Design, synthesis and in vitro evaluation of fangchinoline derivatives as potential anticancer agents

Bioorganic Chemistry xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Bioorganic Chemistry journal homepage: www.elsevier.com/locate/bioorg

Design, synthesis and in vitro evaluation of fangchinoline derivatives as potential anticancer agents Yan-chun Zhanga,1, Xiu-zheng Gaoa,1, Chao Liub, , Mu-xuan Wanga, Rui-rui Zhangb, ⁎ ⁎ Jin-yue Sunb, , Yu-fa Liua, ⁎

a

College of Chemistry, Chemical Engineering and Materials Science, Collaborative Innovation Center of Functionalized Probes for Chemical Imaging in Universities of Shandong, Key Laboratory of Molecular and Nano Probes, Ministry of Education, Shandong Provincial Key Laboratory of Clean Production of Fine Chemicals, Shandong Normal University, 88 East Wenhua Road, Jinan 250014, PR China b Key Laboratory of Novel Food Resources Processing, Ministry of Agriculture and Rural Affairs/Key Laboratory of Agro-Products Processing Technology of Shandong Province/Institute of Agro-Food Science and Technology, Shandong Academy of Agricultural Sciences, 202 Gongye North Road, Jinan 250100, PR China

ARTICLE INFO

ABSTRACT

Keywords: Fangchinoline derivatives Anti-proliferative Apoptosis-inducing Molecular mechanisms

The isolation and modification of natural products play an important role in the synthesis of anti-tumor drugs for the treatment of cancer. The present study was designed to evaluate the effects of fangchinoline derivatives against cancer cells. In vitro cytotoxicity of all derivatives against five cancer cell lines (A549, Hela, HepG-2, MCF-7 and MDA-MB-231 cell lines) and HL-7702 normal cells was assessed using the CCK-8 assay, and the results showed that most of the synthesized compounds displayed better cytotoxic effects on all the tested cells compared to that of the parent fangchinoline. In particular, compound 3i had the strongest inhibitory effect on cell proliferation, with an IC50 value of 0.61 µM against A549 cells. Compared with fangchinoline and HCPT (hydroxycamptothecine), the anti-proliferative activity of compound 3i was significantly increased. More interestingly, compound 3i had slight toxic side effects on normal cells, with an IC50 value of 27.53 µM. Moreover, the cell viability and cell cycle assays revealed that compound 3i inhibited A549 cell proliferation and arrested A549 cells at the G2/M-phase. The apoptosis-inducing effects of compound 3i and the associated molecular mechanisms were assessed using flow cytometry, cell staining, reactive oxygen species assays, RT-qPCR and Western blot analysis. These results suggested that compound 3i induces apoptosis through a mitochondriamediated intrinsic pathway. This study revealed that compound 3i is a promising candidate for future development as an anti-tumor drug.

1. Introduction Cancer is one of the most crucial public health concerns across the world. In particular, lung cancer has the highest morbidity and mortality and is one of the most dangerous malignant cancers to human health and life [1]. Non-small cell lung cancer (NSCLC) accounts for approximately 75–85% of all lung cancers. It is clinically found to occur in advanced stages and often produces resistance to radiation and chemotherapy; therefore, patients have a 5-year survival rate of < 15% [2]. Despite improvements in early detection and treatment of NSCLC in the past two decades, certain patients still suffer rapid disease recurrence and progression [3]. Therefore, the development of effective agents and novel strategies for the treatment of lung cancer is extremely urgent.

Chemotherapy and radiotherapy have been the most widely used and potential strategies for the treatment of cancer among various interventions [4]. Although ideal chemotherapeutic drugs should target cancer cells via cancer-specific receptors, proteins or DNA, the use of chemotherapy is limited mainly by their adverse effects on normal cells. Therefore, it is urgent to develop a low-toxic and high-efficiency anti-tumor drug [5]. Natural products have evolved over millions of years and have a unique chemical diversity, which results in diversity in their biological activities and drug-like properties [6]. Natural products will undergo continual development and use toward meeting the urgent need of developing effective drugs, and they will play a leading role in the discovery of drugs for treating human diseases, especially critical diseases [7]. Stephania tetrandra S. Moore, which contains many bisbenzylisoquinoline alkaloids such as tetrandrine and fangchinolinethe [8], is

Corresponding authors. E-mail addresses: [email protected] (C. Liu), [email protected] (J.-y. Sun), [email protected] (Y.-f. Liu). 1 These authors contributed equally to this work. ⁎

https://doi.org/10.1016/j.bioorg.2019.103431 Received 6 October 2019; Accepted 8 November 2019 0045-2068/ © 2019 Elsevier Inc. All rights reserved.

Please cite this article as: Yan-chun Zhang, et al., Bioorganic Chemistry, https://doi.org/10.1016/j.bioorg.2019.103431

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

traditionally used for analgesic, antirheumatic, and antihypertensive drugs in China [9]. Pharmacological experiments and clinical reports show that tetrandrine and fangchinoline have multiple pharmacological activities, including antitumor [10–16], anti-inflammatory [17,18], multidrug resistance [19–23], antioxidant [24], and others effects. In particular, the good anti-cancer bioactivity of these two alkaloids have made them attractive for anti-cancer drug research and development. Related studies on the molecular mechanism previously indicated that fangchinoline could induce autophagy via P53/sestrin2/AMPK signaling in human hepatocellular carcinoma cell lines, namely, Hep-G2 and PLC/PRF/5 cell lines. Tetrandrine, which has a similar chemical structure, has been reported to arrest the G1/S and G2/M cell cycle and stimulate apoptotic cell death and autophagy via PKC-alpha inhibition and mTOR-dependent. However, little research concerning the derivatization and evaluation of fangchinoline in human lung carcinoma cells has been released [10,14,25]. Based on the previous research in our laboratory [16], the introduction of a benzyl group to fangchinoline can significantly improve its anticancer activity. It is well known that the introduction of fluorine atoms or fluorine-containing groups to drugs is one of the important research strategies for the chemical structural transformation of drugs. Among them, one of the most famous ones is the earliest synthetic fluorine-containing drug 5-fluorouracil [26]. Since the advent of 5fluorouracil, the introduction of fluorine atoms has been widely used in drug modification. Inspired by the above information, in this study, as a continuation of our previous work to study and develop high-efficiency and low-toxic anti-tumor lead compounds, a series of fangchinoline derivatives including those that contained fluorine (10 compounds) and those that did not contain fluorine (11) were designed and synthesized. Results showed that all of the derivatives, especially compound 3i, were proved to significantly increase the anti-proliferative activity of cancer cells compared to that of fangchinoline and HCPT (hydroxycamptothecine). More interestingly, compound 3i had slight toxic side effects on normal cells. Therefore, the related molecular mechanism including the anti-proliferative and apoptosis-inducing effects of compound 3i on A549 cells were primarily elucidated in this paper.

Hep-G2, MCF-7 and MDA-MB-231 cell lines. The HCPT and parent compound (fangchinoline) were used as the reference standards. As shown in Table 1, although 18 of the 21 derivatives exhibited significant activity (IC50 < 10 µM) against the tested cancer cells, the compound 3i was found to be the most potent against A549 cells with an IC50 value of 0.61 µM, which increased 12 times that of fangchinoline. HL-7702, a normal human hepatocyte, was also used to assess the cytotoxic effect of all the derivatives. The results showed that the hepatocytes were less susceptible to the cytotoxic effect of compound 3i with an IC50 value of 27.52 μM compared with that of other tumor cells and the commercial anticancer drug HCPT. Therefore, compound 3i was selected to further study the anti-cancer mechanism. Based on the fangchinoline derivatives (Table 1), the preliminary structure-activity relationship (SAR) can be evaluated. The substitution of benzyl units in fangchinoline is the key pharmacophore to significantly enhance the antitumor activity of the compounds. For derivatives, introducing withdrawing groups (eF, eCl, eBr, eI, eCF3 or eCH3) to the benzyl groups can significantly increase their anticancer activity. In particular, the introduction of a fluorine atom or a fluorinecontaining group can significantly enhance the anticancer activity; however, the introduction of NO2 actually reduces the activity, and the possible reason is that the electron absorption of NO2 is too strong. The introduction of a fluorine atom or a fluorine-containing group can affect the absorption process of the drug, thereby improving the bioavailability [27,28]; it can also enhance the metabolic stability of the drug and prolong the action time of the drug in the body [29–31]. In addition, the introduction of a fluorine atom or a fluorine-containing group can affect drug toxicity. Sometimes the introduction of fluorine atoms can effectively reduce the toxicity of the drug. For example, the introduction of a fluorine atom in methotrexate can effectively reduce cytotoxicity [32]. 2.3. Compound 3i inhibits A549 cell proliferation and colony formation To examine the effect of compound 3i on the growth of lung cancer cells, cell viability experiments were designed, and the results are shown in Fig. 1a. It was observed that 3i potently and distinctly inhibited cell proliferation in a time- and dose-dependent manner. The treatment of A549 cells with 2 μM 3i for 48 h resulted in a 50% loss of cell viability. To further evaluate the effect of 3i on the proliferation of cancer cells, a plate colony formation assay was performed. As shown in Fig. 1b, the colony-forming ability of A549 cells decreased in a dosedependent manner in the presence of 3i, and almost no colonies were observed upon treatment with 4 µM of 3i compared with that of the control group.

