Detection and identification of ruminant and porcine pestiviruses by nested amplification of 5′ untranslated cDNA regions

Journal of Virological Methods

ELSEVIER

Journal

of Virological

Methods

64 (1997) 43-56

Detection and identification of ruminant and porcine pestiviruses by nested amplification of 5’ untranslated cDNA regions Torstein

Sandvik+*,

David

J. Patonb,

Paul J. Lowingsb

“Department qf Virology mu’ Serodiagnostits, Central Veterinary Laboratory, P.O. Bou 8156 Dep., N-0033 Oslo, Norwq bCentral Veterinary Laboratory, New Hati,, Weybridge, Surrey KT15 3NB, UK Accepted

27 September

1996

Abstract Based on published gene sequences of bovine viral diarrhoea virus (BVDV) type I and classical swine fever virus (CSFV), genus- and species-specific primers were designed to detect and identify pestivirus cDNA sequences in a nested polymerase chain reaction (PCR). The PCR primers were validated using cDNA synthesized from 146 pestivirus isolates, comprising representatives of all four so far described genotypes (BVDV type I, BVDV type II, CSFV and border disease virus), as well as others of uncertain classification. PCR products of the predicted size were amplified from all viruses with the genus-specific primers. All 53 cattle isolates, including 5 typed antigenically as BVDV type II were amplified by the internal BVDV-specific primers, but not the CSFV-specific primers. The same result was found for other BVDV type I and II viruses isolated from sheep and pigs. Seventy-seven CSF viruses were amplified by their respective internal primers. Available information strongly indicate that 4 CSF viruses also amplified by the BVDV-specific primers had been contaminated with BVDV in cell cultures. Border disease viruses were mostly not detected by the BVDV-specific primers, but were detected weakly by the CSFV-specific primer pair. Using carrier RNA for extraction of viral RNA, the sensitivity of detection of the single and nested PCR was, respectively, 5 and 50 times higher than obtained with a cell culture assay. The RT-PCR also detected BVDV in all of 15 commercial batches of fetal calf serum examined, and verified three earlier diagnoses of CSFV by detecting specific gene sequences in 30 year old frozen archival organ samples. Copyright 0 1997 Elsevier Science B.V. K~_JwYw~,s:Pestivirus; reaction

* Corresponding 0166.0934/97:$17.00

Bovine viral diarrhoea

author.

Tel.:

Copyright

PIISO166-0934(96)02136-2

virus; Classical

+ 47 2296 4665; Fax:

#G 1997 Elsevier

Science

swine fever virus; Reverse

+ 47 2246 0034

B.V. All rights

reserved

transcription-polymerase

chain

44

T. Sandcik

CI al. : Jotmud

oj Virolo~icul

1. Introduction Pestiviruses are important pathogens of cattle, swine and sheep (Baker, 1987; Terpstra, 1991). Classified as a genus within the Flaviviridae, these small, enveloped, predominantly noncytopathogenie positive-stranded RNA viruses cause a wide range of clinical conditions in their natural hosts. Four viral species or genotypes are currently recognised (Becher et al., 1995; Paton, 1995). Classical swine fever virus (CSFV) occurs naturally only in pigs; bovine viral diarrhoea virus (BVDV) type I is the predominant pestivirus of cattle, but also occurs in sheep and pigs; BVDV type II (also known as ‘atypical pestivirus’, Paton, 1995) has been described most often in cattle, but also in sheep and pigs; and border disease virus (BDV) is a mainly ovine pathogen, occasionally infecting pigs. In most bovine populations, a high rate of pestivirus infection is maintained by virus shed from persistently infected immunotolerant animals (Baker, 1987). Generally, most acute pestiviral infections of cattle are subclinical, or result in full recovery, but clinically severe disease has also been described (Corapi et al., 1990; David et al., 1994; Pellerin et al., 1994). A consequence of the high worldwide incidence of bovine pestivirus infections is frequent contamination of fetal calf serum with both virus and virus-specific antibodies (Bolin et al., 1991). Besides complicating routine diagnostic work in laboratories (Edwards, 1990), BVDV types I and II have also contaminated vaccines, both human (Harasawa and Tomiyama, 1994) and veterinary. In the latter case, this has led to harmful pestivirus infections in swine, goats, sheep and cattle (Wensvoort and Terpstra, 1988; Lerken et al., 1991). The clinical consequences of outbreaks of classical swine fever (CSF, synonym hog cholera) are usually far more serious than infections with other pestiviruses. CSFV strains of high, moderate and low virulence have been described (Van Oirschot, 1988), but since even low-virulent strains are foetopathogenic, and cause significant losses in pig breeding units, outbreaks of CSFV are often controlled by statutory destruction of infected animals. Since other pestiviruses can also infect pigs

