewarmed washing solution (see Table 3) at 48 °C for 30 min.
The microbial consortium used in this study was enriched from black anaerobic sediment of a saline lagoon (Atacama Salt Flat, Chile). All growth experiments were performed at 28 °C in modified Postgate C culture medium (Barton and Tomei, 1995) with NaCl 60 g/L and a complex electron donor, using mineral oil overlay (10 mL medium overlaid with 2 mL mineral oil in 20 mL test tubes). Microcrystalline cellulose, starch, Spirulina and industrial starch were tested as complex electron donors. 2.4. Bioreactor set-up and experimental design for sulfate reduction A PTFE bioreactor with a useful volume of 412 cm3 (dimensions: 49 cm high x 3.3 cm wide). It was packed with Celite R-635 (Celite Corp. Lompoc, CA, USA), a thermally and chemically stable synthesized diatomaceous earth pellets (dimensions 6.35 mm diam × 12.7 mm ht., pore diameter approx. 20 μm and BET surface area of 0.27 m2/g). This support material has been used successfully in biofiltration processes and in packed bed sulfate-reducing bioreactor to recover dissolved sulfide products (McMahon and Daugulis, 2008; Mezgebe et al., 2017). The upflow anaerobic packed bed bioreactor was incubated at 28 °C (0.1 g/L of thioglycolic acid was used). Postgate C modified culture medium and 2 g/L industrial starch, as substrate, were used. The bioreactor was inoculated with a culture of the sulfate-reducing microbial consortium. Feeding and recirculation were performed using a Masterflex peristaltic pump with Tygon tubing (Cole-Parmer Inc., USA). The bioreactor filled with Celite R-635, was handled batch wise for 97 days. After this time, the bioreactor was fed daily in a semi-continuous manner.
Table 2 Hybridization solution composition for the fluorescence “in situ” hybridization. The composition of this solution depends on the probe used. The hybridization solution 1 was used for probes ALF lb. and EUB 338, while the hybridization solution 2 was used for probes BET42a, GAM42a, CF319a and SRB385.
73
Compound
Hybridization solution 1
Hybridization solution 2
Formamide NaCl Tris/HCI pH 7.2 SDS
20% 0.9 M 20 mM 0.01%
35% 0.9 M 20 mM 0.01%
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Table 3 Washing solution composition for the fluorescence “in situ” hybridization. The composition of this solution depends on the probe to be used. The washing solution 1 was used for probes ALF lb. and EUB 338, while washing solution 2 was used for probes BET42a, GAM42a, CF319a and SRB385. Compound
Washing solution 1
Washing solution 2
Tris/HCI pH 7,2 SDS NaCl EDTA
20 mM 0.01% 180 mM 5 mM
20 mM 0.021% 40 mM 5 mM
Once washed the glass slides were left to dry. Then the samples were treated with 20 μL DAPI (50 μL/mL). After 10–15 min they were rinsed with distilled water to eliminate the excess of DAPI. Once the hybridization is done, they were observed in a Zeiss epifluorescence microscope with filter Zeiss N° 20 for the CY3-labeled probe and with a filter Zeiss N° 09 for DAPI. The samples were photographed using a Canon PowerShot sx110 IS camera and a Remote Capture v.3.0.1.8 software. The images were processed using the ImageJ software. The hybridization in situ was applied to the microbial consortiums cultures between 5 and 7 days in test tubes with cellulose, starch and Spirulina media as nutrients. 2.8. Analytical techniques Sulfate removal was determined by a turbidimetric method (Eaton and Clesceri, 2005a). The methylene blue method was used to measure the H2S production (Eaton and Clesceri, 2005b). A Hanna Instruments Multiparameter Photometer, Serie C99, was used for the determination of copper in solution (Hanna Instruments Inc, 2001). 3. Results and discussion 3.1. Sulfate-reducing microbial consortium culture using complex organic substrates Enriched cultures were able to grow and reduce sulfate using complex organic substrates like Spirulina, starch, cellulose and industrial starch. The growth of the microbial consortium was determined by means of the presence of black precipitate that corresponds to FeS. This precipitate was produced by the reaction of H2S with the iron present in the culture medium. The same change in color was observed in all culture media with the different substrates (cellulose, Spirulina and industrial starch). Spirulina, starch and industrial starch generated a greater reduction of sulfate and a higher concentration of hydrogen sulfide compared to cellulose. Similar findings were described in the literature, where a wide range of organic materials for the effective reduction of sulfate was tested (Liamleam and Annachhatre, 2007; Moodley et al., 2017; Skousen et al., 2017; Zhang and Wang, 2014). These materials can be classified as easily-available substances (soluble sugars, starch, amino acids, and proteins) and slowly degradable biopolymers (cellulose, hemicellulose and lignin (Skousen et al., 2017). Organic macromolecules such as cellulose, starch, proteins and lipids are not a direct substrate for BRS. Therefore, it has been proposed that the SRB depends on other microorganisms that can hydrolyze these polymeric substrates, generating monomers (amino acids, sugars) and fatty acids. These monomers are fermented by other bacteria and generate small molecules like propionate, butyrate, lactate and hydrogen. The latter are the substrates of the SRB (Muyzer and Stams, 2008). Therefore, a sulfate reduction process that uses complex organic compounds requires a microbial community with a broad biodiversity. In order to know the composition of the microbial community a FISH analysis was performed. Fig. 1A, shows the composition of the microbial community of the culture with starch as substrate. Microorganisms of all the groups studied were present. Around 47% of the
Fig. 1. Fluorescence “in situ” hybridization of the microbial cultures enriched with A) starch B) Spirulina, and C) cellulose. The percentage of cells hybridized with specific probes was calculated in relation to the total number of cells stained with DAPI. The error bars correspond to the standard deviation.
microorganisms corresponded to Bacteria, while 13% of microorganisms belonged to the domain Archaea. On the other hand, the presence of SRB was detected using the probe SRB385, targeting SRB that belong to δ Proteobacteria. δ-Proteobacteria reached 14% of the total microorganisms. α-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group (CF) represented 15 and 12% respectively of the total microorganisms. Instead, the relative abundance of β- and γ-Proteobacteria were only 5 and 4%, respectively. When Spirulina was used as complex organic substrate, the microbial community was comprised by microorganisms of all the groups studied (Fig. 1B). Approximately 56% of microorganisms corresponded to Bacteria while 7% were Archaea. The δ-Proteobacteria corresponded to a considerable percentage within the microorganisms present in this culture, reaching 21% of the total. This percentage was higher to the one found using the specific probes for α-, β- and γ-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group. 74
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Fig. 1C, shows the composition of the microbial community of the culture with cellulose as substrate. All groups studied were present in this microbial culture. In this microbial consortium, 34% of the microorganisms correspond to Bacteria and near 2% of microorganisms present are Archaea; both percentages were lower as compared to what was found with the culture media with Spirulina and starch. δ-Proteobacteria within the microbial consortium reached 13% of the total microorganisms. Also, the presence of α-, β- and γ-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group were detected in percentages below 9%. Therefore, these halotolerant sulfate-reducing microbial consortia were comprised by Bacteria and Archaea. Its proportion depends on the complex organic compound used for its enrichment and culture. Regarding bacteria, these belong to, at least, the phylogenetic groups of α-, β- and γ-Proteobacteria and bacteria of the CytophagaFlavobacterium group. Its ratio also depends on the type of electron donor with which it was cultured. However, independent of substrate present in the culture medium, the SRB was the predominant group. The presence of Archaea in the bacterial community can be explained by the high salinity of the culture medium used (Oren, 2015). In Spirulina, starch and cellulose, the δ Proteobacteria reach 21, 14 and 13% of the total microorganisms respectively. This group is of great importance, since most of the SRB correspond to this group (Muyzer and Stams, 2008). It is not easy to attribute a specific role to α-, β- and γ-Proteobacteria and to Cytophaga-Flavobacterium group within the microbial community. However, it could be expected that they form part of the set of microorganisms that allow the degradation of a complex substrate such as cellulose or starch, generating low molecular weight substrates useful for SRB. The presence of Cytophaga-Flavobacterium is of interest; since there are several species of this this group have the ability to degrade cellulose (McBride et al., 2014). Lu et al. (2011) proposed a similar structure for a microbial consortium maintained from rice plant waste for the treatment of AMD. For the following studies in bioreactors, starch was selected as electron donor, because of its homogeneous composition and simplicity of its management.
