Detection and Analysis of Helicobacter pylori DNA in the Gastric Juice, Saliva, and Urine by Nested PCR

Oral Science International, May 2008, p.24-34 Copyright © 2008, Japanese Stomatology Society. All Rights Reserved.

Detection and Analysis of Helicobacter pylori DNA in the Gastric Juice, Saliva, and Urine by Nested PCR Ryuhei Yamada1, Akira Yamaguchi2 and Koichi Shibasaki3 1 2

Oral and Maxillofacial Surgery, Osaka Prefectural General Hospital

Department of Oral and Maxillofacial Surgery, The Nippon Dental University School of Life Dentistry at Niigata 3

Department of Internal Medicine, The Nippon Dental University Medical Hospital at Niigata

Abstract : The aim of this study was to investigate the strain heterogeneity of Helicobacter pylori (H. pylori) in saliva, gastric juice, and urine by nested PCR and the direct sequence method, and to clarify the mode of transmission by examining whether H. pylori in the stomach and saliva are identical. Thirty-nine patients undergoing endoscopy were enrolled in this study. H. pylori DNA was assayed in 104 samples using two sets of primers, EHC-U/EHC-L and ET-5U/ET-5L. DNA sequencing was performed in 24 samples. H. pylori DNA was detected in 39 gastric juice samples (100％ ) and in 28 saliva samples (71.8％ ). The prevalence in urine samples was 50％ (13/26). All samples except one were identical with over 97％ identity to the DNA sequence of H. pylori type strain J99 (USA). Nested PCR was highly sensitive for detection of H. pylori DNA in saliva, and DNA sequencing may be useful to clarify the mode of transmission. Key words : Helicobacter pylori, saliva, gastric juice, nested PCR, DNA sequence

Introduction In 1983, Helicobacter pylori (H. pylori) was isolated for the first time by Warren and Marshall1 from the gastric mucosa of patients with chronic gastritis. H. pylori is a Gram-negative helical rod, 0.5–1.0 μm width and 3.0–5.0 μm in length, with several sheathed flagella. The main characteristic of this bacterium is persistent infection in stomach mucosa by its strong urease activity2–6. Received 8/10/07 ; revised 11/20/07 ; accepted 12/17/07. Requests for reprints : Ryuhei Yamada, Oral and Maxillofacial Surgery, Osaka Prefectural General Hospital, 3–1–56 Bandai Higashi, Sumiyoshi-ku, Osaka-shi, Osaka 558-8558, Japan, Phone : ＋81–6–6692–1201, Fax : ＋81–6–6692–7000, E-mail : ryuhei@gh. pref.osaka.jp

H. pylori is widely known to cause chronic gastritis and peptic ulcer7–11, and recently a close link has been proposed to stomach cancer and poorly differentiated mucosa-associated lymphoid tissue (MALT) lymphoma of the stomach12–16. The main routes of infection are thought to be human to human, especially oral-oral and fecal-oral. However, the mechanism of infection has not yet been clarified in detail and remains an important issue for future study. The entire genomic structure of H. pylori was determined from strain 26695 isolated from a British patient in 199717 and strain J 99 isolated from an American patient18 in 1999. The genomes of these strains contained about 1.6 million base

May, 2008

Detection and Analysis of Helicobacter pylori DNA

pairs (bp). Although clinical diagnosis of H. pylori infection is most reliably performed by culture using gastric biopsy specimens, the culture techniques are not necessarily easy. Therefore, the rapid urease test (RUT) and the 13 C-urea breath test (13C-UBT) have been routinely used19,20. Recently, the polymerase chain reaction (PCR) method has been introduced for detection of H. pylori DNA21,22, and PCR products are directly analyzed by DNA sequencer to differentiate the type of strains. In this study, we detected H. pylori DNA from the gastric juice, saliva, and urine by nested PCR, and examined the heterogeneity of each gene. Subjects and Methods 1. Subjects The subjects were 39 patients (16 male and 23 female, with a mean age of 63.2 ± 10.5 years) undergoing endoscopy at The Nippon Dental University Medical Hospital. Nineteen, 17, and 3 patients were diagnosed as gastric ulcer, chronic gastritis and gastric cancer, respectively. All gastric juice samples tested positive for H. pylori DNA by nested PCR. A total of 104 samples from 39 patients were examined by nested PCR : 78 samples (26 patients) derived from three sources (gastric juice, saliva and urine), and 26 samples (13 patients) derived from two sources (gastric juice and saliva). Twenty-four H. pylori DNA-positive samples from 9 patients were analyzed by direct DNA sequencing : 18 samples (6 patients) were collected from three sources, and 6 samples (3 patients) from two sources. Informed consent was obtained from each patient, and the study was approved by the Board of Ethics of the Nippon Dental University, School of Life Dentistry at Niigata. 2. Methods 1) Sampling To avoid contamination by H. pylori, a sterile cotton roll was placed on the sublingual region of each patient for 10 minutes before endoscopy, and