2. Results and discussion 2.1. Synthesis of fangchinoline derivatives The interesting biological activity of fangchinoline against various types of cancers led us to the modify and evaluate the synthesized compounds in efforts to identify a more potent anti-tumor agent. As we continued to search for antitumor lead compounds, the objective of this study was to synthesize fangchinoline-derived compounds and evaluate their effects against cancer cell proliferation. Hence, a series of 21 novel fangchinoline derivatives were synthesized in two or three steps from fangchinoline and evaluated against five cancer cells. Briefly, in route A (Scheme 1), the fangchinoline in DMF was treated with NaH at 0 °C for 2 h, stirring under the protection of N2 to deliver sodium alcoholate. Then, the sodium atoms were replaced by different halogenated hydrocarbons to obtain the final derivatives 3a-3 m. The progress of the chemical reaction was followed by TLC analyses, and all 13 new compounds were obtained with a yield of 69.6–93.1%. The synthesis of the quaternary ammonium salt derivative was carried out according to route B (Scheme 1). Similar to that of route A, the fangchinoline was first reacted with NaH to form sodium alcoholate, and then the intermediate was further heated to 92 °C to finally obtain the fangchinoline derivatives 4a-4h. The 21 derivatives were characterized according to HR-MS, 1H NMR and 13C NMR spectra.

2.4. Compound 3i induces G2/M cell cycle arrest in lung cancer cells To determine whether the inhibitory effect of compound 3i on cancer cell growth is caused by cell cycle progression, A549 cells were treated with compound 3i at different concentrations (0, 1, 2 and 4 µM) for 48 h (Fig. 2a-b). The cell cycle was analyzed using flow cytometry after the DNA was stained with propyl iodide (PI). As shown in Fig. 2e, the percentage of A549 cells in the G1 phase decreased from 74.58% to 69.67%, 58.29% and 56.92%, while the percentage of cells in the G2/M phase increased from 5.82% to 6.07%, 13.09% and 17.15%, respectively. As a result, compound 3i caused significant G2/M phase arrest in a concentration-dependent manner accompanied by a reduction in the number of cells in the G1 phase of the cycle. 2.5. Compound 3i affects cell cycle-related protein expression in A549 cells Among the various cell cycle checkpoint proteins participating in the evolution of the cell cycle, the cyclin A-CDK1 complex is required for passage into the late S/G2 phase while the cyclin B1-CDK1 complex is involved in G2/M transition [33]. The activity of these CDKs is

2.2. Cytotoxic activity of fangchinoline derivatives The CCK-8 assay was used to test the cytotoxicity of the available derivatives against five human cancer cell lines, including Hela, A549, 2

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

Scheme 1. Synthesis of fangchinoline derivatives 3a-3 m, 4a-4 h. Reagents and conditions: (a) RBr, NaH, DMF, 0 °C; (b) RBr, NaH, DMF, 25 °C to 92 °C.

apoptosis is related to the production of ROS in cells. Higher levels of ROS are known to induce oxidative DNA damage and subsequent cell cycle arrest [37]. Reactive oxygen species (ROS) is an important redox molecule in cells that can induce the opening of the mitochondrial permeability transition pore (MPTP), release calcium ions, cytochrome C and apoptosis-inducing factor AIF, and induce caspase 9 to activate caspase 3/6/7 to induce endogenous cell apoptosis [38].

regulated by inhibitor P21 [34]. To determine the underlying molecular mechanism of compound 3i-induced G2/M phase arrest, CDK1, cyclin B1, and P21 were selected for investigation in this study using RT-qPCR and Western blot analysis. As shown in Fig. 3a and b, compared with control cells, compound 3i decreased the expression of CDK1 and cyclin B1 in a dose-dependent manner, while the expression of CDK inhibitor protein P21 was upregulated in A549 cells. Meanwhile, the RT-qPCR results were consistent with the Western blot results, as shown in Fig. 3c. Consequently, the results showed that 3i arrested A549 cells in the G2/M phase in lung cancer cells, which might be related to disruption of the cell cycle progression.

2.8. Compound 3i reduces the mitochondrial membrane potential The compound 3i–induced increase in the total ROS level (Fig. 5) may contribute to increased mitochondrial dysfunction and lead to mitochondria–mediated apoptosis. The changes in mitochondrial membrane potential was also designed and detected to further study the apoptotic induction effect of target compound 3i using the fluorescent probe JC-1. JC-1 is a lipophilic dye that easily enters cells through the plasma membrane and accumulates in the active breathing mitochondria. A549 cells were treated with different concentrations of compound 3i (0, 1, 2 and 4 µM) for 48 h and stained with JC-1 dye. The JC-1 monomer and JC-1 aggregate were activated at 514 and 585 nm, respectively. The fluorescence of the mitochondrial membrane potential of normal cells stained with JC-1 dye was red (JC-1 aggregate), while the mitochondrial membrane potential of apoptotic cells was green (JC1 monomer). Fig. 6 shows that cells treated with unused compounds were usually red, while cells treated with 3i showed strong green fluorescence and typical apoptotic morphology. Therefore, it can be concluded that compound 3i induces apoptosis in A549 cells in a concentration-dependent manner. These results are the same as those of flow cytometry and Hoechst 33,258 staining.

2.6. Compound 3i induced apoptosis in lung cancer cells Annexin V-FITC/PI double staining was used to determine the rate of apoptosis. As shown in Fig. 4a-b, compared with the control group, 3i (1, 2 and 4 µM) significantly increased A549 cell apoptosis in a dosedependent manner (p < 0.01). Cells experiencing apoptosis exhibit morphological characteristics, such as cell shrinkage, nuclear fragmentation, chromatin agglutination and apoptotic body formation. Hoechst 33,258 is a nuclear dye that can reflect apoptosis. After treatment with compound 3i, the A549 cells were stained with Hoechst 33,258 and observed using fluorescence microscopy. As shown in Fig. 4c, as the concentration of compound 3i increased, the number of A549 nuclei that were stained bright blue increased and exhibited typical apoptotic features, cell shrinkage, and chromatin condensation. These results suggest that the potential mechanism of the antiproliferative activity of compound 3i is via the induction of apoptosis. 2.7. Compound 3i induced intracellular ROS generation

2.9. Compound 3i affects apoptosis-related gene and protein expression in A549 cells

Reactive oxygen species (ROS) are a class of oxides that are directly or indirectly converted from molecular oxygen and have more active chemical reactivity than molecular oxygen. Previous studies have shown that when the balance of ROS production and clearance breaks down, ROS can affect the expression of cytokines by damaging mitochondria, activating death receptors, and participating in a series of biological functions such as cell signal transduction [35,36]. DCFH-DA was used to evaluate the generation of ROS. As shown in Fig. 5, when A549 cells were exposed to different concentrations of 3i for 48 h, ROS increased significantly in a dose-dependent manner compared with that of untreated cells (p < 0.01). It is suggested that the 3i-induced

Flow cytometry and staining results showed that compound 3i was able to induce apoptosis in lung cancer cells. However, the apoptotic signaling pathway is regulated by multiple proteins. Mitochondrial triggering events are tightly regulated by the Bcl-2 protein family [39]. These proteins have been shown to play an important role in apoptosis, including pro-apoptotic proteins (Bax, Bad and Bid) and anti-apoptotic proteins (Bcl-2 and Bcl-XL), which are essential for regulating mitochondrial apoptosis. In normal cells, there is an appropriate balance between apoptotic and anti-apoptotic Bcl-2 family proteins, which 3

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

Table 1 Cytotoxic activity of the examined compounds against 6 cell lines. Compound

Structure

IC50 (µM)

R1

X

A549

Hela

HepG-2

MCF-7

MDA-MB-231

HL-7702

3a

–

–

5.616

2.50

4.332

3.298

7.293

33.086

3b

–

–

8.277

5.007

0.96

4.397

6.184

25.68

3c

–

–

4.923

5.668

2.705

4.283

6.823

17.485

3d

–

–

7.955

4.452

1.781

4.789

5.249

24.691

3e

–

–

10.96

5.558

1.659

3.397

5.290

29.117

3f

–

–

7.67

9.183

1.075

2.371

6.291

12.074

3g

–

–

6.517

4.298

1.558

5.283

5.391

23.098

3h

–

–

5.24

17.9

3.578

9.102

15.392

17.962

3i

–

–

0.61

1.56

0.808

1.293

4.721

27.53

3j

–

–

2.68

3.98

3.29

6.259

8.392

24.394

3k

–

–

1.943

9.95

3.181

5.291

11.291

18.022

3l

–

–

1.466

8.997

2.016

4.192

9.201

16.476

3m

–

–

2.82

3.17

0.55

3.45

6.723

19.332

4a

Br

8.58

9.95

9.13

10.492

13.209

23.112

4b

Br

4.65

13.66

9.95

12.371

14.591

21.032

4c

Br

3.29

4.04

3.82

5.291

9.302

20.013

4d

Br

3.05

7.64

6.91

7.385

9.839

22.127

4e

Br

4.20

7.64

3.96

6.391

7.320

26.384

4f

Br

7.81

17.92

10.31

12.921

11.322

19.047

4g

Br

5.13

10.49

9.39

7.930

10.482

22.192

4h

Br

2.32

4.48

3.42

4.201

7.491

16.98

– –

7.34 1.03

11.5 1.82

9.03 1.13

10.48 1.572

11.021 2.061

19.381 38.69

DTET HCPT

-H –

– –

integrate different death and survival signals to control cell fate [40]. To evaluate the effect of 3i on the mitochondrial-dependent apoptotic pathway, A549 cells were treated with 1, 2 and 4 µM for 48 h, and total cell lysates were prepared for Western blot analysis. As shown in Fig. 7, compared with the control group (0 µM), the expression of Bcl-2 protein and Bax protein decreased after 3i treatment (1, 2 and 4 µM), indicating

that the proportion of Bax/Bcl-2 in the 3i-treated cells increased significantly, and the increase was dose-dependent. The results showed that 3i treatment could change the ratio of Bax to Bcl-2, resulting in the collapse of the mitochondrial membrane potential. After the loss of the mitochondrial membrane potential, cytochrome C was released into the cytosol, leading to a cascade reaction of the 4

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

Fig. 1. 3i inhibits A549 cell proliferation and colony formation. (a) A549 cells were treated with various concentrations of 3i for indicated time points and assessed by CCK-8 assay. (b) The cloning ability was determined by colony formation assay in A549 cells. Representative images of the A549 cell colonies after treatment of 0, 1, 2 and 4 μM 3i for 7 day were shown.