Fig. 2. Time course of the sulfate and hydrogen sulfide concentrations in the effluent fed with culture medium during the semi-continuous operation. Concentration of sulfate (■) and hydrogen sulfide (○) in the effluent of the bioreactor, concentration of sulfate in the original culture medium (. . .), maximum allowed sulfate concentration of the surface water standard in Chile (—) (n = 3).
the concentration of H2S and an increase in the concentration of sulfate. The high concentration of H2S could have caused a partial inhibition of the activity of sulfate-reducing bacteria (Reis et al., 1992). To evaluate the capacity of the microbial consortium to eliminate sulfate present in an AMD, a bioreactor containing Celite R-635 was used, because this bioreactor had greater capacity to reduce sulfate and greater stability of the microbial consortium inside the bioreactor. 3.3. Integration of the metal biosorption process and the sulfate reduction process To treat an AMD, it was necessary to remove toxic metals, which have an inhibitory effect on this microbial consortium. In previous experiments in culture tubes, it was found that this sulfate-reducing microbial consortium was able to grow in a culture medium with starch up to a copper concentration of 25 mg/L, while no growth was observed at concentrations higher than 50 mg/L. Similar copper-induced growth inhibition of sulfate-reducing bacteria using isolated Desulfovibrio strains (Sani et al., 2001; Cabrera et al., 2006) or complex microbial communities (Utgikar et al., 2002, 2003) was reported. For these reasons, prior to the sulfate reduction process, the AMD was treated with lime and subsequently by biosorption:
3.2. Removal of sulfate using a sulfate-reducing microbial consortium The sulfate-reducing consortium was cultured on three bioreactors with different configurations: with starch, siliceous river gravel or Celite R-635, as support material. In these experiments, a synthetic sulfate solution without toxic metals was used (culture medium). To abbreviate, only the best configuration with Celite R-635 is described below. The bioreactor, using starch as a substrate, was operated 97 days batch wise, until achieving the formation of a sulfate-reducing biofilm on Celite R-635. The operating parameters of the bioreactor are shown in Table 4. Fig. 2 presents, with dashed lines, the maximum sulfate concentration allowed by the standards for industrial discharges to surface waters in Chile. It was observed that the sulfate concentration in the bioreactor effluent was kept under this limit throughout the experiment. On day 119, the concentration of H2S increased significantly, reaching 7.1 mM. At the end of the experiment, there was a reduction in
A) Process of treatment with lime and biosorption: the AMD contained a copper concentration of 22.0 mM (1400 mg/L) and a sulfate concentration of 67.6 mM. The treatment with lime allowed reducing the sulfate concentration to 18.8 mM and the concentration of copper at 0.31 mM. To eliminate the remaining copper, a biosorption process with aggregated Bacillus biomass was used (Cotoras et al., 2009), which decreased the copper concentration to 0.028 mM. B) Sulfate reduction process: the bioreactor was initially operated with culture medium. After 10 days, the bioreactor was fed with AMD treated with lime and biosorption. Table 5 shows the operation parameters. An increase in the sulfate inlet concentration was observed when feeding with AMD. In contrast, there was a significant decrease in the sulfate concentration in the effluent (Fig. 3). It is important to note that the sulfate concentration in the effluent was lower than the maximum value allowed by the standards for industrial discharges to surface waters in Chile, except on day 18, when there was an increase in the sulfate concentration. This can be due to a very high feed rate which could be overcome by changing the speed. Eventually, it could also be an inhibitory effect caused by H2S.
Table 4 Parameters during the bioreactor with Celite R-635 as support material operation. Batch Days Recirculation (times/ d) HRT (d) pH
Semi-continuous
1–66 0
67–97 0.5
98–109 1.0
110–112 1.0
113–116 1.0
117–121 1.0
0 ND
0 ND
10 7.5
5.0 7.5
2.5 9.0
3.2 9.0
ND: not determined. 75
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
concentration using low cost organic substrates like Spirulina, cellulose and industrial starch was enriched. 2. Independent of substrate used in the culture medium, δProteobacteria was the predominant group, but an important proportion of α-, β- and γ-Proteobacteria, Cytophaga-Flavobacterium group and Archaea were also present within this microbial community. 3. Using this sulfate-reducing consortium in a packed bed bioreactor, with Celite R-635 as support, it was possible to reduce the sulfate concentration in the culture medium. 4. It was possible to removing metal and sulfate from an acid mine drainage through the synergistic combination of a treatment system by biosorption, to reduce the inhibitory concentration of metals, followed by a new process of elimination of sulfate that uses a halotolerant sulfate-reducing the microbial consortium.
Table 5 Parameters during the bioreactor operation with Celite R-635 as support fed with culture medium or AMD. Semi-continuous Days Fed with Recirculation (times/d) HRT (d) pH
1–9 Culture medium 1.0 3.3 9.0
10–13 AMD 1.0 3.3 9.0
14–18 AMD 1.0 5.0 10
19–23 AMD 1.0 5.0 11
The findings reported here show that this integrated biological process represents a more economical alternative for the removal of metal and sulfate. Acknowledgements This work was supported by InnovaChile Linea 3 – CORFO (grant number 2013-25745). References Fig. 3. Time course of the sulfate and hydrogen sulfide concentrations in the bioreactor effluent fed with AMD during the semi-continuous operation. Concentration of sulfate (■) and hydrogen sulfide (○) in the effluent of the bioreactor, concentration of sulfate in the AMD (. . .), maximum allowed sulfate concentration of the surface water standard in Chile (—) (n = 3).
Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D.A., 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microb. 56 (6), 1919–1925. Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59 (1), 143–169. Barton, L.L., Tomei, F.A., 1995. Characteristics and activities of sulphate-reducing bacteria. In: Barton, L.L. (Ed.), Sulphate-Reducing Bacteria. Springer, New York, pp. 1–32. https://doi.org/10.1007/978-1-4899-1582-5_1. Boshoff, G., Duncan, J., Rose, P.D., 2004. The use of micro-algal biomass as a carbon source for biological sulphate reducing systems. Water Res. 38, 2659–2666. https:// doi.org/10.1016/j.watres.2004.03.031. Cabrera, G., Pérez, R., Gomez, J.M., Abalos, A., Cantero, D., 2006. Toxic effects of dissolved heavy metals on Desulfovibrio vulgaris and Desulfovibrio sp. strains. J. Hazard. Mater. 135 (1–3), 40–46. https://doi.org/10.1016/j.jhazmat.2005.11.058. Costa, J.M., Rodriguez, R.P., Sancinetti, G.P., 2017. Removal sulphate and metals Fe+2, cu+2, and Zn+2 from acid mine drainage in an anaerobic sequential batch reactor. J. Environ. Chem. Eng. 5 (2), 1985–1989. https://doi.org/10.1016/j.jece.2017.04.011. Cotoras, D., Viedma, P., 2011. U.S. Patent 7 (951), 578. Cotoras, D., Valenzuela, F., Zarzar, M. and Viedma, P., 2009. U.S. Patent 7,479,220. de Godoi, L.A.G., Foresti, E., Damianovic, M.H.R.Z., 2017. Down-flow fixed-structured bed reactor: an innovative reactor configuration applied to acid mine drainage treatment and metal recovery. J. Environ. Manag. 197, 597–604. https://doi.org/10. 1016/j.jenvman.2017.04.027. Dev, S., Roy, S., Bhattacharya, J., 2017. Optimization of the operation of packed bed bioreactor to improve the sulfate and metal removal from acid mine drainage. J. Environ. Manag. 200, 135–144. https://doi.org/10.1016/j.jenvman.2017.04.102. Eaton, D.A., Clesceri, L.S., 2005a. 4500-SO42-E. Turbidimetric Method in Standard Methods for the Examination of Water & Wastewater. American Public Health Association. Eaton, D.A., Clesceri, L.S., 2005b. 4500-S2-D. Methylene Blue Method in Standard Methods for the Examination of Water & Wastewater. American Public Health Association. Hanna Instruments Inc, 2001. C99 & C 200 Series, Multi Parameter Bench Photometer, Instruction Manual, Woonsocket, Rhode Island, 02895, USA. Hao, T.W., Xiang, P.Y., Mackey, H.R., Chi, K., Lu, H., Chui, H.K., Chen, G.H., 2014. A review of biological sulphate conversions in wastewater treatment. Water Res. 65, 1–21. https://doi.org/10.1016/j.watres.2014.06.043. Hedrich, S., Johnson, D.B., 2014. Remediation and selective recovery of metals from acidic mine waters using novel modular bioreactors. Environ. Sci. Technol. 48 (20), 12206–12212. Johnson, D.B., Hallberg, K.B., 2005. Acid mine drainage remediation options: a review. Total Environ. 338 (1–2), 3–14. https://doi.org/10.1016/j.scitotenv.2004.09.002. Jong, T., Parry, D.L., 2003. Removal of sulfate and heavy metals by sulfate reducing bacteria in short-term bench scale upflow anaerobic packed bed reactor runs. Water Res. 37 (14), 3379–3389. Kaksonen, A.H., Puhakka, J.A., 2007. Sulphate reduction based bioprocesses for the treatment of acid mine drainage and the recovery of metals. Eng. Life Sci. 7, 541–564. https://doi.org/10.1002/elsc.200720216. Kefeni, K.K., Msagati, T.A., Mamba, B.B., 2017. Acid mine drainage: prevention,
In the literature, high performance sulfate removal processes using low molecular weight compounds as carbon sources and electron donors have been described. The preferred organic substrates were lactate (Remoundaki et al., 2008), ethanol (Kousi et al., 2011) and glycerol (Hedrich and Johnson, 2014; Ňancucheo and Johnson, 2014). These low molecular weight compounds are direct electron donors of the SRB, allowing establishing communities composed predominantly by this microbial group. However, these organic compounds are expensive, so they would not allow their application to the treatment of large flows of AMD. In this work, it was possible to enrich a microbial consortium capable of growing cellulose and starch, as models of low-cost agricultural waste. The low SRB ratio in this consortium may be due to the need for a wide diversity of non-sulfate-reducing bacteria to hydrolyse these polysaccharides, ferment sugars and produce substrates for the SRB. Despite the lower performance of this bioreactor, it was possible to reduce the concentration of sulfate under the Chilean standard of surface water, reaching the expected environmental objective. Jong and Parry (2003) and Dev et al. (2017) reported the simultaneous removal of sulfate and metals by sulfate reducing bacteria in an upflow anaerobic packed bed reactor using sodium lactate as electron donor. Similarly, Costa et al. (2017) showed removal sulfate and metals from acid mine drainage in an anaerobic sequential batch reactor using ethanol as carbon source. However, the process developed in this study allows treating higher metal and sulfate concentrations due to a sequential process of precipitation with lime, metal biosorption and biological reduction of sulfate. Another important difference is that in this work the removal of sulfate was carried out using low cost carbon sources such as industrial starch, Spirulina and cellulose. 4. Conclusion The following conclusions can be drawn from this study: 1. A
sulfate-reducing
consortium
able
to
reduce
the
sulfate 76
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Oyewo, O.A., Agboola, O., Onyango, M.S., Popoola, P., Bobape, M.F., 2018. Current methods for the remediation of acid mine drainage including continuous removal of metals from wastewater and mine dump. In: Bio-Geotechnologies for Mine Site Rehabilitation, pp. 103–114. https://doi.org/10.1016/B978-0-12-812986-9. 00006-3. Reis, M.A.M., Almeida, J.S., Lemos, P.C., Carrondo, M.J.T., 1992. Effect of hydrogen sulfide on growth of sulphate reducing bacteria. Biotechnol. Bioeng. 40, 593–600. https://doi.org/10.1002/bit.260400506. Remoundaki, E., Kousi, P., Joulian, C., Battaglia-Brunet, F., Hatzikioseyian, A., Tsezos, M., 2008. Characterization, morphology and composition of biofilm and precipitates from a sulphate-reducing fixed-bed reactor. J. Hazard. Mater. 153 (1–2), 514–524. Sani, R.K., Peyton, B.M., Brown, L.T., 2001. Copper-induced inhibition of growth of Desulfovibrio desulfuricans G20: assessment of its toxicity and correlation with those of zinc and lead. Appl. Environ. Microb. 67 (10), 4765–4772. https://doi.org/10.1128/ AEM.67.10.4765-4772.2001. Skousen, J., Zipper, C.E., Rose, A., Ziemkiewicz, P.F., Nairn, R., McDonald, L.M., Kleinmann, R.L., 2017. Review of passive systems for acid mine drainage treatment. Mine Water Environ. 36 (1), 133–153. https://doi.org/10.1007/s10230-016-0417-1. Sousa, J.A., Plugge, C.M., Stams, A.J., Bijmans, M.F., 2015. Sulphate reduction in a hydrogen fed bioreactor operated at haloalkaline conditions. Water Res. 68, 67–76. https://doi.org/10.1016/j.watres.2014.09.035. Tait, S., Clark, W.P., Keller, J., Batstone, D.J., 2009. Removal of sulphate from highstrength wastewater by crystallisation. Water Res. 43, 762–772. https://doi.org/10. 1016/j.watres.2008.11.008. Utgikar, V.P., Harmon, S.M., Chaudhary, N., Tabak, H.H., Govind, R., Haines, J.R., 2002. Inhibition of sulphate-reducing bacteria by metal sulfide formation in bioremediation of acid mine drainage. Environ. Toxicol. 17 (1), 40–48. https://doi.org/10.1002/tox. 10031. Utgikar, V.P., Tabak, H.H., Haines, J.R., Govind, R., 2003. Quantification of toxic and inhibitory impact of copper and zinc on mixed cultures of sulphate-reducing bacteria. Biotechnol. Bioeng. 82, 306–312. https://doi.org/10.1002/bit.10575. Wei, X., Rodak, C.M., Zhang, S., Han, Y., Wolfe, F.A., 2016. Mine drainage generation and control options. Water Environ. Res. 88 (10), 1409–1432. https://doi.org/10.2175/ 106143016X14696400495136. Zhang, M., Wang, H., 2014. Organic wastes as carbon sources to promote sulphate reducing bacterial activity for biological remediation of acid mine drainage. Miner. Eng. 69, 81–90. https://doi.org/10.1016/j.mineng.2014.07.010.