25

then saliva was collected by compressing the cotton roll with a 10 ml syringe. Gastric juice was aspirated from a sterile tube inserted into the side hole of the gastrofiberscope. Urine samples were collected in the morning. All samples were stored at −80℃ until DNA extraction. 2) Preparation of H. pylori DNA for nested PCR Samples were thawed at room temperature, and DNA was extracted using a QIAmp DNA Mini Kit (QIAGEN Ltd., Crawley, UK). The thawed sample (50 μl) was injected into a microtube, and 150 μl of PBS and 20 μl of proteinase K solution were added. The mixture was incubated at 56℃ for 10 min, and then further incubated at 70℃ for 10 min after addition of 200 μl of Buffer AL. The mixture was subsequently washed with Buffer AW1 and AW2, and centrifuged at 8,000 rpm for 1 min after addition of 200 μl of Buffer AE. To the precipitate, 66 μl of 3M NaCl, 600 μl of 100% ethanol, and 1 μl of RAKUCHIN were added ; the mixture was kept at −80℃ for 10 min and then centrifuged at 15,000 rpm for 10 min. The supernatant was discarded, and the precipitate was dried and dissolved in 15 μl of TE buffer (10 mM Tris-HCl containing 1 mM EDTA, pH 8.0) to use as a DNA sample. 3) Detection of H. pylori DNA by nested PCR The first-step PCR was performed as follows. The reaction mixture consisted of 5 μl of DNA template, 5 μl of dNTP (2.5 mM), 5 μl of 10 × PCR reaction buffer (10 mM Tris-HCl, pH 8.3, with 15 mM MgCl2), 0.3 μl of Perkin-Elmer AmpliTaq DNA polymerase (Roche Molecular Systems, Inc., Branchburg, NJ, USA), and 3 μl each of primers EHC-U/EHC-L (Target 860-bp DNA, 417bp) (Table 1). Sterile distilled water was added to a final volume of 50 μl. PCR was performed using a“Robocycler Ⓡ Gradient 96”(STRATAGENE) (Fig. 1). Similarly, the second-step PCR was performed in a reaction mixture containing 5 μl of first-step PCR product, 5 μl of dNTP, 5 μl of 10 × PCR reaction buffer, 0.3 μl of Perkin-Elmer AmpliTaq DNA polymerase, 3 μl each of primers ET5U/ET-5L (Target 860-bp DNA, 230bp) (Table 1), and sterile distilled water added to a final volume of 50 μl (Fig. 1). The first and second step of am-

26

Oral Science International Vol. 5, No. 1

Fig. 1

Procedure for nested PCR amplification

(First- and second-step PCR were carried out under the same conditions)

Table 1 PCR primers

The sequences of PCR primers

) sequence (5’ → 3’

EHC-U EHC-L

CCCTCACGCCATCAGTCCCAAAAA AAGAAGTCAAAAACGCCCCAAAAC

ET-5U ET-5L

GGCAAATCATAAGTCCGCAGAA TGAGACTTTCCTAGAAGCGGTGTT

plification consisted of 30 cycles comprising a 90-sec denaturation step at 94℃, a 120-sec primer annealing step at 55℃, and a 90-sec primer extension step at 72℃23. The DNA of H. pylori (cultured strain) was used as a positive control, and sterile distilled water served as a negative control for each assay. The PCR products were electrophoresed on 2% agarose gels containing ethidium bromide. 4) DNA sequencing of nested PCR products DNA was extracted from a 230-bp band of the second-step PCR product using a gel extraction kit. DNA sequencing was performed on an ABI 377 autosequencer (Takara, Japan). 5) Statistical analysis The relationship between the amount of H. pylori DNA in gastric juice and the detection rates of H. pylori DNA in saliva and urine were analyzed by the χ2 test, and p ＜ 0.05 was considered significant. Results 1. Detection of H. pylori DNA by nested PCR The results of first-step PCR with the primer set