apoptotic complex and caspase. In this study, cytochrome C released into the cytoplasmic fractions was studied after 3i treatment (Fig. 7). The results showed that the expression of cytochrome C in A549 cells increased in a dose-dependent manner, suggesting that 3i could regulate the apoptosis of A549 cells through a mitochondrial-mediated pathway. The release of cytochrome C leads to the activation of caspase-9, and then caspase-9 continues to process and activate other downstream caspase, including caspase-3, leading to the decomposition of many downstream molecules, including PARP, and the final execution stage of cell death [41]. To determine whether the caspase-mediated pathway was also involved in apoptosis of A549 cells induced by 3i, the levels of cleaved caspase-3 and cleaved caspase-9 were determined by Western blot analysis. The levels of caspase-3 and caspase9 increased in a dose-dependent manner, as shown in Fig. 7. In addition, the RT-qPCR results support Western blotting, as shown in Fig. 7. In conclusion, an increase in the ratio of Bax/Bcl-2 leads to the collapse of the mitochondrial membrane potential, followed by the release of cytochrome C and the activation of the cascade reaction of cysteine protease, leading to PARP cleavage and the final stage. Taken together, mechanical analysis showed that compound 3i had a time- and dose-dependent blocking effect on the activation of P21, cyclin-B1 and CDK1. At the same time, compound 3i induced cell death through the endogenous apoptotic pathway, which involves the activation of Bcl-2, Bax, cytochrome C, caspase-9 and caspase-3, suggesting that the fangchinoline derivative 3i can be used as a potential anticancer candidate drug.

0 M

1 M

2 M

4 M

3. Experimental 3.1. General 1

H NMR and 13C NMR spectra were obtained using a Bruker AV400 spectrometer in CDCl3 or CD3OD with tetramethylsilane as the internal standard. HRMS data were obtained on a UHR-TOF-MS instrument (BRUKER). The reaction progress was monitored by thin-layer chromatography on silica gel GF-254. The purity of compound 3i (94% purity) was determined using HPLC with gradient elution 65–100% MeOH/H2O (0.8 mL/min, 50 min) following another 100% MeOH (0.8 mL/min, 10 min) as the isocratic solvent system, and its HPLC spectra is shown in the supporting information (Fig. 1S). 3.2. Chemicals and reagents The mixture of stirred DTET (100 mg, 0.16 mmol) and NaH (20 mg, 0.83 mmol) was dissolved in 2 mL DMF at 0 °C. Then, R1Br (0.18 mmol) dissolved in 0.5 mL DMF was added to the DTET solution, and the mixture was stirred until the TLC analysis showed that the reaction was completed. The temperature of the mixture was cooled to room temperature and vacuum evaporated. The residue was purified using aluminum column chromatography, and 3a-3m were obtained using CH2Cl2/CH3OH as the eluent. 3a,7-O-(o-F-Benzyl)-DTET, 1H NMR (CDCl3, 400 MHz) δ 7.25 (d, J = 7.6 Hz, 1H), 7.15–7.01 (m, 2H), 6.91 (d, J = 4.7 Hz, 2H), 6.81 (dt, J = 13.7, 8.6 Hz, 3H), 6.70 (d, J = 7.6 Hz, 1H), 6.43 (d, J = 9.0 Hz, 2H), 6.30–6.16 (m, 2H), 5.73 (s, 1H), 4.58 (d, J = 11.5 Hz, 1H), 4.37 Fig. 2. 3i induces G2 phase accumulation. (a- d) A549 cells were treated with 3i of 0,1,2 and 4 µM for 48 h, and the cell cycle distribution was detected with flow cytometry. (e) Quantification of flow cytometry analysis of cell cycle distribution. ***P < 0.001 compared with the population of cells in G2 phase in the control group.

5

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

a

0 M

1 M

2 M

4 M

b

c

P21 CDK1 CyclinB1 GAPDH Fig. 3. 3i effects cell cycle related protein expression in A549 cells. (a) Western blotting analysis of the expression of Cyclin B1, P21, and CDK1. GAPDH was used as a loading control. (b) The relative expression level of protein was quantified. (c) RT-PCR analyses of relative normalized expression of Cyclin B1, CDK1 and P21. The data represented as mean ± SD of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

(d, J = 11.6 Hz, 1H), 3.84 (s, 3H), 3.63 (s, 3H), 3.53–3.32 (m, 2H), 3.28 (s, 3H), 3.24–2.93 (m, 2H), 2.92–2.38 (m, 10H), 2.36 (s, 3H), 2.23 (d, J = 22.0 Hz, 3H). 13C NMR (CDCl3, 100 MHz) δ 160.31, 157.86, 152.79, 150.36, 148.34, 147.81, 147.38, 146.09, 142.95, 135.61, 133.89, 133.77, 131.60, 129.39, 127.96, 127.46, 126.94, 126.50, 123.74, 122.76, 122.12, 121.79, 120.81, 119.34, 115.20, 113.72, 113.51, 111.84, 110.54, 105.00, 66.33, 63.02, 60.45, 55.11, 54.86, 54.76, 44.51, 43.20, 41.35, 41.28, 40.91, 39.15, 23.57, 21.13; HRMS (ESI) : calcd for C44H45FN2O6 m/z: 717.3295, found: 718.3466 [M + H]+. Yield: 83%. 3b, 7-O-(m-F-Benzyl)-DTET, 1H NMR(400 MHz, CDCl3) δ 7.34(dd, J = 8.2, 2.1 Hz, 1H), 7.21–7.17 (m, 1H), 7.16–7.14 (m, 1H), 7.14–7.11 (m, 1H), 6.92–6.90 (m, 1H), 6.88 (dd, J = 5.0, 3.2 Hz, 2H), 6.80 (dd, J = 8.3, 2.5 Hz, 1H), 6.74 (dd, J = 11.7, 9.0 Hz, 2H), 6.54–6.50 (m, 2H), 6.35–6.29 (m, 2H), 5.88 (s, 1H), 4.59 (d, J = 11.0 Hz, 1H), 4.22 (d, J = 11.0 Hz, 1H), 3.93 (s, 3H), 3.77 (s, 1H), 3.73 (s, 3H), 3.70 (dd, J = 6.2, 4.1 Hz, 1H), 3.57–3.50 (m, 1H), 3.48–3.43 (m, 1H), 3.38 (d, J = 4.6 Hz, 3H), 3.27 (dd, J = 12.6, 5.6 Hz, 1H), 2.95–2.89 (m, 2H), 2.83–2.77 (m, 2H), 2.74–2.68 (m, 2H), 2.53 (s, 1H), 2.50 (s, 1H), 2.45 (s, 3H), 2.34 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 163.80, 161.37,

a

0 M

153.73, 151.26, 149.41, 148.79, 148.43, 147.04, 143.86, 140.09, 136.48, 135.27, 134.86, 132.63, 130.17, 129.40, 128.59, 128.25, 123.50, 122.75, 121.92, 120.27, 116.19, 114.88, 114.66, 114.38, 114.17, 112.95, 111.54, 106.00, 73.40, 64.11, 61.42, 60.29, 55.95, 45.76, 44.12, 42.84, 42.00, 40.26, 29.72, 29.34, 24.98, 22.06; HRMS (ESI): calcd for C44H45FN2O6: 717.3295 [M + H]+, found: 717.3269 [M + H]+. Yield: 75%. 3c,7-O-(p-F-Benzyl)-DTET, 1H NMR (400 MHz, CDCl3) δ 7.32 (d, J = 7.3 Hz, 1H), 7.17–7.10 (m, 1H), 6.95 (dd, J = 12.6, 6.9 Hz, 3H), 6.91–6.85 (m, 3H), 6.83–6.75 (m, 1H), 6.52 (d, J = 8.4 Hz, 2H), 6.31 (d, J = 11.0 Hz, 2H), 5.85 (s, 1H), 4.56 (d, J = 10.5 Hz, 1H), 4.20 (d, J = 10.5 Hz, 1H), 3.91 (d, J = 12.0 Hz, 3H), 3.72 (s, 3H), 3.60–3.40 (m, 2H), 3.37 (d, J = 8.8 Hz, 3H), 3.31–3.00 (m, 2H), 2.99–2.67 (m, 8H), 2.55 (s, 3H), 2.52–2.41 (m, 2H), 2.34 (s, 3H). 13C NMR (CDCl3, 100 MHz) δ 163.55, 161.11, 153.75, 151.39, 149.43, 148.78, 148.52, 147.13, 143.95, 136.68, 135.12, 134.68, 133.31, 132.65, 130.15, 130.09, 130.01, 128.43, 128.26, 128.10, 123.12, 122.82, 121.91, 120.23, 116.14, 114.89, 114.68, 112.94, 111.59, 106.04, 73.62, 64.07, 61.51, 56.16, 55.93, 55.83, 45.65, 44.29, 42.60, 42.41, 41.98, 39.05, 25.36, 22.23; HRMS (ESI): calcd for C44H45FN2O6 m/z: 717.3295,

b

1 M

c 2 M

0 M

1 M

4 M

2 M

4 M

Fig. 4. 3i induce apoptosis of lung cancer cells. (a, b). The apoptosis of A549 cells following 48 h of different concentrations CTEO treatment was detected by flow cytometry. Q1-UL, Q1-UR, Q1-LL and Q1-L represent necrotic, late apoptotic, normal, and early apoptotic cells, respectively. (c). Hoechst-positive cells were observed under a fluorescence microscope **P < 0.01, ***P < 0.001 compared with control cells. 6

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

Fig. 5. 3i induces reactive oxygen species generation in A549 cells. (a) A549 cells were treated with 0, 1, 2 and 4 μM 3i for 48 h. ROS production was analyzed and quantitated by a fluorescence spectrophotometer. (b) Statistical results were represented as mean ± SD of three independent experiments in A549 cells. *P < 0.05, **P < 0.01, ***P < 0.001.