treatment options, and resource recovery: a review. J. Clean. Prod. 151, 475–493. https://doi.org/10.1016/j.jclepro.2017.03.082. Kousi, P., Remoundaki, E., Hatzikioseyian, A., Battaglia-Brunet, F., Joulian, C., Kousteni, V., Tsezos, M., 2011. Metal precipitation in an ethanol-fed, fixed-bed sulphate-reducing bioreactor. J. Hazard. Mater. 189 (3), 677–684. Liamleam, W., Annachhatre, A.P., 2007. Electron donors for biological sulphate reduction. Biotechnol. Adv. 25 (5), 452–463. https://doi.org/10.1016/j.biotechadv.2007. 05.002. Lu, J., Chen, T., Wu, J., Wilson, P.C., Hao, X., Qian, J., 2011. Acid tolerance of an acid mine drainage bioremediation system based on biological sulfate reduction. Bioresour. Technol. 102 (22), 10401–10406. https://doi.org/10.1016/j.biortech. 2011.09.046. Manz, W., Amann, R., Ludwig, W., Wagner, M., Schleifer, K.H., 1992. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst. Appl. Microbiol. 15 (4), 593–600. Manz, W., Amann, R., Ludwig, W., Vancanneyt, M., Schleifer, K.H., 1996. Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 142 (5), 1097–1106. https://doi.org/10.1099/13500872-142-5-1097. McBride, M.J., Liu, W., Lu, X., Zhu, Y., Zhang, W., 2014. The family cytophagaceae. In: The Prokaryotes. Springer Berlin Heidelberg, pp. 577–593. McMahon, M.J., Daugulis, A.J., 2008. Gas phase H2S product recovery in a packed bed bioreactor with immobilized sulfate-reducing bacteria. Biotechnol. Lett. 30, 467–473. https://doi.org/10.1007/s10529-007-9566-4. Mezgebe, B., Sorial, G.A., Sahle-Demessie, E., Hassan, A.A., Lu, J., 2017. Performance of anaerobic biotrickling filter and its microbial diversity for the removal of stripped disinfection by-products. Water Air Soil Poll. 228, 437–448. https://doi.org/10. 1007/s11270-017-3616-x. Moodley, I., Sheridan, C.M., Kappelmeyer, U., Akcil, A., 2017. Environmentally sustainable acid mine drainage remediation: research developments with a focus on waste/ by-products. Miner. Eng. https://doi.org/10.1016/j.mineng.2017.08.008. Muyzer, G., Stams, A.J., 2008. The ecology and biotechnology of sulphate-reducing bacteria. Nat. Rev. Microbiol. 6 (6), 441. https://doi.org/10.1038/nrmicro1892. Ňancucheo, I., Johnson, D.B., 2014. Removal of sulfate from extremely acidic mine waters using low pH sulfidogenic bioreactors. Hydrometallurgy 150, 222–226. Oren, A., 2015. Halophilic microbial communities and their environments. Curr. Opin. Biotech. 33, 119–124. https://doi.org/10.1016/j.copbio.2015.02.005.
77
Contents lists available at ScienceDirect
Hydrometallurgy journal homepage: www.elsevier.com/locate/hydromet
Design of a bioprocess for metal and sulfate removal from acid mine drainage Cristian Hurtado, Pabla Viedma, Davor Cotoras
T
⁎
Universidad de Chile, Facultad de Ciencias Químicas y Farmacéuticas, Laboratorio de Biotecnología, Santos Dumont 964, 8380494 Santiago, Chile
A R T I C LE I N FO
A B S T R A C T
Keywords: Sulfate reduction Metal removal Biosorption Sulfate-reducing bacteria Acid mine drainage
The high levels of sulfate and the metals in acid mine drainages generate important environmental problems. This paper describes the synergistic combination of a biosorption process and a new sulfate removal process. The treatment for the elimination of metals by biosorption with a Bacillus strain allowed reducing the high metal concentrations that had a toxic effect on the sulfate-reducing bacteria (SRB). On the other hand, the sulfate removal process used a microbial sulfate-reducing halotolerant consortium, which was able to reduce the sulfate concentration using low-cost organic substrates such as spirulina, cellulose and industrial starch. Independent of substrate present in the culture medium, the SRB was the predominant group. The sulfate-reducing consortium was cultured on a bench-scale upflow anaerobic packed bed bioreactor filled with Celite R-635. It was possible to reduce the concentration of sulfate in the culture medium in batch or semi-continuous operation. This integrated process is an inexpensive alternative for the elimination of metals by biosortion and the elimination of sulfate using a sulfate-reducing consortium.
1. Introduction Sulfate and metals are pollutants present in acid mine drainage (AMD). AMD is the acidic metal rich water formed by the reaction between the water and rock containing sulfur-bearing minerals. The resulting acidic solution acts as a leaching agent containing dissolved metals and sulfuric acid that in contact with water bodies can contaminate those, making them unfit for use (Costa et al., 2017). This is one of the most significant environmental challenges facing the mining industry and environmental management agencies across the globe (Skousen et al., 2017; Tait et al., 2009; Wei et al., 2016). There are currently some alternatives to remove sulfate and metals from water. The most commonly used method for treating AMD is based on chemical neutralization (e.g., lime addition) resulting in the precipitation of metal hydroxides (de Godoi et al., 2017; Johnson and Hallberg, 2005; Kefeni et al., 2017). However, these alternatives pose important issues such as not reducing the concentration of sulfate to the levels required or being cost-ineffective. In recent years, several studies have evaluated different techniques such as solvent extraction, ultrafiltration, microfiltration, nanofiltration, reverse osmosis, organic and inorganic ion exchange, and adsorption (Oyewo et al., 2018). However, these treatments are too expensive to be applied at large scale. Considering the above issues the need for developing an economical and
⁎
efficient alternative for the removal of sulfate is required. The use of sulfate-reducing bacteria (SRB) is an option for the treatment of water with high levels of sulfate (Sousa et al., 2015), but is limited for two reasons: substrates of low molecular weight (i.e. lactate, pyruvate or ethanol) are very expensive and mining effluents contain high concentrations of metals that have a toxic effect on the SRB (Kaksonen and Puhakka, 2007; Utgikar et al., 2003). In this research, the use of microbial consortia capable of hydrolyzing, fermenting more economical complex substrates and producing low molecular weight metabolites as substrates for SRBs is proposed (Boshoff et al., 2004 and Hao et al., 2014). In this study, a halotolerant consortium was enriched using complex substrates such as Spirulina, cellulose and industrial starch. The halotolerance of microorganisms is an important characteristic for the treatment of mining effluents that contain high levels of salts. For metal removal was, a biosorption process previously developed by our research group used (Cotoras et al., 2009). The combined process was used to treat an AMD water.
Corresponding author. E-mail address: [email protected] (D. Cotoras).
https://doi.org/10.1016/j.hydromet.2018.07.006 Received 16 February 2018; Received in revised form 25 June 2018; Accepted 12 July 2018 Available online 17 July 2018 0304-386X/ © 2018 Published by Elsevier B.V.