EHC-U/EHC-L, and second-step PCR with the primer pair ET-5U/ET-5L are shown in Fig. 2. H. pylori DNA was clearly recognizable as 417-bp and 230-bp bands, respectively. 2. Detection rates of H. pylori DNA H. pylori DNA was detected in gastric juice from all 39 patients. In saliva samples, H. pylori DNA was detected in 28 (71.8%) of the 39 patients, and in 13 (50.0%) of 26 patients in urine samples (Table 2 and Fig. 3). 3. H. pylori DNA-positive rates in simultaneously analyzed samples from three sources (gastric juice, saliva and urine) In 9 (34.6%) of the 26 patients whose samples were collected simultaneously, all samples of three sources were H. pylori DNA-positive by nested PCR assay. In 7 patients (26.9%), H. pylori DNA was detected in gastric juice and saliva, but not in urine. In 4 patients (15.4%), H. pylori DNA was detected in gastric juice and urine, but not in saliva. In 6 patients (23.1%), H. pylori DNA was detected in gastric juice, but not in saliva and urine. 4. Relationship between the intra-gastric amount of H. pylori, and the amount of H. pylori in saliva and urine If large amounts of H. pylori DNA were present, a 417-bp band was clearly shown in the first-step PCR. Even if a 417-bp band was not demonstrated because of a small amount of H. pylori DNA, a 230-bp band was clearly shown in the second-step

May, 2008

Detection and Analysis of Helicobacter pylori DNA

27

Fig. 2 The amplified products analyzed by agarose gel electrophoresis H. pylori DNA was clearly recognizable as 417-bp and 230-bp bands, respectively.

PCR. From this evidence, we semi-quantified the amount of H. pylori DNA in gastric juice by whether first-step PCR was positive or not. H. pylori DNA was detected in 27 (69.2%) of 39 gastric juice samples by first-step PCR, and 21 (77.8%) of these 27 patients were simultaneously positive in saliva by second-step PCR (Fig. 4a). In contrast, 26 patients were simultaneously investigated for H. pylori DNA in both gastric juice and urine. H. pylori DNA was detected in 19 (73.1%) gastric juice samples by first-step PCR, and 9 (47.4%) of these 19 patients were positive by second-step PCR in urine (Fig. 4b). Although, H. pylori DNA was not detected in 12 (30.8%) of 39 gastric juice samples by first-step PCR, 7 (58.3%) of these 12 patients were positive by second-step PCR in saliva (Fig. 4a). In contrast, H. pylori DNA was not detected in 7 (26.9%) of 26 gastric juice samples by first-step PCR, and 4 (57.1%) of these 7 patients were positive by second-step PCR in urine (Fig. 4b). From these results, H. pylori DNA in saliva was significantly associated with the amounts of H. pylori DNA in gastric juice (p ＜ 0.05). However,

H. pylori DNA in urine did not correlate with the amounts of H. pylori DNA in gastric juice. 5. DNA analysis The 230-bp second-step PCR products were extracted from 24 samples of 9 patients, and the sequences of 207 nucleotides at positions 77750– 77956 were compared with the H. pylori J99 genome (Fig. 5). C to T point mutation at position 77845 was recognized in all 24 samples, and T to G and G to A transition at positions 77809 and 77878 were confirmed in five and three of six urine samples, respectively. In Case 7 (a 61-yearold female), the H. pylori genome in gastric juice had mutations in 14 of the 207 nucleotides, while in the remaining patients the H. pylori genome had more than 98.6% identity to the H. pylori J99 genome. Discussion Since the PCR technique can artificially amplify the targeted DNA region more than one hundred thousand fold, it is an excellent method of sensitively and rapidly detecting the presence of trace

28

Oral Science International Vol. 5, No. 1

Table 2

Detection of H. pylori DNA using nested PCR in all samples from patients ( ＋: H. pylori DNA positive −: H. pylori DNA negative)