found: 718.3468[M + H]+. Yield: 88.2%. 3d, 7-O-(m-Cl-Benzyl)-DTET, 1H NMR (400 MHz, CDCl3) δ 7.33 (dd, J = 8.2, 1.8 Hz, 1H), 7.19–7.09 (m, 3H), 7.06 (s, 1H), 6.89 (dd, J = 8.2, 1.4 Hz, 1H), 6.84 (dd, J = 7.7, 3.3 Hz, 2H), 6.78 (dd, J = 8.2, 2.4 Hz, 1H), 6.52 (s, 2H), 6.34–6.26 (m, 2H), 5.82 (s, 1H), 4.57 (d, J = 11.2 Hz, 1H), 4.18 (d, J = 11.2 Hz, 1H), 3.90 (s, 3H), 3.71 (s, 3H), 3.58–3.39 (m, 2H), 3.37 (s, 3H), 3.31–2.99 (m, 2H), 2.98–2.60 (m, 8H), 2.56–2.46 (m, 2H), 2.44 (s, 3H), 2.33 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 162.53, 153.79, 151.26, 149.40, 148.72, 148.52, 147.09, 143.87, 139.65, 136.42, 135.06, 134.77, 133.75, 132.62, 130.22, 129.27, 128.60, 128.25, 127.92, 127.87, 127.57, 125.97, 123.08, 122.86, 121.89, 120.31, 116.23, 112.93, 111.61, 106.04, 73.32, 64.00, 61.45, 56.14, 56.05, 55.81, 45.54, 44.22, 42.40, 41.95, 39.75, 29.89, 24.84, 22.18; HRMS (ESI): calcd for C44H45ClN2O6: 733.3000[M + H]+, found: 733.3074[M + H]+. Yield: 83.1%. 3e, 7-O-(m-Br-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.26–7.20 (m, 2H), 7.15 (s, 1H), 7.03 (dd, J = 8.2, 2.4 Hz, 1H), 6.96 (t, J = 7.8 Hz, 1H), 6.81–6.75 (m, 3H), 6.68 (dd, J = 8.3, 2.4 Hz, 1H), 6.42 (d, J = 7.8 Hz, 2H), 6.20 (dd, J = 9.7, 2.9 Hz, 2H), 5.72 (s, 1H), 4.48 (d, J = 11.2 Hz, 1H), 4.08 (d, J = 11.2 Hz, 1H), 3.81 (s, 3H), 3.62 (s, 3H), 3.57–3.34 (m, 2H), 3.27 (s, 3H), 3.12 (dd, J = 12.7, 5.7 Hz, 2H), 2.83 (dt, J = 16.9, 7.7 Hz, 4H), 2.74 (d, J = 5.0 Hz, 2H), 2.70–2.63 (m, 2H),

0 M

2.59 (dd, J = 8.9, 4.6 Hz, 2H), 2.35 (s, 3H), 2.23 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 162.49, 153.78, 151.23, 149.42, 148.79, 148.42, 147.07, 143.85, 139.96, 136.45, 135.27, 134.94, 132.63, 130.85, 130.48, 130.20, 129.57, 128.64, 128.47, 128.36, 126.49, 123.26, 122.81, 122.05, 121.86, 120.33, 116.32, 112.99, 111.63, 106.04, 73.30, 63.99, 61.42, 56.17, 56.00, 55.82, 45.68, 44.15, 42.61, 42.40, 42.03, 39.66, 25.13, 22.13. HRMS (ESI): calcd for C44H45BrN2O6: 778.2441[M + H]+, found: 779.2525[M + H]+.Yield: 93.1%. 3f, 7-O-(m-I-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.53 (d, J = 7.1 Hz, 1H), 7.46 (s, 1H), 7.35 (dd, J = 8.2, 1.9 Hz, 1H), 7.14 (dd, J = 8.2, 2.5 Hz, 1H), 6.97–6.90 (m, 2H), 6.86 (s, 2H), 6.79 (dd, J = 8.3, 2.5 Hz, 1H), 6.52 (d, J = 5.3 Hz, 2H), 6.35–6.27 (m, 2H), 5.80 (s, 1H), 4.55 (d, J = 11.3 Hz, 1H), 4.18 (d, J = 11.3 Hz, 1H), 3.92 (s, 3H), 3.73 (s, 3H), 3.66–3.47 (m, 2H), 3.44 (s, 2H), 3.37 (s, 3H), 3.24 (dd, J = 12.5, 5.5 Hz, 2H), 2.99–2.84 (m, 4H), 2.74 (ddd, J = 19.5, 15.0, 7.2 Hz, 4H), 2.45 (s, 3H), 2.32 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 162.59, 153.70, 151.25, 149.43, 148.72, 148.44, 147.08, 143.82, 139.99, 136.74, 136.46, 135.17, 134.80, 132.58, 130.26, 129.73, 128.56, 128.26, 128.09, 127.11, 123.20, 122.78, 121.92, 121.90, 120.31, 116.20, 112.96, 111.55, 106.02, 93.98, 73.27, 63.93, 61.40, 56.17, 56.00, 55.84, 45.51, 44.14, 42.54, 42.38, 41.92, 39.62, 24.93, 22.23; HRMS (ESI): calcd for C44H45IN2O6: 825.2356[M + H]+, found:

1 M

2 M

4 M

Aggregate JC-1

Monomeric JC-1

Merge

Fig. 6. JC-1 mitochondrial membrane potential staining of 3i in A549 cells. Line 1. Treatment without 3i as control for 48 h and (Line 2–4) treatments with 3i at the concentrations of 1, 2 and 4 μM for 48 h, respectively. 7

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

a

0 M

1 M

2 M

4 M

Fig. 7. 3i change the expression level of apoptosis related proteins. (a) Cells were treated with 3i at the indicated doses for 48 h. Cell lysates were collected and subjected to Western blotting using BaX, Bcl-2, Cleaved Caspase 9, Cleaved Caspase 3, Cytochrome C. GAPDH was used as loading control. (b) The relative expression level of apoptosis related proteins. The results from three independent experiments were expressed as mean ± SD compared with the control group, *P < 0.05, **P < 0.01, ***P < 0.001.

b

Cleaved caspase 9 Cleaved caspase 3 Cytochrome C BcL-2 Bax GAPDH

825.2236[M + H]+. Yield: 86.7%. 3 g, 7-O-(m-CH3-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.31 (dd, J = 8.2, 2.0 Hz, 1H), 7.14 (d, J = 2.5 Hz, 1H), 7.12 (d, J = 2.7 Hz, 1H), 7.09 (d, J = 7.5 Hz, 1H), 7.02 (d, J = 7.6 Hz, 1H), 6.87 (d, J = 3.8 Hz, 3H), 6.78 (dd, J = 8.2, 2.3 Hz, 2H), 6.51 (d, J = 14.9 Hz, 2H), 6.35 – 6.26 (m, 2H), 5.83 (s, 1H), 4.58 (d, J = 10.6 Hz, 1H), 4.19 (d, J = 10.6 Hz, 1H), 3.92 (s, 3H), 3.72 (s, 3H), 3.58–3.38 (m, 2H), 3.35 (s, 3H), 3.22 (dd, J = 12.6, 5.6 Hz, 1H), 2.89 (ddd, J = 17.3, 15.1, 9.4 Hz, 4H), 2.81–2.72 (m, 2H), 2.68 (dd, J = 18.4, 8.8 Hz, 2H), 2.48 (s, 3H), 2.42 (dd, J = 27.0, 16.4 Hz, 2H), 2.33 (s, 3H), 2.29 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 153.77, 151.42, 149.42, 149.00, 148.44, 147.08, 144.02, 137.46, 137.01, 135.27, 134.99, 132.65, 130.13, 128.92, 128.29, 128.26, 128.21, 127.87, 127.72, 125.38, 124.00, 123.32, 122.76, 121.87, 121.81, 120.44, 116.28, 112.97, 111.61, 106.05, 74.58, 64.06, 61.49, 56.18, 55.95, 55.85, 45.71, 44.22, 42.62, 42.40, 42.07, 39.69, 25.17, 22.14, 21.37; HRMS (ESI): calcd for C45H48N2O6: 717.3546[M + H]+, found: 717.3588[M + H]+. Yield: 87.2%. 3 h, 7-O-(m-NO2-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 8.07 (t, J = 10.4 Hz, 1H), 7.91 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.31–7.22 (m, 2H), 7.12 (dd, J = 8.1, 2.4 Hz, 1H), 6.90–6.84 (m, 2H), 6.78 (dd, J = 8.3, 2.4 Hz, 1H), 6.54–6.48 (m, 2H), 6.35 (s, 1H), 6.27 (dd, J = 8.3, 1.9 Hz, 1H), 5.83 (s, 1H), 4.73 (d, J = 11.7 Hz, 1H), 4.31 (d, J = 11.7 Hz, 1H), 3.91 (s, 3H), 3.74 (s, 3H), 3.61 – 3.51 (m, 2H), 3.40 (s, 3H), 3.27 (dt, J = 16.3, 6.5 Hz, 1H), 3.15 (dd, J = 12.4, 5.5 Hz, 1H), 2.94 (s, 2H), 2.87–2.76 (m, 1H), 2.75–2.65 (m, 4H), 2.62 (dd, J = 13.6, 9.6 Hz, 1H), 2.49 (d, J = 13.8 Hz, 2H), 2.40 (s, 3H), 2.33 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 153.62, 151.18, 149.37, 148.64, 148.39, 147.97, 147.03, 143.60, 139.71, 136.00, 135.35, 134.78, 133.28, 132.63, 130.13, 128.74, 123.20, 122.77, 122.22, 121.90, 120.06, 116.14, 112.89, 111.51, 105.94, 72.41, 67.09, 63.60, 61.40, 56.12, 55.99, 55.80, 55.45, 55.04, 53.55, 45.28, 44.02, 42.35, 41.94, 37.56, 36.49, 29.72, 25.67, 22.02; HRMS (ESI) calcd for C44H45N3O8: 744.3240[M + H]+, found: 744.3224[M + H]+. Yield: 76% 3i, 7-O-(o-CF3- Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.50 (d, J = 7.8 Hz, 1H), 7.42 (s, 1H), 7.33–7.20 (m, 3H), 7.14 (d, J = 2.5 Hz, 1H), 6.93–6.84 (m, 2H), 6.78 (s, 1H), 6.57–6.50 (m, 2H), 6.35 (s, 1H), 6.29 (d, J = 1.9 Hz, 1H), 5.88 (s, 1H), 4.81 (d, J = 13.4 Hz, 1H), 4.53 (d, J = 13.3 Hz, 1H), 3.92 (s, 3H), 3.69 (s, 3H), 3.59–3.49 (m, 2H), 3.41 (s, 3H), 3.21 (dd, J = 12.5, 5.5 Hz, 2H), 2.97–2.61 (m, 8H), 2.60–2.41 (m, 2H), 2.34 (s, 3H), 2.21 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 162.57, 153.80, 151.37, 149.43, 148.67, 148.41, 147.12, 143.96, 136.84, 136.37, 134.99, 134.78, 132.58, 131.79, 130.15, 128.72, 128.30, 127.97, 127.74, 126.56, 126.07, 124.91, 123.18, 122.85, 121.90, 120.36, 116.21, 112.89, 111.63, 106.09, 69.21, 63.95, 61.51, 56.16, 55.94, 55.71, 50.52, 45.54, 44.19, 42.39, 42.13, 41.91, 39.98,