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Table 1 Sequences, position in the target rRNA and specificity of the probes used in the fluorescence “in situ” hybridization. Probe
Sequence (5′–3′) of probe
Specificity
rRNA type
Reference
EUB338 ALFlb BET42a GAM42a SRB385 CF319a ARCH915
GCTGCCTCCCGTAGGAGT CGTTCGYTCTGAGCCAG GCCTTCCCACTTCGTTT GCCTTCCCACATCGTTT CGGCGTCGCTGCGTCAGG TGGTCCGTGTCTCAGTAC GTGCTCCCCCGCCAATTCCT
Most bacteria α-Proteobacteria β-Proteobacteria γ-Proteobacteria δ-Proteobacteria Cytophaga-Flavobacterium Archaea
16S 16S 23S 23S 16S 16S 16S
Amann et al., 1990 Manz et al., 1992 Manz et al., 1992 Manz et al., 1992 Amann et al., 1995 Manz et al., 1996 Amann et al., 1995
2. Materials and methods
2.5. Bacterial strain and culture medium for metal biosorption
2.1. Reagents
The bacterial strain Bacillus sp. NRRL-B-30881 was used in this study (Cotoras and Viedma, 2011). All growth experiments were performed in the following culture medium (in grams per liter of distilled water): D-glucose, 10; Na2HPO4, 1.0; KH2PO4, 0.3; K2SO4, 0.1; NaCl, 0.1; MgSO4·7H2O, 0.02; CaCl2, 0.01; FeSO4·7H2O, 0.001; yeast extract, 1.0 and casein hydrolysate, 1.0 (Cotoras and Viedma, 2011).
N,N-Dimethyl-1,4-phenylenediamine oxalate, 4′,6-Diamidino-2phenylindole (DAPI) and microcrystalline cellulose were purchased from Sigma-Aldrich (USA). NH4Cl, Na2SO4, CaCl2·6H2O, MgSO4·7H2O, FeSO4·7H2O, H3PO4, ZnCl2, CuCl2·2H2O, (NH4)2HPO4, Na2HPO4·2H2O, acetamide, thioglycolic acid, ethanol, formaldehyde (37%), yeast extract, starch were purchased from Merck (Germany). K2HPO4, BaCl2·2H2O, NaCl, Tris, SDS, EDTA, NaOH, formamide and H2SO4 were purchased from Winkler (Chile). Dry Spirulina, casein hydrolysate and mineral oil for microbiology were supplied by General Nutrition Centers (USA), Difco (USA) and Biomérieux (France), respectively. Industrial starch was kindly provided by Corn Products (Chile).
2.6. Metals biosorption of a pretreated acid mine drainage An amount of lime necessary to reach a pH equal to 6.3 to pre-treat the AMD was used. Bacillus sp., NRRL-B-30881 was cultured at 28 °C for 16 h in a fermenter (Multigen F-1000, New Brunswick Scientific, USA) with a capacity of 2 L, with aeration (0.75 vvm) and stirring (200 rpm). The obtained aggregate biomass was left to decant and the supernatant was discarded. This biomass was used for the biosorption of the metals present in the AMD. 2 l of AMD were contacted with the biomass in the bioreactor for 1 h with stirring (75 rpm). After the biosorption stage, the biomass was separated by decantation and a solution with low metal concentration was obtained.
2.2. Acid mine drainage A sample of AMD was collected from a copper mine located in the Andean Mountains of Central Chile. This AMD had a pH value of 2.95, a sulfate concentration of 3602 mg/L and following concentrations of heavy metals (in mg/L): copper, 1400; iron, 27.9; zinc, 20.4 and nickel 0.60.
2.7. Fluorescence in situ hybridization (FISH)
2.3. Sulfate-reducing microbial consortium and culture medium
The characterization of the microbial populations enriched in the different complex organic compounds was done using the in situ hybridization technique. The specific oligonucleotide sequences of CY3labeled probes and the hybridization conditions are summarized in the Table 1. To perform the microbial consortium in situ hybridization, 100 μL of culture was taken and placed in 900 μL PBS and centrifuged for 5 min at 4724 x g. Once the centrifuging was done the supernatant was discarded and the pellet was re-suspended in 900 μL PBS, then centrifuged for 3 min at 112 x g. A sample of 50 μL was placed on a glass slide and was fixed with heat. Once fixed, 20 μL 37% formaldehyde was added on each sample for 20 min. Then, 50 μL of the hybridization solution was added to each sample (see Table 2) containing 20 mg of a CY3-labeled probe on each of the samples. They were incubated at 46 °C for 90 min in an equilibrated chamber. Probes BET42a and GAM42a were used with competitor oligonucleotides as described previously (Manz et al., 1992). Then the glass slides were incubated in a prewarmed washing solution (see Table 3) at 48 °C for 30 min.
The microbial consortium used in this study was enriched from black anaerobic sediment of a saline lagoon (Atacama Salt Flat, Chile). All growth experiments were performed at 28 °C in modified Postgate C culture medium (Barton and Tomei, 1995) with NaCl 60 g/L and a complex electron donor, using mineral oil overlay (10 mL medium overlaid with 2 mL mineral oil in 20 mL test tubes). Microcrystalline cellulose, starch, Spirulina and industrial starch were tested as complex electron donors. 2.4. Bioreactor set-up and experimental design for sulfate reduction A PTFE bioreactor with a useful volume of 412 cm3 (dimensions: 49 cm high x 3.3 cm wide). It was packed with Celite R-635 (Celite Corp. Lompoc, CA, USA), a thermally and chemically stable synthesized diatomaceous earth pellets (dimensions 6.35 mm diam × 12.7 mm ht., pore diameter approx. 20 μm and BET surface area of 0.27 m2/g). This support material has been used successfully in biofiltration processes and in packed bed sulfate-reducing bioreactor to recover dissolved sulfide products (McMahon and Daugulis, 2008; Mezgebe et al., 2017). The upflow anaerobic packed bed bioreactor was incubated at 28 °C (0.1 g/L of thioglycolic acid was used). Postgate C modified culture medium and 2 g/L industrial starch, as substrate, were used. The bioreactor was inoculated with a culture of the sulfate-reducing microbial consortium. Feeding and recirculation were performed using a Masterflex peristaltic pump with Tygon tubing (Cole-Parmer Inc., USA). The bioreactor filled with Celite R-635, was handled batch wise for 97 days. After this time, the bioreactor was fed daily in a semi-continuous manner.
Table 2 Hybridization solution composition for the fluorescence “in situ” hybridization. The composition of this solution depends on the probe used. The hybridization solution 1 was used for probes ALF lb. and EUB 338, while the hybridization solution 2 was used for probes BET42a, GAM42a, CF319a and SRB385.