Case

Gender

Age

1st PCR (Gastric juice)

Gastric juice

Saliva

Urine

1 2 3 4 5 6 7 8 9 l0 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

F M F M F F F F F M M F F M M M M M F M F M M F F F M F M F F M F F M F F F F

32 70 45 76 78 65 77 57 54 58 59 65 73 60 70 68 85 48 62 49 75 57 63 77 65 75 66 70 63 57 47 58 61 59 63 72 68 78 39

＋ − ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ − − ＋ ＋ ＋ − − ＋ − ＋ ＋ ＋ ＋ ＋ − − ＋ ＋ − ＋ − ＋ ＋ − ＋ ＋ ＋ −

＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋

＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ − − − − − − − − − − ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ −

＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ ＋ − − − − − − − ＋ ＋ ＋ ＋ − − − − − − ND ND ND ND ND ND ND ND ND ND ND ND ND

amounts of pathogens such as viruses and bacteria. In addition, the nested PCR method further increases the detection sensitivity by designing the second pair of primers for a region within the target DNA amplified by a pair of primers and reamplifying the first PCR product as a new template. It has been reported that the nested PCR method can detect 0.01 pg of DNA24. Since one

cell of H. pylori has been reported to contain 0.0076 pg of DNA, DNA can be theoretically detected from one to two cells of H. pylori. However, this method has the drawback of being unable to distinguish between DNA from live bacteria and dead bacteria and being prone to contamination due to its high sensitivity. In this study, we detected H. pylori DNA from

May, 2008

Detection and Analysis of Helicobacter pylori DNA

29

Fig. 3

Detection rates of H. pylori DNA in gastric juice, saliva, and urine. H. pylori DNA was detected in gastric juice from all 39 patients. In saliva and urine, H. pylori DNA was detected in 71.8％ and in 50.0％ , respectively.

Fig. 4 H. pylori DNA-positive rates in simultaneously analyzed samples from three sources (gastric juice, saliva, and urine)

gastric juice, saliva, and urine by nested PCR using two pairs of primers, EHC-U/EHC-L and ET5U/ET-5L, targeting 417-bp and 230-bp DNA of H. pylori, respectively. The results of H. pylori DNA detection from various specimens by nested PCR using primers targeting urease A, B, and C have been reported25–38 (Table 3). Li et al.26 reported

that H. pylori DNA was detected in 84% of saliva samples by single-step PCR using primers EHCU/EHC-L targeting 860-bp DNA of H. pylori. Using the same primers, Song et al.30,36,39 reported that 100% of dental plaques and 64.0% of saliva samples were positive for H. pylori DNA. Using nested PCR with primer pairs ET1-U/ET1-L and

30

Oral Science International Vol. 5, No. 1

Fig. 5 Comparison of the sequence of 207 nucleotides at positions 77750-77956 in the H. pylori J99 genome and the patients C to T point mutation at position 77845 was recognized in all 24 samples. In Case 7, the H. pylori genome in gastric juice had mutations in 14 of the 207 nucleotides, while in the remaining patients the H. pylori genome had more than 98.6％ identity to the H.pylori J99 genome.

ET4-U/ET4-L targeting 850-bp DNA, Jiang et al.29 reported that H. pylori DNA was detected in 22% of saliva samples by first-step PCR and in 73% of saliva samples by second-step PCR. Kuwahara et al.23 reported that H. pylori DNA was detected in 78.1% (25/32) of saliva samples by single-step PCR using primers HP-1/HP-2 targeting urease B. We similarly detected H. pylori DNA in the saliva of

28 (71.8%) of 39 patients with H. pylori-positive gastric juice by nested PCR. However, since H. pylori is not necessarily distributed evenly in saliva40, and since the PCR method is so sensitive that it can detect DNA in trace amounts in samples, the failure to detect H. pylori DNA should not necessarily lead to the conclusion that saliva is negative for H. pylori, and further it is impor-

May, 2008

31

Detection and Analysis of Helicobacter pylori DNA

Table 3

Summary of studies on detection of H. pylori DNA in gastric biopsy specimens, dental plaque, and saliva by various primers

Reporter

Primers

Target DNA

Sample

Method

Detection rates

26

EHC-U/EHC-L

860-bp DNA, 417 bp

Gastric biopsy Specimens

Single PCR

100% (71/71)

Li et al.