Mrrlrod~ 64 (1997) 43-56

under natural circumstances, sometimes with symptoms indistinguishable from low-virulent CSFV strains (Terpstra and Wensvoort, 1988; Paton et al., 1992; Frey et al., 1995), reliable laboratory tests able to distinguish between CSFV and other pestiviruses are of great importance. Reference methods for pestivirus diagnostic work include use of cell cultures and specific antisera for virus isolation and serology. The introduction of monoclonal antibodies (mAbs) against pestiviruses has improved the quality of the diagnostic tests considerably, primarily by their ability to distinguish between CSFV and other pestiviruses (Edwards et al., 1991), but also by allowing the development of cell-culture independent enzyme immunoassays to be used for routine screening of large numbers of samples (Juntti et al., 1987; Wensvoort et al., 1988; Entrican et al., 1995). Nevertheless, cell culture-based techniques remain the standard reference methods for all pestivirus diagnostic work, and with them, the need for continuous monitoring of cell cultures and media for viral contamination. Primer-directed amplification of cDNA has proved to be a rapid and sensitive method for detection of even small amounts of viral nucleic acid. Several investigators have used the polymerase chain reaction (PCR) to detect pestivirus nucleic acid (reviewed by BClak and Ballagi-Pord8ny, 1993; Alansari et al., 1993; Ridpath et al., 1993; Schmitt et al., 1994; Da Silva et al., 1995; Hamel et al., 1995; Horner et al., 1995; Radwan et al., 1995; Tajima et al., 1995), or for analysis of PCR amplified cDNA for identification of pestiviruses (Boye et al., 1991; De Moerlooze et al., 1993; Hofmann et al., 1994; VilEek et al., 1994). Using species-specific PCR primers, cDNAs of the protein-encoding parts of the pestivirus genome have been amplified for selective detection of CSFV (Katz et al., 1993; Wirz et al., 1993; Lowings et al., 1994) or to discriminate between different BVDV strains and BDV (Sullivan and Akkina, 1995). Recently, Canal et al. (1996) designed primers from the 5’ untranslated region (5’-UTR) for selective amplification of CSFV and BVDV. The function of the 5’-UTR is not completely understood, but there are indications that it is of importance for efficient translation initiation. A proposed secondary structure model of the 5’-

T. Sandcik

rt al.

1Journal of’ Virological Methods 64 (1997) 43-56

UTR indicated loop structures of striking similarity between different pestiviruses (Deng and Brock, 1993) one of which is also structurally similar to an internal ribosome entry site identified within the 5’-UTR of hepatitis C virus (Le et al., 1995). Since the similarity of these loop structures is maintained by base-pairing of self-complementary runs of up to seven nucleotides, this implies a more strict conservation of some parts of the 5’-UTR sequence compared to the flexibility permitted by codon degeneracy within proteinencoding parts of the genome. Hypothesizing that the differences between the 5’-UTRs of BVDV type I and CSFV would allow us to design PCR primers able to differentiate these two virus species, we examined published 5’-UTR gene sequences for internal primer candidates, flanked by a pair of primers designed to recognise pestiviruses generically. The primer candidates were tested by amplification of cDNA from a representative selection of pestiviruses isolated from cattle, pigs and sheep, as well as on various samples which are frequently investigated for presence of pestiviruses.