73
Compound
Hybridization solution 1
Hybridization solution 2
Formamide NaCl Tris/HCI pH 7.2 SDS
20% 0.9 M 20 mM 0.01%
35% 0.9 M 20 mM 0.01%
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Table 3 Washing solution composition for the fluorescence “in situ” hybridization. The composition of this solution depends on the probe to be used. The washing solution 1 was used for probes ALF lb. and EUB 338, while washing solution 2 was used for probes BET42a, GAM42a, CF319a and SRB385. Compound
Washing solution 1
Washing solution 2
Tris/HCI pH 7,2 SDS NaCl EDTA
20 mM 0.01% 180 mM 5 mM
20 mM 0.021% 40 mM 5 mM
Once washed the glass slides were left to dry. Then the samples were treated with 20 μL DAPI (50 μL/mL). After 10–15 min they were rinsed with distilled water to eliminate the excess of DAPI. Once the hybridization is done, they were observed in a Zeiss epifluorescence microscope with filter Zeiss N° 20 for the CY3-labeled probe and with a filter Zeiss N° 09 for DAPI. The samples were photographed using a Canon PowerShot sx110 IS camera and a Remote Capture v.3.0.1.8 software. The images were processed using the ImageJ software. The hybridization in situ was applied to the microbial consortiums cultures between 5 and 7 days in test tubes with cellulose, starch and Spirulina media as nutrients. 2.8. Analytical techniques Sulfate removal was determined by a turbidimetric method (Eaton and Clesceri, 2005a). The methylene blue method was used to measure the H2S production (Eaton and Clesceri, 2005b). A Hanna Instruments Multiparameter Photometer, Serie C99, was used for the determination of copper in solution (Hanna Instruments Inc, 2001). 3. Results and discussion 3.1. Sulfate-reducing microbial consortium culture using complex organic substrates Enriched cultures were able to grow and reduce sulfate using complex organic substrates like Spirulina, starch, cellulose and industrial starch. The growth of the microbial consortium was determined by means of the presence of black precipitate that corresponds to FeS. This precipitate was produced by the reaction of H2S with the iron present in the culture medium. The same change in color was observed in all culture media with the different substrates (cellulose, Spirulina and industrial starch). Spirulina, starch and industrial starch generated a greater reduction of sulfate and a higher concentration of hydrogen sulfide compared to cellulose. Similar findings were described in the literature, where a wide range of organic materials for the effective reduction of sulfate was tested (Liamleam and Annachhatre, 2007; Moodley et al., 2017; Skousen et al., 2017; Zhang and Wang, 2014). These materials can be classified as easily-available substances (soluble sugars, starch, amino acids, and proteins) and slowly degradable biopolymers (cellulose, hemicellulose and lignin (Skousen et al., 2017). Organic macromolecules such as cellulose, starch, proteins and lipids are not a direct substrate for BRS. Therefore, it has been proposed that the SRB depends on other microorganisms that can hydrolyze these polymeric substrates, generating monomers (amino acids, sugars) and fatty acids. These monomers are fermented by other bacteria and generate small molecules like propionate, butyrate, lactate and hydrogen. The latter are the substrates of the SRB (Muyzer and Stams, 2008). Therefore, a sulfate reduction process that uses complex organic compounds requires a microbial community with a broad biodiversity. In order to know the composition of the microbial community a FISH analysis was performed. Fig. 1A, shows the composition of the microbial community of the culture with starch as substrate. Microorganisms of all the groups studied were present. Around 47% of the
Fig. 1. Fluorescence “in situ” hybridization of the microbial cultures enriched with A) starch B) Spirulina, and C) cellulose. The percentage of cells hybridized with specific probes was calculated in relation to the total number of cells stained with DAPI. The error bars correspond to the standard deviation.
microorganisms corresponded to Bacteria, while 13% of microorganisms belonged to the domain Archaea. On the other hand, the presence of SRB was detected using the probe SRB385, targeting SRB that belong to δ Proteobacteria. δ-Proteobacteria reached 14% of the total microorganisms. α-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group (CF) represented 15 and 12% respectively of the total microorganisms. Instead, the relative abundance of β- and γ-Proteobacteria were only 5 and 4%, respectively. When Spirulina was used as complex organic substrate, the microbial community was comprised by microorganisms of all the groups studied (Fig. 1B). Approximately 56% of microorganisms corresponded to Bacteria while 7% were Archaea. The δ-Proteobacteria corresponded to a considerable percentage within the microorganisms present in this culture, reaching 21% of the total. This percentage was higher to the one found using the specific probes for α-, β- and γ-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group. 74
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Fig. 1C, shows the composition of the microbial community of the culture with cellulose as substrate. All groups studied were present in this microbial culture. In this microbial consortium, 34% of the microorganisms correspond to Bacteria and near 2% of microorganisms present are Archaea; both percentages were lower as compared to what was found with the culture media with Spirulina and starch. δ-Proteobacteria within the microbial consortium reached 13% of the total microorganisms. Also, the presence of α-, β- and γ-Proteobacteria and bacteria of the Cytophaga-Flavobacterium group were detected in percentages below 9%. Therefore, these halotolerant sulfate-reducing microbial consortia were comprised by Bacteria and Archaea. Its proportion depends on the complex organic compound used for its enrichment and culture. Regarding bacteria, these belong to, at least, the phylogenetic groups of α-, β- and γ-Proteobacteria and bacteria of the CytophagaFlavobacterium group. Its ratio also depends on the type of electron donor with which it was cultured. However, independent of substrate present in the culture medium, the SRB was the predominant group. The presence of Archaea in the bacterial community can be explained by the high salinity of the culture medium used (Oren, 2015). In Spirulina, starch and cellulose, the δ Proteobacteria reach 21, 14 and 13% of the total microorganisms respectively. This group is of great importance, since most of the SRB correspond to this group (Muyzer and Stams, 2008). It is not easy to attribute a specific role to α-, β- and γ-Proteobacteria and to Cytophaga-Flavobacterium group within the microbial community. However, it could be expected that they form part of the set of microorganisms that allow the degradation of a complex substrate such as cellulose or starch, generating low molecular weight substrates useful for SRB. The presence of Cytophaga-Flavobacterium is of interest; since there are several species of this this group have the ability to degrade cellulose (McBride et al., 2014). Lu et al. (2011) proposed a similar structure for a microbial consortium maintained from rice plant waste for the treatment of AMD. For the following studies in bioreactors, starch was selected as electron donor, because of its homogeneous composition and simplicity of its management.
Fig. 2. Time course of the sulfate and hydrogen sulfide concentrations in the effluent fed with culture medium during the semi-continuous operation. Concentration of sulfate (■) and hydrogen sulfide (○) in the effluent of the bioreactor, concentration of sulfate in the original culture medium (. . .), maximum allowed sulfate concentration of the surface water standard in Chile (—) (n = 3).
the concentration of H2S and an increase in the concentration of sulfate. The high concentration of H2S could have caused a partial inhibition of the activity of sulfate-reducing bacteria (Reis et al., 1992). To evaluate the capacity of the microbial consortium to eliminate sulfate present in an AMD, a bioreactor containing Celite R-635 was used, because this bioreactor had greater capacity to reduce sulfate and greater stability of the microbial consortium inside the bioreactor. 3.3. Integration of the metal biosorption process and the sulfate reduction process To treat an AMD, it was necessary to remove toxic metals, which have an inhibitory effect on this microbial consortium. In previous experiments in culture tubes, it was found that this sulfate-reducing microbial consortium was able to grow in a culture medium with starch up to a copper concentration of 25 mg/L, while no growth was observed at concentrations higher than 50 mg/L. Similar copper-induced growth inhibition of sulfate-reducing bacteria using isolated Desulfovibrio strains (Sani et al., 2001; Cabrera et al., 2006) or complex microbial communities (Utgikar et al., 2002, 2003) was reported. For these reasons, prior to the sulfate reduction process, the AMD was treated with lime and subsequently by biosorption:
3.2. Removal of sulfate using a sulfate-reducing microbial consortium The sulfate-reducing consortium was cultured on three bioreactors with different configurations: with starch, siliceous river gravel or Celite R-635, as support material. In these experiments, a synthetic sulfate solution without toxic metals was used (culture medium). To abbreviate, only the best configuration with Celite R-635 is described below. The bioreactor, using starch as a substrate, was operated 97 days batch wise, until achieving the formation of a sulfate-reducing biofilm on Celite R-635. The operating parameters of the bioreactor are shown in Table 4. Fig. 2 presents, with dashed lines, the maximum sulfate concentration allowed by the standards for industrial discharges to surface waters in Chile. It was observed that the sulfate concentration in the bioreactor effluent was kept under this limit throughout the experiment. On day 119, the concentration of H2S increased significantly, reaching 7.1 mM. At the end of the experiment, there was a reduction in
A) Process of treatment with lime and biosorption: the AMD contained a copper concentration of 22.0 mM (1400 mg/L) and a sulfate concentration of 67.6 mM. The treatment with lime allowed reducing the sulfate concentration to 18.8 mM and the concentration of copper at 0.31 mM. To eliminate the remaining copper, a biosorption process with aggregated Bacillus biomass was used (Cotoras et al., 2009), which decreased the copper concentration to 0.028 mM. B) Sulfate reduction process: the bioreactor was initially operated with culture medium. After 10 days, the bioreactor was fed with AMD treated with lime and biosorption. Table 5 shows the operation parameters. An increase in the sulfate inlet concentration was observed when feeding with AMD. In contrast, there was a significant decrease in the sulfate concentration in the effluent (Fig. 3). It is important to note that the sulfate concentration in the effluent was lower than the maximum value allowed by the standards for industrial discharges to surface waters in Chile, except on day 18, when there was an increase in the sulfate concentration. This can be due to a very high feed rate which could be overcome by changing the speed. Eventually, it could also be an inhibitory effect caused by H2S.