Saliva Fecal

84.0% 25.0%

(57/68) (15/61)

Jiang et al.29

ET1-U/ET1-L ET4-U/ET4-L

850-bp DNA, 283 bp 203 bp

Saliva

Nested PCR

73.0% (33/45)

Song et al.30,36,39

HPU1/HPU2 HP1/HP2

Urease A, 411 bp 16SrRNA, 109 bp

Dental plaque Dental plaque

Single PCR Single PCR

26.5% 78.9%

EHC-U/EHC-L ET-5U/ET-5L

860-bp DNA, 417 bp 230 bp

Dental plaque Saliva

Nested PCR Nested PCR

100% (40/40) 64.0% (16/31)

Kuwahara et al.23

HP-1/HP-2

Urease B, 759 bp

Saliva

Single PCR

78.1% (25/32)

Berroteran et al.38

HPU1/HPU2

Urease A, 411 bp

Gastric biopsy Specimens Dental plaque

Single PCR

75.0% (24/32)

(9/34) (30/38)

37.5% (12/32)

Wang et al.35

ET-2U/ET-2L

860-bp DNA, 417 bp

Saliva

Single PCR

71.0% (22/31)

Yamada et al.41

EHC-U/EHC-L ET-5U/ET-5L

860-bp DNA, 417 bp 230 bp

Gastric juice Saliva Urine

Nested PCR

100% 71.8% 50.0%

tant to consider sampling errors and contamination in the interpretation of results. Although it is well known that H. pylori DNA can be detected in the stomach, oral cavity, and feces26,28, our literature search failed to find a report describing its detection in urine. In this study, we detected H. pylori DNA for the first time in urine of 13 (50.0%) of 26 H. pylori positive patients. The possible mechanism of entry of H. pylori DNA into the blood circulation and the urine remains incompletely defined. However, likely pathways are that H. pylori DNA enters the blood circulation throughout the injured gastric mucosa, or H. pylori digested and absorbed into the small intestine reaches the liver via the portal vein and is subsequently released into the blood as H. pylori DNA. Thereafter, H. pylori DNA may be filtered through the renal glomeruli and excreted in the urine. A second possibility is an H. pylori infection in the urinary bladder or kidney, with H. pylori DNA subsequently detected in the urine. Therefore, detailed pathways and their clinical significance remain major issues for further re-

(39/39) (28/39) (13/26)

search. In the nested PCR assay, a positive first-step PCR for H. pylori DNA suggests the presence of more abundant DNA than a positive second-step PCR. Therefore, in this study we examined the relationships between the amounts of H. pylori DNA in gastric juice and the detection rates of H. pylori DNA in saliva and urine. As a result, H. pylori DNA was detected in 27 (69.2%) of 39 patients in gastric juice by first-step PCR, and 21 (77.8%) of these 27 gastric juice samples were simultaneously positive by second-step PCR in saliva. This suggested that the content of H. pylori DNA in gastric juice was positively related to the detection rate of H. pylori DNA in saliva. On the other hand, 19 (73.1%) of 26 patients simultaneously investigated for H. pylori in both gastric juice and urine tested positive for H. pylori DNA by first-step PCR in gastric juice, but only 9 (47.4%) of these 19 patients were positive by second-step PCR in urine. This suggested that the detection rate of H. pylori DNA in the urine did not correlate with the amounts of H. pylori DNA in gastric juice. The assay using mixed saliva con-

32

taminated by food debris and dental plaque may be the main reason, though further studies will be needed to clarify whether H. pylori DNA is detectable in pure saliva. We analyzed DNA targeting a total of 207 bp at positions 77750 to 77956 of the H. pylori J99 genome, and noted more than 98.6% identity with the exception of the gastric juice of the Case 7 patient, confirming the practically identical bacterial strain. From these results, we confirmed that the two pairs of primers used in this study were superior to other primers. However, in Case 7 (the 61-year-old female), the sequence identity in gastric juice was low at 93.2%. These data suggest that more than one H. pylori strain may exist in the gastric juice, saliva, and urine of the same patients. Yamamoto et al.41 reported a 9-year-old boy reinfected with different strains of H. pylori after eradication therapy. Recent studies42 have reported infection of patients by more than one strain of H. pylori. In this study, all samples had C to T point mutation at position 77845. This is a very interesting finding, suggesting the possibility of a region-specific type of H. pylori.