24.77, 22.20. 19F NMR (CDCl3, 376 MHz) δ −60.56 (s, 3F); HRMS (ESI): calcd for C45H45F3N2O6: 767.3263[M + H]+, found: 767.3339[M + H]+. Yield: 85.3% 3j, 7-O-(2,5-2F-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.32 (d, J = 8.0 Hz, 1H), 7.13 (dd, J = 8.1, 2.0 Hz, 1H), 6.99 (dd, J = 18.4, 8.3 Hz, 1H), 6.86 (dd, J = 12.0, 8.0 Hz, 3H), 6.83 – 6.76 (m, 1H), 6.68 (s, 1H), 6.52 (d, J = 4.3 Hz, 2H), 6.31 (d, J = 11.7 Hz, 2H), 5.86 (s, 1H), 4.54 (d, J = 10.9 Hz, 1H), 4.13 (d, J = 10.9 Hz, 1H), 3.91 (s, 3H), 3.72 (s, 3H), 3.78–3.65 (m, 2H), 3.64–3.44 (m, 2H), 3.37 (s, 3H), 3.21 (dd, J = 12.7, 5.6 Hz, 2H), 2.82 (dddd, J = 23.7, 21.3, 14.9, 10.7 Hz, 8H), 2.51 (s, 3H), 2.33 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 153.76, 151.22, 151.09, 149.42, 148.73, 148.63, 148.46, 147.08, 143.80, 136.34, 135.32, 134.87, 134.73–134.56 (m), 132.65, 130.13, 128.75, 128.60, 123.91, 123.29, 122.80, 121.89, 120.17, 117.01, 116.83, 116.68, 116.51, 116.23, 112.97, 111.61, 106.01, 72.85, 64.01, 61.43, 56.14, 55.97, 55.80, 45.68, 44.12, 42.56, 42.38, 42.03, 38.95, 25.52, 22.10; HRMS (ESI): calcd for C44H44F2N2O6: 735.3201[M + H]+, found: 735.4218[M + H]+. Yield: 77.5%. 3 k, 7-O-(2-F-5-CF3-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.57 (d, J = 4.8 Hz, 1H), 7.44 (s, 1H), 7.33 (d, J = 7.6 Hz, 1H), 7.15 (d, J = 7.6 Hz, 1H), 7.00 (t, J = 8.7 Hz, 1H), 6.87 (s, 2H), 6.79 (d, J = 7.7 Hz, 1H), 6.51 (d, J = 5.9 Hz, 2H), 6.29 (d, J = 13.9 Hz, 2H), 5.88 (s, 1H), 4.71 (d, J = 12.6 Hz, 1H), 4.33 (d, J = 12.6 Hz, 1H), 3.93 (s, 3H), 3.69 (s, 3H), 3.64–3.46 (m, 2H), 3.40 (s, 3H), 3.16 (dd, J = 50.7, 43.0 Hz, 2H), 2.99–2.39 (m, 10H), 2.31 (d, J = 11.7 Hz, 6H). 13 C NMR (100 MHz, CDCl3) δ 162.69, 160.19, 153.76, 151.17, 149.42, 148.64, 148.40, 147.07, 143.62, 136.14, 135.12, 134.80, 132.55, 130.19, 128.90, 128.33, 127.97, 127.61, 126.41, 126.07, 125.26, 123.16, 122.78, 121.93, 120.14, 116.17, 115.29, 115.07, 112.91, 111.54, 105.89, 66.63, 63.92, 61.43, 56.13, 55.98, 55.66, 45.35, 44.11, 42.38, 42.10, 41.86, 39.78, 24.52, 22.15; HRMS (ESI):calcd for C44H44F4N2O6: 786.3242[M + H]+, found: 786.3350[M + H]+. Yield: 78.2%. 3 l, 7-O-(3,5-2CF3-Benzyl)-DTET. 1H NMR (400 MHz, CDCl3) δ 7.71 (s, 1H), 7.58 (s, 2H), 7.31 (dd, J = 8.1, 1.4 Hz, 1H), 7.14 (dd, J = 8.1, 2.2 Hz, 1H), 6.92–6.83 (m, 2H), 6.79 (dd, J = 8.2, 2.2 Hz, 1H), 6.52 (s, 2H), 6.32 (s, 1H), 6.28 (dd, J = 8.2, 1.5 Hz, 1H), 5.91 (s, 1H), 4.71 (d, J = 12.3 Hz, 1H), 4.21 (d, J = 12.3 Hz, 1H), 3.92 (s, 3H), 3.70 (s, 3H), 3.56 (ddd, J = 21.0, 12.4, 8.2 Hz, 2H), 3.41 (s, 3H), 3.38–3.12 (m, 2H), 3.02–2.85 (m, 2H), 2.84–2.59 (m, 6H), 2.45 (dd, J = 19.9, 9.7 Hz, 2H), 2.32 (d, J = 10.1 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 153.74, 151.05, 149.43, 148.59, 148.47, 147.10, 143.62, 140.63, 135.97, 135.20, 134.75, 132.53, 131.24, 130.91, 130.16, 129.04, 128.51, 128.43, 127.20, 127.18, 124.77, 123.27, 122.78, 122.06, 121.95, 121.94, 121.33, 120.17, 116.16, 112.97, 111.56, 105.92, 72.28, 63.81, 61.43, 56.09, 55.62, 45.26, 44.07, 42.37, 42.15, 42.01, 41.89, 38.70, 8