Table 4 Parameters during the bioreactor with Celite R-635 as support material operation. Batch Days Recirculation (times/ d) HRT (d) pH
Semi-continuous
1–66 0
67–97 0.5
98–109 1.0
110–112 1.0
113–116 1.0
117–121 1.0
0 ND
0 ND
10 7.5
5.0 7.5
2.5 9.0
3.2 9.0
ND: not determined. 75
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
concentration using low cost organic substrates like Spirulina, cellulose and industrial starch was enriched. 2. Independent of substrate used in the culture medium, δProteobacteria was the predominant group, but an important proportion of α-, β- and γ-Proteobacteria, Cytophaga-Flavobacterium group and Archaea were also present within this microbial community. 3. Using this sulfate-reducing consortium in a packed bed bioreactor, with Celite R-635 as support, it was possible to reduce the sulfate concentration in the culture medium. 4. It was possible to removing metal and sulfate from an acid mine drainage through the synergistic combination of a treatment system by biosorption, to reduce the inhibitory concentration of metals, followed by a new process of elimination of sulfate that uses a halotolerant sulfate-reducing the microbial consortium.
Table 5 Parameters during the bioreactor operation with Celite R-635 as support fed with culture medium or AMD. Semi-continuous Days Fed with Recirculation (times/d) HRT (d) pH
1–9 Culture medium 1.0 3.3 9.0
10–13 AMD 1.0 3.3 9.0
14–18 AMD 1.0 5.0 10
19–23 AMD 1.0 5.0 11
The findings reported here show that this integrated biological process represents a more economical alternative for the removal of metal and sulfate. Acknowledgements This work was supported by InnovaChile Linea 3 – CORFO (grant number 2013-25745). References Fig. 3. Time course of the sulfate and hydrogen sulfide concentrations in the bioreactor effluent fed with AMD during the semi-continuous operation. Concentration of sulfate (■) and hydrogen sulfide (○) in the effluent of the bioreactor, concentration of sulfate in the AMD (. . .), maximum allowed sulfate concentration of the surface water standard in Chile (—) (n = 3).
Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D.A., 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microb. 56 (6), 1919–1925. Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59 (1), 143–169. Barton, L.L., Tomei, F.A., 1995. Characteristics and activities of sulphate-reducing bacteria. In: Barton, L.L. (Ed.), Sulphate-Reducing Bacteria. Springer, New York, pp. 1–32. https://doi.org/10.1007/978-1-4899-1582-5_1. Boshoff, G., Duncan, J., Rose, P.D., 2004. The use of micro-algal biomass as a carbon source for biological sulphate reducing systems. Water Res. 38, 2659–2666. https:// doi.org/10.1016/j.watres.2004.03.031. Cabrera, G., Pérez, R., Gomez, J.M., Abalos, A., Cantero, D., 2006. Toxic effects of dissolved heavy metals on Desulfovibrio vulgaris and Desulfovibrio sp. strains. J. Hazard. Mater. 135 (1–3), 40–46. https://doi.org/10.1016/j.jhazmat.2005.11.058. Costa, J.M., Rodriguez, R.P., Sancinetti, G.P., 2017. Removal sulphate and metals Fe+2, cu+2, and Zn+2 from acid mine drainage in an anaerobic sequential batch reactor. J. Environ. Chem. Eng. 5 (2), 1985–1989. https://doi.org/10.1016/j.jece.2017.04.011. Cotoras, D., Viedma, P., 2011. U.S. Patent 7 (951), 578. Cotoras, D., Valenzuela, F., Zarzar, M. and Viedma, P., 2009. U.S. Patent 7,479,220. de Godoi, L.A.G., Foresti, E., Damianovic, M.H.R.Z., 2017. Down-flow fixed-structured bed reactor: an innovative reactor configuration applied to acid mine drainage treatment and metal recovery. J. Environ. Manag. 197, 597–604. https://doi.org/10. 1016/j.jenvman.2017.04.027. Dev, S., Roy, S., Bhattacharya, J., 2017. Optimization of the operation of packed bed bioreactor to improve the sulfate and metal removal from acid mine drainage. J. Environ. Manag. 200, 135–144. https://doi.org/10.1016/j.jenvman.2017.04.102. Eaton, D.A., Clesceri, L.S., 2005a. 4500-SO42-E. Turbidimetric Method in Standard Methods for the Examination of Water & Wastewater. American Public Health Association. Eaton, D.A., Clesceri, L.S., 2005b. 4500-S2-D. Methylene Blue Method in Standard Methods for the Examination of Water & Wastewater. American Public Health Association. Hanna Instruments Inc, 2001. C99 & C 200 Series, Multi Parameter Bench Photometer, Instruction Manual, Woonsocket, Rhode Island, 02895, USA. Hao, T.W., Xiang, P.Y., Mackey, H.R., Chi, K., Lu, H., Chui, H.K., Chen, G.H., 2014. A review of biological sulphate conversions in wastewater treatment. Water Res. 65, 1–21. https://doi.org/10.1016/j.watres.2014.06.043. Hedrich, S., Johnson, D.B., 2014. Remediation and selective recovery of metals from acidic mine waters using novel modular bioreactors. Environ. Sci. Technol. 48 (20), 12206–12212. Johnson, D.B., Hallberg, K.B., 2005. Acid mine drainage remediation options: a review. Total Environ. 338 (1–2), 3–14. https://doi.org/10.1016/j.scitotenv.2004.09.002. Jong, T., Parry, D.L., 2003. Removal of sulfate and heavy metals by sulfate reducing bacteria in short-term bench scale upflow anaerobic packed bed reactor runs. Water Res. 37 (14), 3379–3389. Kaksonen, A.H., Puhakka, J.A., 2007. Sulphate reduction based bioprocesses for the treatment of acid mine drainage and the recovery of metals. Eng. Life Sci. 7, 541–564. https://doi.org/10.1002/elsc.200720216. Kefeni, K.K., Msagati, T.A., Mamba, B.B., 2017. Acid mine drainage: prevention,
In the literature, high performance sulfate removal processes using low molecular weight compounds as carbon sources and electron donors have been described. The preferred organic substrates were lactate (Remoundaki et al., 2008), ethanol (Kousi et al., 2011) and glycerol (Hedrich and Johnson, 2014; Ňancucheo and Johnson, 2014). These low molecular weight compounds are direct electron donors of the SRB, allowing establishing communities composed predominantly by this microbial group. However, these organic compounds are expensive, so they would not allow their application to the treatment of large flows of AMD. In this work, it was possible to enrich a microbial consortium capable of growing cellulose and starch, as models of low-cost agricultural waste. The low SRB ratio in this consortium may be due to the need for a wide diversity of non-sulfate-reducing bacteria to hydrolyse these polysaccharides, ferment sugars and produce substrates for the SRB. Despite the lower performance of this bioreactor, it was possible to reduce the concentration of sulfate under the Chilean standard of surface water, reaching the expected environmental objective. Jong and Parry (2003) and Dev et al. (2017) reported the simultaneous removal of sulfate and metals by sulfate reducing bacteria in an upflow anaerobic packed bed reactor using sodium lactate as electron donor. Similarly, Costa et al. (2017) showed removal sulfate and metals from acid mine drainage in an anaerobic sequential batch reactor using ethanol as carbon source. However, the process developed in this study allows treating higher metal and sulfate concentrations due to a sequential process of precipitation with lime, metal biosorption and biological reduction of sulfate. Another important difference is that in this work the removal of sulfate was carried out using low cost carbon sources such as industrial starch, Spirulina and cellulose. 4. Conclusion The following conclusions can be drawn from this study: 1. A