Oral Science International Vol. 5, No. 1

primer (EHC-U/EHC-L and ET-5U/ET-5L) are superior to other previously reported primers for H. pylori DNA. 5. Detailed pathways and their clinical significance of urinary H. pylori DNA remain major issues for further studies.

References 1. Marshall B.J., and Warren J.R. : Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 4：1273–1275, 1983. 2. Slomiany B.L., Bilski J., Sarosiek J., Murty V.L., Dworkin B., VanHorn K., Zielenski J., and Slomiany A. : Campylobacter pyloridis degrades mucin and undermines gastric mucosal integrity. Biochem Biophys Res Commun 144：307–314, 1987. 3. Dunn B.E., Campbell G.P., Perez-Perez G.I., and Blaser M.J. : Purification and characterization of urease from Helicobacter pylori. J Biol Chem 265：9464–9469, 1990. 4. Marshall B.J., Goodwin C.S., Warren J.R., Murray R., Blincow E.D., Blackbourn S.J., Phillips M., Waters T.E., and Sanderson C.R. : Prospective double-blind trial of duodenal ulcer relapse after eradication of Campylobacter pylori. Lancet 2：1437–1442, 1988. 5. Gulisano M., Marceddu S., and Tanda F. : Morphologic study of the gastric mucosa during Helicobacter pylori infections. Ital J Anat Embryol 97：229–238, 1992. 6. Dooley C.P., Cohen H., Fitzgibbons P.L., Bauer M., Apple-

Conclusions 1. H. pylori DNA was detected in the saliva of 28 (71.8%) of 39 patients in whose gastric juice H. pylori DNA was detected by nested PCR, and in the urine of 13 (50.0%) of 26 patients. 2. H. pylori DNA in saliva was significantly associated with the amounts of H. pylori DNA in gastric juice (p ＜ 0.05). However, H. pylori DNA in urine did not correlate with the amounts of H. pylori DNA in gastric juice. 3. As all except one case showed more than 98.6% identity with the H. pylori J99 strain by the direct sequencing analysis method, we speculated that they were infected with an identical strain of H. pylori. In Case 7 (a 61-year-old female), H. pylori genome in gastric juice had mutations in 14 of the 207 nucleotides, and the sequence identity was 93.2%, suggesting double infection with strains of different subtypes. 4. This study demonstrated that the two pairs of

man M.D., Perez-Perez G.I., and Blaser M.J. : Prevalence of Helicobacter pylori infection and histologic gastritis in 321：1562–1566,

asymptomatic persons. N Engl J Med 1989.

7. Graham D.Y. : Campylobacter pylori and peptic ulcer disease. Gastroenterology 96：615–625, 1989. 8. Hopkins R.J., Girardi L.S., and Turney E.A. : Relationship between Helicobacter pylori eradication and reduced duodenal and gastric ulcer recurrence : a review. Gastroenterology 110：1244–1252, 1996. 9. Cave D.R. : Transmission and epidemiology of Helicobacter pylori. Am J Med 100(5A)：12S–17S, 1996. 10. Howden C.W. : Clinical expressions of Helicobacter pylori infection. Am J Med 100(5A)：27S–32S, 1996 . 11. Lambert J.R., Lin S.K., and Aranda-Michel J. : Helicobacter pylori. Scand J Gastroenterol Suppl

208：

33–46, 1995. 12. Asaka M., Kimura T., Kato M., Kudo M., Miki K., Ogoshi K., Kato T., Tatsuta M., and Graham D.Y. : Possible role of Helicobacter pylori infection in early gastric cancer development. Cancer 73：2691–2694, 1994. 13. Uemura N., Okamoto S., Yamamoto S., Matsumura N.,

May, 2008

Detection and Analysis of Helicobacter pylori DNA

Yamaguchi S., Yamakido M., Taniyama K., Sasaki N., and Schlemper R.J.: Helicobacter pylori infection and the

33

molecular typing of Helicobacter pylori in saliva and gastric mucosa. Jpn J Maxillofac Surg 46：497–502, 2000.