2. Materials

and methods

2.1. Viruses and cell cultures A geographically representative selection of 45 Norwegian cattle pestiviruses, as well as one Swedish BVDV type I isolate, two BVDV type I reference strains, 3 Canadian and 2 English BVDV type II isolates were included (Table 1). The most recent Norwegian isolates had been stored as blood plasma from animals persistently infected with pestiviruses, and were propagated by inoculating bovine fetal kidney (BFK) cell cultures (approximately 5 cm2 in tubes) with 50 ~1 volumes of plasma. After adsorption for 1 h at 37°C fresh minimal essential medium (MEM) was added, and the cells were incubated for 4 days at 37°C in a 5% CO, atmosphere. Negative controls were inoculated with plasma from a healthy, known uninfected animal. Seventy-seven CSFV isolates and strains were selected to form a panel of viruses differing by

45

year of origin, virulence, geographical origin and genetic classification (Table 2, Lowings et al., 1996). Eleven ovine pestiviruses were selected. These included isolates typed by mAbs as BDV or BVDV types I and II (Paton, 1995) and three Norwegian isolates that had not been typed. Three porcine, non-CSFV pestiviruses were also analysed. These had been previously typed antigenitally as BDV or BVDV type II, whilst a deer and a giraffe virus are of uncertain classification (Table 1). The CSFV and BDV isolates were grown in PK15 and ovine testis cells, respectively. 2.2. Sequence

injbrmution

und PCR primer

design

The 5’-UTRs of the cDNA sequences of five published pestivirus genomes (Renard et al., 1987; Collett et al., 1988; Meyers et al., 1989; Moormann et al., 1990; Deng and Brock, 1992), as well as that of hepatitis C virus (Kato et al., 1990), were aligned and examined manually for PCR primers corresponding to pestivirus, CSFV and BVDV type I sequences, respectively. Using two computer programs (Amplify, W. Engels, Genetics Department, University of Wisconsin; OligoTM, National Biosciences, Plymouth, Minnesota), primer pair candidates were matched on the basis of near equal T, and checked for mispriming and dimerization potential. Although designed to be used as alternative pairs, the CSFV and BVDV primers were chosen to amplify targets of different length, to facilitate genotype identification. The selected oligonucleotide primers (Table 3) were synthesized at the Biotechnology Centre, University of Oslo. 2.3. RNA

extraction

and cDNA

synthesis

RNA was extracted from virus-infected cell cultures by either of two methods. For the Norwegian virus isolates, the acid guanidinium thiocyanate/phenol/chloroform method of Chomczynski and Sacchi (1987) was used essentially as described, except that drained inoculated cell cultures were lysed directly in 0.5 ml 4 M guanidinium SCN (solution D), to allow extraction in 1.5 ml microcentrifuge tubes. Extracted RNA was

46

T. Sun&k

Table 1 Non-CSFV isolates; origin, I-specific primer pairs Isolate

antigenic

er al. i Journal qf’ Vimlogical

classification

Origin

and

Antigenic

number

Mrtlmds

of isolates

classification

64 (1997) 43-56

amplified

with pestivirus-,

Amplification Pesti-

BVDV-

(55)

(60)

(55)

BVDV type I BVDV type I BVDV type I BVDV type II BVDV type II Untested Untested

+ + i

f + +

3 2 6 39

3 2 6 39

Sheep 60226 135661 13li4 Aveyron Moredun Weybridge Lees 173157 171 I-2031 3525-66 3908-2075

England, 1985 England, 1986 England, 1987 France, 1984 Scotland, 1976 England, 1977 England, I985 England, 1987 Norway, 1992 Norway, 1992 Norway, 1992