sulfate-reducing
consortium
able
to
reduce
the
sulfate 76
Hydrometallurgy 180 (2018) 72–77
C. Hurtado et al.
Oyewo, O.A., Agboola, O., Onyango, M.S., Popoola, P., Bobape, M.F., 2018. Current methods for the remediation of acid mine drainage including continuous removal of metals from wastewater and mine dump. In: Bio-Geotechnologies for Mine Site Rehabilitation, pp. 103–114. https://doi.org/10.1016/B978-0-12-812986-9. 00006-3. Reis, M.A.M., Almeida, J.S., Lemos, P.C., Carrondo, M.J.T., 1992. Effect of hydrogen sulfide on growth of sulphate reducing bacteria. Biotechnol. Bioeng. 40, 593–600. https://doi.org/10.1002/bit.260400506. Remoundaki, E., Kousi, P., Joulian, C., Battaglia-Brunet, F., Hatzikioseyian, A., Tsezos, M., 2008. Characterization, morphology and composition of biofilm and precipitates from a sulphate-reducing fixed-bed reactor. J. Hazard. Mater. 153 (1–2), 514–524. Sani, R.K., Peyton, B.M., Brown, L.T., 2001. Copper-induced inhibition of growth of Desulfovibrio desulfuricans G20: assessment of its toxicity and correlation with those of zinc and lead. Appl. Environ. Microb. 67 (10), 4765–4772. https://doi.org/10.1128/ AEM.67.10.4765-4772.2001. Skousen, J., Zipper, C.E., Rose, A., Ziemkiewicz, P.F., Nairn, R., McDonald, L.M., Kleinmann, R.L., 2017. Review of passive systems for acid mine drainage treatment. Mine Water Environ. 36 (1), 133–153. https://doi.org/10.1007/s10230-016-0417-1. Sousa, J.A., Plugge, C.M., Stams, A.J., Bijmans, M.F., 2015. Sulphate reduction in a hydrogen fed bioreactor operated at haloalkaline conditions. Water Res. 68, 67–76. https://doi.org/10.1016/j.watres.2014.09.035. Tait, S., Clark, W.P., Keller, J., Batstone, D.J., 2009. Removal of sulphate from highstrength wastewater by crystallisation. Water Res. 43, 762–772. https://doi.org/10. 1016/j.watres.2008.11.008. Utgikar, V.P., Harmon, S.M., Chaudhary, N., Tabak, H.H., Govind, R., Haines, J.R., 2002. Inhibition of sulphate-reducing bacteria by metal sulfide formation in bioremediation of acid mine drainage. Environ. Toxicol. 17 (1), 40–48. https://doi.org/10.1002/tox. 10031. Utgikar, V.P., Tabak, H.H., Haines, J.R., Govind, R., 2003. Quantification of toxic and inhibitory impact of copper and zinc on mixed cultures of sulphate-reducing bacteria. Biotechnol. Bioeng. 82, 306–312. https://doi.org/10.1002/bit.10575. Wei, X., Rodak, C.M., Zhang, S., Han, Y., Wolfe, F.A., 2016. Mine drainage generation and control options. Water Environ. Res. 88 (10), 1409–1432. https://doi.org/10.2175/ 106143016X14696400495136. Zhang, M., Wang, H., 2014. Organic wastes as carbon sources to promote sulphate reducing bacterial activity for biological remediation of acid mine drainage. Miner. Eng. 69, 81–90. https://doi.org/10.1016/j.mineng.2014.07.010.
treatment options, and resource recovery: a review. J. Clean. Prod. 151, 475–493. https://doi.org/10.1016/j.jclepro.2017.03.082. Kousi, P., Remoundaki, E., Hatzikioseyian, A., Battaglia-Brunet, F., Joulian, C., Kousteni, V., Tsezos, M., 2011. Metal precipitation in an ethanol-fed, fixed-bed sulphate-reducing bioreactor. J. Hazard. Mater. 189 (3), 677–684. Liamleam, W., Annachhatre, A.P., 2007. Electron donors for biological sulphate reduction. Biotechnol. Adv. 25 (5), 452–463. https://doi.org/10.1016/j.biotechadv.2007. 05.002. Lu, J., Chen, T., Wu, J., Wilson, P.C., Hao, X., Qian, J., 2011. Acid tolerance of an acid mine drainage bioremediation system based on biological sulfate reduction. Bioresour. Technol. 102 (22), 10401–10406. https://doi.org/10.1016/j.biortech. 2011.09.046. Manz, W., Amann, R., Ludwig, W., Wagner, M., Schleifer, K.H., 1992. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst. Appl. Microbiol. 15 (4), 593–600. Manz, W., Amann, R., Ludwig, W., Vancanneyt, M., Schleifer, K.H., 1996. Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 142 (5), 1097–1106. https://doi.org/10.1099/13500872-142-5-1097. McBride, M.J., Liu, W., Lu, X., Zhu, Y., Zhang, W., 2014. The family cytophagaceae. In: The Prokaryotes. Springer Berlin Heidelberg, pp. 577–593. McMahon, M.J., Daugulis, A.J., 2008. Gas phase H2S product recovery in a packed bed bioreactor with immobilized sulfate-reducing bacteria. Biotechnol. Lett. 30, 467–473. https://doi.org/10.1007/s10529-007-9566-4. Mezgebe, B., Sorial, G.A., Sahle-Demessie, E., Hassan, A.A., Lu, J., 2017. Performance of anaerobic biotrickling filter and its microbial diversity for the removal of stripped disinfection by-products. Water Air Soil Poll. 228, 437–448. https://doi.org/10. 1007/s11270-017-3616-x. Moodley, I., Sheridan, C.M., Kappelmeyer, U., Akcil, A., 2017. Environmentally sustainable acid mine drainage remediation: research developments with a focus on waste/ by-products. Miner. Eng. https://doi.org/10.1016/j.mineng.2017.08.008. Muyzer, G., Stams, A.J., 2008. The ecology and biotechnology of sulphate-reducing bacteria. Nat. Rev. Microbiol. 6 (6), 441. https://doi.org/10.1038/nrmicro1892. Ňancucheo, I., Johnson, D.B., 2014. Removal of sulfate from extremely acidic mine waters using low pH sulfidogenic bioreactors. Hydrometallurgy 150, 222–226. Oren, A., 2015. Halophilic microbial communities and their environments. Curr. Opin. Biotech. 33, 119–124. https://doi.org/10.1016/j.copbio.2015.02.005.
77