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

24.95, 22.13; HRMS (ESI): calcd for C46H44F6N2O6: 835.3137[M + H]+, found: 835.3317[M + H]+. Yield: 69.6%. The mixture of stirred DTET (100 mg, 0.16 mmol) and NaH (20 mg, 0.83 mmol) was dissolved in 2 mL DMF at 0 °C. Then, R1Br (0.5 mmol) dissolved in 0.5 mL DMF was added to the DTET solution, and the mixture was stirred at 0 °C for 6 h, then heated to 92 °C until the TLC analysis showed that the reaction was completed. The temperature of the mixture was cooled to room temperature and vacuum evaporated. The residue was purified using aluminum column chromatography, and 4a-4 h were obtained using CH2Cl 2/CH3OH as the eluent. 4a, 7-O,N,N'-3(m-F-Benzyl)-DTET hydrochloride bromide. 1H NMR (400 MHz, CD3OD) δ 7.67–7.61 (m, 1H), 7.57 (dd, J = 8.4, 2.0 Hz, 1H), 7.47–7.43 (m, 3H), 7.36–7.33 (m, 1H), 7.26 (s, 1H), 7.05 (dd, J = 10.1, 5.6 Hz, 4H), 6.98 (s, 1H), 6.96 (s, 1H), 6.93 (d, J = 2.4 Hz, 1H), 6.87 (s, 1H), 6.84 (d, J = 5.6 Hz, 1H), 6.74 (d, J = 2.4 Hz, 1H), 6.72 (d, J = 2.4 Hz, 1H), 6.63–6.59 (m, 1H), 6.45 (d, J = 1.7 Hz, 1H), 6.34 (td, J = 8.4, 2.2 Hz, 1H), 6.14 (s, 1H), 5.06 (dd, J = 17.9, 9.6 Hz, 2H), 4.77 (dd, J = 11.0, 4.8 Hz, 1H), 4.65 (s, 2H), 4.62 (d, J = 3.3 Hz, 1H), 4.53–4.46 (m, 1H), 4.44 (d, J = 5.2 Hz, 1H), 4.41 (d, J = 5.6 Hz, 1H), 4.31–4.20 (m, 1H), 4.10 (s, 1H), 3.87 (d, J = 2.2 Hz, 3H), 3.85 (d, J = 1.9 Hz, 3H), 3.81–3.76 (m, 1H), 3.71 (s, 3H), 3.59 (s, 1H), 3.44 (d, J = 4.8 Hz, 2H), 3.30 (s, 2H), 3.14 (t, J = 11.7 Hz, 1H), 3.01 (s, 1H), 2.97 (s, 1H), 2.68 (s, 3H), 1.30 (s, 3H). 13C NMR (100 MHz, CD3OD) δ 163.74, 161.69, 154.81, 154.67, 153.77, 150.19, 149.91, 148.54, 146.73, 146.45, 143.85, 143.41, 140.38, 136.83, 132.01, 131.75, 130.95, 130.22, 129.26, 128.59, 125.31, 124.77, 123.36, 122.63, 122.22, 121.87, 121.60, 120.09, 120.01, 119.44, 117.44, 115.31, 115.18, 114.04, 113.81, 113.64, 113.43, 113.23, 112.79, 112.40 112.18, 106.66, 71.93, 69.67, 65.66, 63.69, 63.01, 56.95, 55.32, 54.98, 54.43, 52.60, 50.40, 45.50, 39.06, 36.34, 29.41 23.17; HRMS (ESI): calcd for C57H57F3N2O6: 467.2079[M/2]2+, found: 467.2078[M/2]2+. 4b, 7-O,N,N'-3(m-Cl-Benzyl)-DTET hydrochloride bromide. 1H NMR (400 MHz, CD3OD) δ 7.69 (s, 1H), 7.63 (d, J = 5.8 Hz, 1H), 7.58 (s, 1H), 7.56 (s, 1H), 7.54 (d, J = 3.1 Hz, 1H), 7.51 (d, J = 1.0 Hz, 1H), 7.42 (td, J = 7.9, 2.7 Hz, 2H), 7.26 (d, J = 5.9 Hz, 2H), 7.16 (d, J = 6.7 Hz, 1H), 7.09 (d, J = 8.3 Hz, 1H), 6.99 (d, J = 3.9 Hz, 1H), 6.96 (d, J = 3.2 Hz, 1H), 6.94 (d, J = 3.1 Hz, 1H), 6.90 (d, J = 2.8 Hz, 1H), 6.85 (d, J = 2.3 Hz, 1H), 6.77–6.73 (m, 1H), 6.65 (dd, J = 8.2, 2.0 Hz, 1H), 6.60 (d, J = 7.6 Hz, 1H), 6.43 (d, J = 1.5 Hz, 1H), 6.11 (s, 1H), 5.52 (s, 1H), 5.04 (t, J = 10.4 Hz, 2H), 4.77 (d, J = 5.3 Hz, 1H), 4.69 (s, 1H), 4.65 (s, 1H), 4.63–4.54 (m, 2H), 4.43 (d, J = 4.8 Hz, 1H), 4.40 (d, J = 5.4 Hz, 1H), 4.07 (d, J = 3.0 Hz, 1H), 3.99–3.94 (m, 1H), 3.83 (s, 6H), 3.76 (s, 3H), 3.65 (d, J = 7.0 Hz, 1H), 3.61 (s, 2H), 3.55–3.49 (m, 2H), 3.44 (d, J = 4.9 Hz, 1H), 3.30 (s, 2H), 3.17 (t, J = 11.7 Hz, 1H), 3.01 (s, 1H), 2.95 (d, J = 9.1 Hz, 1H), 2.68 (s, 3H). 13C NMR (100 MHz, CD3OD) δ 154.93, 154.75, 153.70, 150.37, 150.09, 149.92, 148.57, 146.73, 146.42, 143.83, 143.34, 139.72, 136.70, 134.75, 134.58, 133.49, 133.14, 132.61, 132.38, 132.00, 131.73, 131.18, 130.87, 129.53, 129.36, 128.97, 127.44, 126.84, 125.43, 124.88, 123.96, 123.53, 122.36, 121.87, 121.60, 121.24, 119.67, 114.97, 113.92, 112.61, 112.11, 106.64, 72.74, 71.76, 69.45, 65.41, 63.51, 62.80, 55.50, 55.00, 53.64, 52.83, 50.50, 50.43, 45.60, 39.03, 36.31, 23.26; HRMS (ESI): calcd for C58H57Cl3N2O6: 492.1636[M/2]2+, found: 492.1629[M/2]2+. 4c, 7-O,N,N'-3(m-Br-Benzyl)-DTET hydrochloride bromide. HRMS (ESI): calcd for C58H57Br5N2O6: 559.0843[M/2]2+, found: 559.0843[M/2]2+. 4d, 7-O,N,N'-3(m-I-Benzyl)-DTET hydrochloride bromide. HRMS 629.5687[M/2]2+, found: (ESI):calcd for C58H57Br2I3N2O6: 629.5710[M/2]2+. 4e, 7-O,N,N'-3(m-CH3-Benzyl)-DTET hydrochloride bromide. HR-MS (ESI): calcd for C61H66Br2N2O6: 461.2455 [M/2]2+, found: 461.2477 [M/2]2+. 4f, 7-O,N,N'-3(m-NO3-Benzyl)-DTET hydrochloride bromide. 1H NMR (400 MHz, CD3OD) δ 8.36 (d, J = 1.7 Hz, 1H), 8.07 (d, J = 8.0 Hz, 1H), 7.95–7.90 (m, 2H), 7.53 (t, J = 7.9 Hz, 1H), 7.45 (t, J = 7.9 Hz, 2H),

7.36 (dd, J = 17.0, 8.5 Hz, 3H), 7.02 (dd, J = 8.2, 2.2 Hz, 1H), 6.96 (d, J = 9.1 Hz, 1H), 6.93–6.88 (m, 3H), 6.79 (s, 1H), 6.75–6.68 (m, 2H), 6.50 (dd, J = 8.3, 2.1 Hz, 2H), 6.46–6.43 (m, 1H), 6.39 (s, 1H), 5.60 (s, 1H), 4.73 (dd, J = 12.6, 7.7 Hz, 2H), 4.65 (d, J = 13.0 Hz, 1H), 4.42 (d, J = 12.1 Hz, 1H), 3.86 (d, J = 3.3 Hz, 3H), 3.84 (s, 3H), 3.81 (s, 3H), 3.76 (s, 1H), 3.46 (s, 2H), 3.36 (s, 1H), 3.33 (d, J = 4.0 Hz, 2H), 3.14 (s, 1H), 2.83 (d, J = 7.9 Hz, 2H), 2.78 (s, 1H), 2.72 (d, J = 2.7 Hz, 2H), 2.67 (s, 2H), 2.42 (s, 3H), 2.35 (s, 1H), 1.93 (s, 3H) ; HRMS (ESI): calcd for C58H57N5O12: 507.6996 [M/2]2+, found: 507.6975 [M/2]2+. 4 g, 7-O,N,N'-3(2′′,5′′-2F-Benzyl)-DTET hydrochloride bromide. HRMS (ESI): calcd for C44H45F6N2O6: 494.1938[M/2]2+, found: 494.1934[M/2]2+. 4 h, 7-O,N,N'-3(o-CF3-Benzyl)-DTET hydrochloride bromide. 1H NMR (CDCl3, 400 MHz) δ 7.62–7.06 (m, 10H), 6.96–6.73 (m, 5H), 6.61–6.44 (m, 3H), 6.42–6.21 (m, 3H), 5.88 (s, 1H), 4.81 (d, J = 13.3 Hz, 1H), 4.53 (d, J = 13.3 Hz, 1H), 3.92 (s, 3H), 3.70 (s, 3H), 3.57 (dt, J = 11.2, 6.6 Hz, 4H), 3.42 (s, 3H), 3.29–3.18 (m, 2H), 3.06–2.85 (m, 4H), 2.80–2.54 (m, 8H), 2.35 (s, 3H), 2.21 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 153.81, 151.37, 149.38, 148.63, 148.48, 147.12, 143.97, 136.81, 136.31, 134.81, 134.67, 132.58, 132.08, 131.80, 130.23, 129.92, 129.90, 128.70, 128.36, 128.12, 127.70, 127.63, 126.58, 126.06, 125.76, 125.64, 125.45, 125.04, 124.97, 124.91, 124.86, 123.09, 122.92, 122.86, 121.91, 120.33, 116.18, 112.83, 111.60, 106.07, 69.20, 63.98, 61.53, 56.15, 55.94, 55.71, 53.02, 45.49, 44.24, 42.39, 42.03, 41.88, 39.94, 35.91, 34.45, 31.91, 29.32, 27.22, 25.58, 24.64, 22.43, 22.18; HRMS (ESI): calcd for C61H57Br2F9N2O6: 542.2031[M/2]2+, found: 542.2071[M/2]2+. 3.3. CCK-8 assays A549 cells in the logarithmic growth phase were seeded on a 96well plate for 12 h at a density of 5000 cells/well. The cells were treated with different concentrations of 20, 10, 5, 2.5, 1.25, 0.625 and 0.3125 µM for 24, 48, and 72 h. At the end of the incubation, 10 µL CCK-8 (5 mg/mL) and 90 µL of the medium were added to each pore, and the plate was placed at 37 °C for 2 h. The absorbance was measured under 450 nm using a microplate reader (BIO-RAD, USA). 3.4. Clonogenic assays A total of 1000 cells in the logarithmic growth phase were inoculated in 6-cm Petri dishes. One week later, the cells were treated with different concentrations of compound 3i medium. The cells were cultured for two weeks. The plates were washed with PBS and fixed with 4% paraformaldehyde and stained with Giemsa (0.04%). 3.5. Flow cytometry analysis of the DNA content The cells were inoculated and processed on a 6-well plate. A549 cells were treated with compound 3i at different concentrations for 48 h. Subsequently, cells were harvested and fixed with 70% EtOH overnight at 4 °C. After fixation, the cells were resuspended in 500 µL of RNase/PI solution and stained for 20 min. The cells were analyzed using flow cytometry. The cell cycle distribution was calculated using MFLT 32 software. 3.6. Annexin V and PI staining of apoptotic cells The cells were cultured on 6-well plates for 24 h, and then treated with different concentrations of 3i for 48 h. Then, the cells were washed twice with PBS and stained with FITC Annexin V and PI according to the manufacturer's instructions. The stained cells were detected using the FACSCalibur flow cytometer (BD Biosciences). Q1-UL, Q1-UR, Q1LL and Q1-L respectively represent necrosis, late apoptosis, normal and early apoptotic cells. 9

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

3.7. Hoechst 33,258 staining Cells (5 × 104 cells/well) were inoculated on a 12-well culture plate and incubated with 3i of various concentrations for 48 h. Then, the cells were washed with PBS, fixed for 15 min (4% paraformaldehyde), stained with Hoechst 33,258 for 5 min (1 μg/mL), and then washed twice with PBS. Finally, the apoptotic characteristics of the cancer cells were studied using confocal microscopy (SP8, Leica, GER). 3.8. Reactive oxygen species assay Intracellular ROS production was measured by dyeing cells with fluorescent probe 2′, 7′-dichlorofluorescein diacetate (DCFH-DA). The cells were treated with 0, 1, 2 and 4 µM 3i for 48 h and incubated with 10 mM DCFH-DA for 30 min at 37 °C in the dark. Then, the cells were washed twice with PBS and resuspended in PBS. The cells were collected, and the fluorescence of DCFH-DA (excitation = 488 nm; emission = 521 nm) was detected using a fluorescence spectrophotometer (F-4600; HITACHI, Tokyo, Japan). 3.9. Mitochondrial membrane potential (ΔΨm) measurements

Fig. 8. Schematic model of the molecular mechanisms associated with 3i induced apoptosis and inhibited proliferation in A549 cells.