345：

24. Ho S.A., Hoyle J.A., Lewis F.A., Secker A.D., Cross D.,

14. Parsonnet J., Friedman G.D., Vandersteen D.P., Chang Y.,

and Taylor G.R. : Direct polymerase chain reaction test for

Vogelman J.H., Orentreich N., and Sibley R.K.:

detection of Helicobacter pylori in humans and animals. J Clin Microbiol 29：2543–2549, 1991.

development of gastric cancer. N Engl J Med 784–789, 2001.

Mapstone N.P., Dixon M.F., Wyatt J.I., Tompkins D.S.,

Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 325：1127–1131, 1991. 15. Wotherspoon A.C., Diss T.C., Pan L.X., Schmid C., KerrMuir M.G., Lea S.H., and Isaacson P.G.: Primary low-

25. Fujimoto S., Marshall B., and Blaser M.J. : PCR-based restriction fragment length polymorphism typing of Helicobacter pylori. J Clin Microbiol 32：331–334, 1994.

grade B-cell lymphoma of the conjunctiva : a mucosa-asso-

26. Li C., Ha T., Ferguson D.A. Jr., Chi D.S., Zhao R., Patel

ciated lymphoid tissue type lymphoma. Histopathology 23：417–424, 1993.

N.R., Krishnaswamy G., and Thomas E. : A newly devel-

16. Konturek P.C., Konturek S.J., Starzyska T., Marlicz K.,

oped PCR assay of H. pylori in gastric biopsy, saliva, and feces. Evidence of high prevalence of H. pylori in saliva 41：2142–2149,

Bielanski W., Pierzchalski P., Karczewska E., Hartwich A.,

supports oral transmission. Dig Dis Sci

Rembiasz K., Lawniczak M., Ziemniak W., and Hahn E.C. :

1996.

Helicobacter pylori-gastrin link in MALT lymphoma. Aliment Pharmacol Ther 14：1311–1318, 2000.

27. Stone G.G., Shortridge D., Flamm R.K., Beyer J., Ghoneim A.T., and Tanaka S.K. : PCR-RFLP typing of ureC

17. Tomb J.F., White O., Kerlavage A.R., Clayton R.A., Sutton

from Helicobacter pylori isolated from gastric biopsies

G.G., Fleischmann R.D., Ketchum K.A., Klenk H.P., Gill

during a European multi-country clinical trial. J Antimi-

S., Dougherty B.A., Nelson K., Quackenbush J., Zhou

crob Chemother 40：251–256, 1997.

L., Kirkness E.F., Peterson S., Loftus B., Richardson D.,

28. Bamford K.B., Lutton D.A., O’ Loughlin B., Coulter W.A.,

Dodson R., Khalak H.G., Glodek A., McKenney K.,

and Collins J.S. : Nested primers improve sensitivity in

Fitzegerald L.M., Lee N., Adams M.D., Venter J.C., et al. :

the detection of Helicobacter pylori by the polymerase chain reaction. J Infect 36：105–110, 1998.

The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388：539–547, 1997.

29. Jiang C., Li C., Ha T., Ferguson D.A. Jr., Chi D.S., Laffan

18. Alm R.A., Ling L.S., Moir D.T., King B.L., Brown E.D.,

J.J., and Thomas E. : Identification of H. pylori in saliva

Doig P.C., Smith D.R., Noonan B., Guild B.C., deJonge B.L., Carmel G., Tummino P.J., Caruso A., Uria-Nickelsen

by a nested PCR assay derived from a newly cloned DNA probe. Dig Dis Sci 43：1211–1218, 1998.

M., Mills D.M., Ives C., Gibson R., Merberg D., Mills S.D.,

30. Song Q., Haller B., Schmid R.M., Adler G., and Bode G. :

Jiang Q., Taylor D.E., Vovis G.F., and Trust T.J. : Genomic-

Helicobacter pylori in dental plaque : a comparison of different PCR primer sets. Dig Dis Sci 44：479–484, 1999.

sequence comparison of two unrelated isolates of the hu397：

31. Leung W.K., Siu K.L., Kwok C.K., Chan S.Y., Sung R., and

19. Marshall B.J., Warren J.R., Francis G.J., Langton S.R.,

children and its implication in gastro-oral transmission. Am J Gastroenterol 94：2881–2884, 1999.

man gastric pathogen Helicobacter pylori. Nature 176–180, 1999.

Goodwin C.S., and Blincow E.D. : Rapid urease test in the management of Campylobacter pyloridis-associated gastritis. Am J Gastroenterol 82：200–210, 1987. 20. Graham D.Y., Klein P.D., Evans D.J. Jr., Evans D.G., Alpert L.C., Opekun A.R., and Boutton T.W. : Campylobacter

Sung J.J. : Isolation of Helicobacter pylori from vomitus in

32. Kim N., Lim S.H., Lee K.H., You J.Y., Kim J.M., Lee N.R., Jung H.C., Song I.S., and Kim C.Y. : Helicobacter pylori in dental plaque and saliva. Korean J Intern Med 187–194, 2000.

15：

pylori detected noninvasively by the 13C-urea breath test. Lancet 1：1174–1177, 1987.

33. Tanahashi T., Kita M., Kodama T., Sawai N., Yamaoka Y.,

21. Westblom T.U., Phadnis S., Yang P., and Czinn S.J. : Diag-

PCR-restriction fragment length polymorphism analysis

nosis of Helicobacter pylori infection by means of a poly-

and PCR-direct sequencing methods for differentiating

merase chain reaction assay for gastric juice aspirates.

Helicobacter pylori ureB gene variants. J Clin Microbiol 38：165–169, 2000.

Clin Infect Dis 16：367–371, 1993.

Mitsufuji S., Katoh F., and Imanishi J. : Comparison of

22. Nowak J.A., Forouzandeh B., and Nowak J.A. : Estimates

34. Goosen C., Theron J., Ntsala M., Maree F.F., Olckers A.,

of Helicobacter pylori densities in the gastric mucus layer

Botha S.J., Lastovica A.J., and van der Merwe S.W. : Eval-

by PCR, histologic examination, and CLO test. Am J Clin Pathol 108：284–288, 1997.

uation of a novel heminested PCR assay based on the phosphoglucosamine mutase gene for detection of

23. Kuwahara T., Shibasaki K., and Yamaguchi A. : Study of

Helicobacter pylori in saliva and dental plaque. J Clin Mi-

34

Oral Science International Vol. 5, No. 1

51：764–770, 2002.

crobiol 40：205–209, 2002. 35. Wang J., Chi D.S., Laffan J.J., Li C., Ferguson D.A. Jr.,

39. Song Q., Lange T., Spahr A., Adler G., and Bode G. : Char-

Litchfield P., and Thomas E. : Comparison of cytotoxin

acteristic distribution pattern of Helicobacter pylori in

genotypes of Helicobacter pylori in stomach and saliva. Dig Dis Sci 47：1850–1856, 2002.

dental plaque and saliva detected with nested PCR. J Med Microbiol 49：349–353, 2000.

36. Song Q., Spahr A., Schmid R.M., Adler G., and Bode G. :

40. Berloco P., Cavallini A., Di Leo A., and Russo F. : Saliva

Helicobacter pylori in the oral cavity : high prevalence and great DNA diversity. Dig Dis Sci 45：2162–2167, 2000.

samples not a reliable tool for diagnosis of Helicobacter

37. Chong S.K., Lou Q., Fitzgerald J.F., and Lee C.H. : Evaluation of 16S rRNA gene PCR with primers Hp1 and Hp2

pylori infection. Eur J Clin Microbiol Infect Dis

20：

68–69, 2001. 41. Yamamoto T. : Molecular Epidemiology of Intrafamilial

34：

Helicobacter pylori Infectionsin Childhood in Japan. Niigata Medical Journal 114：147–151, 2000.

38. Berroteran A., Perrone M., Correnti M., Cavazza M.E.,

42. Yamamoto T. : Molecular Epidemiology of Intrafamilial

for detection of Helicobacter pylori. J Clin Microbiol 2728–2730, 1996.

Tombazzi C., Goncalvez R., and Lecuna V. : Detection of

Transmission of Helicobacter pylori in Japan. Ulcer Re-

Helicobacter pylori DNA in the oral cavity and gastroduo-

search 27(2)：140–143, 2000.

denal system of a Venezuelan population. J Med Microbiol