The changes in MMP were quantified by JC-1 assay. Healthy polarized cell mitochondria form JC-1 aggregates (green fluorescence), while dead cells form JC-1 monomers (red fluorescence). Cells (5 × 104 cells/pore) were inoculated on a 12-well plate and incubated with various concentrations of 3i for 48 h. Then, the cells were washed with PBS and determined according to the manufacturer's instructions. The results were detected using fluorescence microscopy (SP8, Leica, GER).

incubation, the membrane was washed with TBST and incubated with two antibodies. Finally, the imprinting was developed using an enhanced chemiluminescence detection kit, and the relative protein expression level was quantified using ImageJ software. 3.12. Statistical analysis

3.10. Quantitative real-time RT-qPCR analysis

All experimental data were reported as the mean value of the specified number of independent experiments plus the standard deviation (SD). The data is expressed as an average value of ± SD. P < 0.05 is considered to be statistically significant. Additionally, P < 0.01 (**) and P < 0.001 (***) are statistically significant.

A549 cells (5 × 106) were inoculated on 6-well plates and exposed to various concentrations of 3i for 48 h. The cells were lysed with TRIZol reagent, and total RNA was separated using the RNeasy kit (Vazyme, Nanjing, China). According to the manufacturer's instructions (Vazyme, Nanjing, China), reverse transcription was performed using the Reverse Transcription Kit. SYBR Premix ExTaq II (TLiRNaseH Plus) (Takara, Beijing, China) was used to analyze gene amplification by quantitative RTqPCR, and specific primer sequences are listed in Table 2 (all primers were designed using Primer Premier 5.0). Real-time PCR (Eppendorf, Realplex, Germany) was performed in triplicate, and gene expression was calculated as fold change according to the 2-ΔΔCq method.

4. Conclusion A series of new fangchinoline derivatives, including those that contain fluorine (10 compounds) and those that do not contain fluorine (11), were designed and synthesized in the present study, all of which were evaluated against five cancer cell lines (A549, Hela, HepG-2, MCF-7 and MDA-MB231 cell lines) and HL-7702 normal cells. The results showed that 18 of the 21 derivatives exhibited significant activity (IC50 < 10 µM) against the tested cancer cells, and the compound 3i was found to be the most potent against A549 cells with the IC50 value of 0.61 µM, which increased 12 times that of fangchinoline. More interestingly, compound 3i had slight toxic side effects on normal cells with an IC50 value of 27.53 µM. Moreover, cell viability and cell cycle assays revealed that compound 3i inhibited A549 cell proliferation and arrested A549 cells at the G2/Mphase (Fig. 8). Apoptotic-inducing effects of compound 3i and the associated molecular mechanisms were assessed using flow cytometry, cell staining, reactive oxygen species assays, RT-qPCR and Western blot analysis (Fig. 8). These results suggested that compound 3i induces apoptosis through a mitochondria-mediated intrinsic pathway. This study revealed that compound 3i is a promising candidate for development into an antitumor drug in the future.

3.11. Western blot analysis A549 cells were treated with or without 3i (1 × 106 cells/hole on the 6-wells plates). The total protein concentration of each sample was estimated using the BCA protein kit. A total of 80 µg of protein were electrophoretic to 12% or 10% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was then blocked with 5% skimmed milk for 1 h and incubated overnight with their respective primary antibodies overnight at 4 °C with appropriate dilution. After Table 2 The sequences of primers. Primers

F/R

Primer sequence

GAPDH

F R F R F R F R

5′-GACCTGACCTGCCGTCTAG-3′ 5′-AGGAGTGGGTGTCGCTGT-3′ TGCTGGGGTCAGCTCGTTACTCA TGGGATGCTAGGCTTCCTGGTT 5′-CCTGGCACCTCACCTGCTCT-3′ 5′-CGGCGTTTGGAGTGGTAGAA-3′ 5′-AAGATGGAGCTGATCCAAAC-3′ 5′-TACATGGTCTCCTGCAACAA-3′

CDK1 P21 Cyclin-B1

Acknowledgements This study was supported by the Provincial Natural Science Foundation Key Project of Shandong, China (NO. ZR2018ZC0944), the Provincial Natural Science Foundation of Shandong, China (ZR2019MC072) and the Provincial Key Research and Development 10

Bioorganic Chemistry xxx (xxxx) xxxx

Y.-c. Zhang, et al.

Program of Shandong, China (NO. 2018GNC110008, 2019GSF109087); the Taishan Scholars’s Program of Shandong for Jin-yue Sun.

1110–1119, https://doi.org/10.1016/j.phymed.2014.04.029. [22] C. Zhao, L. Shao, J. Lu, X. Deng, Y. Tong, Y. Wu, Hybrid prodrug nanoparticles with tumor-penetration and programmed drug activation for enhanced chemo-resistant cancer therapy, ACS Appl. Mater. Interfaces 9 (2017) 18450–18461, https://doi. org/10.1021/acsami.7b01908. [23] M. Jiang, R. Zhang, Y. Wang, W. Jing, Y. Liu, Y. Ma, B. Sun, M. Wang, P. Chen, H. Liu, Reduction-sensitive paclitaxel prodrug self-assembled nanoparticles with tetrandrine effectively promote synergistic therapy against drug-sensitive and multidrug-resistant breast cancer, Mol. Pharm. 14 (2017) 3628, https://doi.org/10. 1021/acs.molpharmaceut.7b00381. [24] R. Elias, A. Gepdiremen, A. Chea, F. Topal, Antioxidant activity of bisbenzylisoquinoline alkaloids from Stephania rotunda: cepharanthine and fangchinoline, J. Enzyme Inhib. Med. Chem. 25 (2010) 44–53, https://doi.org/10.3109/ 14756360902932792. [25] J. Lan, N. Wang, L. Huang, Y. Liu, X. Ma, H. Lou, C. Chen, Y. Feng, W. Pan, Design and synthesis of novel tetrandrine derivatives as potential anti-tumor agents against human hepatocellular carcinoma, Eur. J. Med. Chem. 127 (2017) 554, https://doi. org/10.1016/j.ejmech.2017.01.008. [26] C. Heidelberger, N.K. Chaudhuri, P. Danneberg, D. Mooren, L. Griesbach, R. Duschinsky, R.J. Schnitzer, E. Pleven, J. Scheiner, Fluorinated pyrimidines, a new class of tumour-inhibitory compounds, Nature 179 (1957) 663–666, https:// doi.org/10.1038/179663a0. [27] M. Rowley, D.J. Hallett, S. Goodacre, C. Moyes, J. Crawforth, T.J. Sparey, S. Patel, R. Marwood, S. Thomas, 3-(4-Fluoropiperidin-3-yl)-2-phenylindoles as high affinity, selective, and orally bioavailable h5-HT(2A) receptor antagonists, J. Med.Chem 32 (2001) 1603–1614, https://doi.org/10.1021/jm0004998. [28] M.G. Russell, V.G. Matassa, R.R. Pengilley, M.B. Niel, B. Van, A.P. Sohal, L. Watt, M.S. Hitzel, J.A. Beer, H.B. Broughton Stanton, 3-[3-(Piperidin-1-yl)propyl]indoles as highly selective h5-HT(1D) receptor agonists, J. Med.Chem 42 (1999) 4981–5001, https://doi.org/10.1021/jm9910021. [29] S.B. Rosenblum, T. Huynh, A. Afonso, H.R. Davis Jr., N. Yumibe, J.W. Clader, D.A. Burnett, Discovery of 1-(4-fluorophenyl)-(3R)-[3-(4-fluorophenyl)-(3S)-hydroxypropyl]-(4S)-(4 -hydroxyphenyl)-2-azetidinone (SCH 58235): a designed, potent, orally active inhibitor of cholesterol absorption, J. Med.Chem 41 (1998) 973–980, https://doi.org/10.1021/jm970701f. [30] D. Guay, P. Hamel, M. Blouin, C. Brideau, C.C. Chan, N. Chauret, Y. Ducharme, Z. Huang, M. Girard, T.R. Jones, F. Laliberte, P. Masson, M. McAuliffe, H. Piechuta, J. Silva, R.N. Young, Y. Girard, Discovery of L-791,943: a potent, selective, non emetic and orally active phosphodiesterase-4 inhibitor, Bioorg. Med. Chem. Lett. 12 (2002) 1457–1461, https://doi.org/10.1016/s0960-894x(02)00190-7. [31] T.D. Penning, J.J. Talley, S.R. Bertenshaw, J.S. Carter, P.W. Collins, S. Docter, M.J. Graneto, L.F. Lee, J.W. Malecha, J.M. Miyashiro, R.S. Rogers, D.J. Rogier, S.S. Yu, E.G. AndersonGd, J.N. Burton, S.A. Cogburn, C.M. Gregory, W.E. Koboldt, K. Perkins, A.W. Seibert, Y.Y. Veenhuizen, P.C. Isakson Zhang, Synthesis and biological evaluation of the 1,5-diarylpyrazole class of cyclooxygenase-2 inhibitors: identification of 4-[5-(4-methylphenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benze nesulfonamide (SC-58635, celecoxib), J. Med.Chem 40 (1997) 1347–1365, https:// doi.org/10.1021/jm960803q. [32] Y. Kokuryo, K. Kawata, T. Nakatani, A. Kugimiya, Y. Tamura, K. Kawada, M. Matsumoto, R. Suzuki, K. Kuwabara, Y. Hori, M. Ohtani, Synthesis and evaluation of novel fluorinated methotrexate derivatives for application to rheumatoid arthritis treatment, J. Med.Chem 40 (1997) 3280–3291, https://doi.org/10.1021/ jm970085n. [33] V. Oakes, W. Wang, B. Harrington, W.J. Lee, H. Beamish, K.M. Chia, A. Pinder, H. Goto, M. Inagaki, S. Pavey, B. Gabrielli, Cyclin A/Cdk2 regulates Cdh1 and claspin during late S/G2 phase of the cell cycle, Cell Cycle 13 (2014) 3302–3311, https://doi.org/10.4161/15384101.2014.949111. [34] S.T. Chou, H.Y. Peng, C.T. Chang, J.S. Yang, H.K. Chung, S.T. Yang, W.G. Wood, J.G. Chung, Zanthoxylum ailanthoides Sieb and Zucc. extract inhibits growth and induces cell death through G2/M-phase arrest and activation of apoptotic signals in colo 205 human colon adenocarcinoma cells, Anticancer Res. 31 (2011) 1667, https://doi.org/10.1038/onc.2010.612. [35] S.I. Dikalov, D.G. Harrison, Methods for detection of mitochondrial and cellular reactive oxygen species, Antioxid. Redox Sign. 20 (2014) 372–382, https://doi.org/ 10.1089/ars.2012.4886. [36] P.T. Schumacker, Reactive oxygen species in cancer: a dance with the devil, Cancer Cell 27 (2015) 156–157, https://doi.org/10.1016/j.ccell.2015.01.007. [37] J. Boonstra, J.A. Post, Molecular events associated with reactive oxygen species and cell cycle progression in mammalian cells, Gene 337 (2004) 1–13, https://doi.org/ 10.1016/j.gene.2004.04.032. [38] S. Wang, Y. Hu, Y. Yu, Z. Cheng, T. Liu, Sotetsuflavone inhibits proliferation and induces apoptosis of A549 cells through ROS-mediated mitochondrial-dependent pathway, Bmc Complementary Altern Med 18 (2018) 235, https://doi.org/10. 1186/s12906-018-2300-z. [39] S. Cory, J.M. Adams, Killing cancer cells by flipping the Bcl-2/Bax switch, Cancer Cell 8 (2005) 5–6, https://doi.org/10.1016/j.ccr.2005.06.012. [40] E.Z. Bagci, Y. Vodovotz, T.R. Billiar, G.B. Ermentrout, I. Bahar, Bistability in apoptosis: roles of bax, bcl-2, and mitochondrial permeability transition pores, Biophysical J 90 (2006) 1546–1559, https://doi.org/10.1529/biophysj.105. 068122. [41] T.J. Fan, L.H. Han, R.S. Cong, J. Liang, Caspase family proteases and apoptosis, Acta Biochim. Biophy. Sin. 37 (2005) 719–727, https://doi.org/10.1111/j.1745-7270. 2005.00108.x.

Declaration of Competing Interest The authors declare that they have no conflicts of interest. References [1] A. Jemal, R. Siegel, E. Ward, T. Murray, J. Xu, C. Smigal, M.J. Thun, Cancer statistics, CA Cancer J. Clin. 56 (2006) (2006) 106–130, https://doi.org/10.3322/ canjclin.54.1.8. [2] S.C. Erridge, H. Møller, A. Price, D. Brewster, International comparisons of survival from lung cancer: pitfalls and warnings, Nat. Clin. Pract. Oncol. 4 (2007) 570–577, https://doi.org/10.1038/ncponc0932. [3] I. Guessous, J. Cornuz, F. Paccaud, Lung cancer screening: current situation and perspective, Swiss. Med. Wkly. 137 (2007) 304–311 https://doi.org/2007/21/ smw-11582. [4] A.C. Begg, F.A. Stewart, C. Vens, Strategies to improve radiotherapy with targeted drugs, Nat. Rev. Cancer 11 (2011) 239–253, https://doi.org/10.1038/nrc3007. [5] C.F. Cheok, Protecting normal cells from the cytotoxicity of chemotherapy, Cell. Cycle 11 (2012) 2227–2228, https://doi.org/10.4161/cc.20961. [6] H. Yuan, Q. Ma, L. Ye, G. Piao, The traditional medicine and modern medicine from natural products, Molecules 21 (2016), https://doi.org/10.3390/ molecules21050559. [7] G.M. Cragg, D.J. Newman, Natural products: a continuing source of novel drug leads, BBA-Biomembranes 2013 (1830) 3670–3695, https://doi.org/10.1016/j. bbagen.2013.02.008. [8] S.L. Wang, R. Zhang, X.Y. Song, M.M. Wei, T. Xie, J. Cao, Mechanochemical-assisted extraction of active alkaloids from plant with solid acids, ACS Sustain. Chem. Eng. 7 (2019) 197–207, https://doi.org/10.1021/acssuschemeng.8b02902. [9] H.S. Kim, Y.H. Zhang, K.W. Oh, H.Y. Ahn, Vasodilating and hypotensive effects of fangchinoline and tetrandrine on the rat aorta and the stroke-prone spontaneously hypertensive rat, J. Ethnopharmacol. 58 (1997) 117–123, https://doi.org/10.1016/ S0378-8741(97)00092-5. [10] Y.Z. Liu, B. Xia, J.J. Lan, S.C. Hu, L. Huang, C. Chen, X.Y. Zeng, H.Y. Lou, C.H. Lin, W.D. Pan, Design, synthesis and anticancer evaluation of fangchinoline derivatives, Molecules 22 (2017) 1923, https://doi.org/10.3390/Molecules22111923. [11] J.R. Song, J.J. Lan, C. Chen, S.C. Hu, J.L. Song, W.L. Liu, X.Y. Zeng, H.Y. Lou, Y. Ben-David, W.D. Pan, Design, synthesis and bioactivity investigation of tetrandrine derivatives as potential anti-cancer agents, MedChemComm 9 (2018) 1131–1141, https://doi.org/10.1039/c8md00125a. [12] B. Fan, X.Y. Zhang, Y.L. Ma, A.L. Zhang, Fangchinoline Induces Apoptosis, Autophagy and Energetic Impairment in Bladder Cancer, CellPhysiol Biochem 43 (2017) 1003–1011, https://doi.org/10.1159/000481698. [13] Y.Z. Liu, L. Huang, Q.Y. Sun, M.S. Zhang, T.L. Li, G.Y. Liang, W.D. Pan, Syntheses and anti-cancer activities of derivatives of tetrandrine and fangchinoline, Chem. Res. Chinese U 30 (2014) 937–940, https://doi.org/10.1007/s40242-014-4240-6. [14] N. Wang, W. Pan, M. Zhu, M. Zhang, X. Hao, G. Liang, Y. Feng, Fangchinoline induces autophagic cell death via p53/sestrin2/AMPK signalling in human hepatocellular carcinoma cells, Brit. J. Pharmacol. 164 (2011) 731–742, https://doi.org/ 10.1111/j.1476-5381.2011.01349.x. [15] C.D. Wang, C.F. Yuan, Y.Q. Bu, X.M. Wu, J.Y. Wan, L. Zhang, N. Hu, X.J. Liu, Y. Zu, G.L. Liu, F.Z. Song, Fangchinoline inhibits cell proliferation via Akt/GSK-3beta/ cyclin D1 signaling and induces apoptosis in MDA-MB-231 breast cancer cells, Asian Pac. J. Cancer P. 15 (2014) 769–773, https://doi.org/10.7314/apjcp.2014.15.2. 769. [16] D.C. Li, H.Z. Liu, Y.F. Liu, Q.K. Zhang, C. Liu, S.H. Zhao, B. Jiao, Design, synthesis and biological activities of tetrandrine and fangchinoline derivatives as antitumer agents, Bioorg. Med. Chem. Lett. 27 (2017) 533–536, https://doi.org/10.1016/j. bmcl.2016.12.029. [17] T. Liu, Q.X. Zeng, X.Q. Zhao, W. Wei, Y.H. Li, H.B. Deng, D.Q. Song, Synthesis and biological evaluation of fangchinoline derivatives as anti-inflammatory agents through inactivation of inflammasome, Molecules 24 (2019), https://doi.org/10. 3390/molecules24061154. [18] Y. Shen, C. Chou, W. Chiou, C. Chen, Anti-inflammatory effects of the partially purified extract of radix Stephaniae tetrandrae: comparative studies of its active principles tetrandrine and fangchinoline on human polymorphonuclear leukocyte functions, Mol. Pharmacol. 60 (2001) 1083–1090, https://doi.org/10.1124/mol. 60.5.1083. [19] P. He, H. Sun, X.X. Jian, Q.H. Chen, D.L. Chen, G.T. Liu, F.P. Wang, Partial synthesis and biological evaluation of bisbenzylisoquinoline alkaloids derivatives: potential modulators of multidrug resistance in cancer, J. Asian Nat. Prod. Res. 14 (2012) 564–576, https://doi.org/10.1080/10286020.2012.680443. [20] S. Huiling, X. Wenlin, C. Qiaoyun, W. Zhaoyang, T. Huarong, W. Fachun, Tetrandrine prevents acquired drug resistance of K562 cells through inhibition of mdr1 gene transcription, J. Cancer Res. Clin. Oncol. 136 (2010) 659–665, https:// doi.org/10.1007/s00432-009-0704-3. [21] F.S. Yan, M. Wink, Tetrandrine and fangchinoline, bisbenzylisoquinoline alkaloids from Stephania tetrandra can reverse multidrug resistance by inhibiting P-glycoprotein activity in multidrug resistant human cancer cells, Phytomedicine 21 (2014)

11