BDV BDV BDV BDV BDV BVDV type I BVDV type II BVDV type II Untested Untested Untested

+ + + + + + + + + + +

+ _ _

+ _ _

_

_ + + + + + +

Porcine 8716 Vosges Rutten

England, 1987 France, 1976 The Netherlands

BDV BVDV type II Uncertain

+ + +

_

Other Deer Giraffe

England, 197’~ Kenya. 1969

Uncertain Uncertain

+ +

+ + + + + +

+ +

i:, -

(+) and

~

represent

positive,

weak

precipitated twice with equal volumes of isopropanol, and after washing with 75% ethanol the dried RNA pellets were dissolved in 20 ~11 of diethyl pyrocarbonate-treated water, and eventually stored at - 70°C. For the other viruses, RNA was prepared by the acid phenol method (Stallcup and Washington, 1983). The RNA was reverse transcribed in 2.5 ~1 volumes containing 12 ~1 of dissolved RNA, 50 mM Tris-HCl, 75 mM KCI, 3 mM MgCl,, 0.5 mM dNTPs and 0.05 AZ6” units of random hexamer primers. This mixture was incubated at 90°C

positive

or negative

BVDV

type

CSFV-primers

USA, 1962 USA, 1960 Sweden, 1992 Canada, 1992-93 England, 1987 Norway, 1966 82 Norway, 1992 94

+,

and

results

Cattle NADL Oregon C24V 1 field isolate 3 field isolates 2 field isolates 6 field isolates 39 field isolates

Where applicable, temperatures.

CSFV-

(50)

(60)

(55)

(50)

_ _ 0 0 0 0

_ _ _

(+)

(+)

+ +

_

+ _ _ _

(+) _

+

_ (+) +

_

_ _

6,

amplification

(+) _ _

with

the

_ indicated

annealing

for 5 min and then cooled on ice before 20 units of human placenta ribonuclease inhibitor and 200 murine leukemia virus of Moloney units (MoMLV) reverse transcriptase (RT) were added. The first strand cDNA was synthesized at 37°C for 45 min. 2.4. Amplificution

und detection

of cDNA

For generic amplification of pestivirus cDNAs, 5 ~1 volumes of randomly primed cDNA were added to 20 /fl of PCR mixtures to give final

T. Sandvik et al. /Journal Table 2 CSFV isolates

and strains,

Isolate

origin

and number

of isolates

amplified

with pestivirus-,

Genetic classification (CSFV subgroup)

Origin

CSFV-

Amplification Pestivirus-

5 field isolates PS Porco 3 field isolates MS France Thiverval Bas - Rhin Brescia s7D2 D4878 3 field isolates CIW SID

ALD Al6 Hokkaido Osaka Kanagawa ALD VRI 201 VRI 503 3 field isolates 4 field isolates HCV-37 Porcivac Bergen van Zoelen Larvik Svelvik Gilja Baker A Eystrup Riems vaccine Eystrup Glentorf Osterode Atzbull 5 field isolates PS-Cells Porton Painswhin Liphook Moore Congenital Tremor 7 field isolates Baker A ALD Armour Old Lederdale 7 field isolates 33l-Old

Belgium, 1986 Brazil Brazil, 1987 France France, I978 France, 1986 Italy, 1945 Italy Italy, 1981 Italy, 1983 Italy, 1985 Italy, I992 (Japan) Japan Japan, 1966 Japan, 1971 Japan, 1974 (Malaysia) Malaysia, 1967 Malaysia, 1983 Malaysia. 1986 Malaysia, I986 Mexico The Netherlands, The Netherlands, Norway, 1960 Norway, 1961 Norway, 1963 (Norway) (Norway) Germany Germany Germany, 1968 Germany, 1982 Germany, 1984 Germany, 1986 UK UK, 19.56 UK, 1957 UK, 1964 UK, 1964 UK, 1986 USA USA, 1946 USA, 1946 USA, 1946 USA, 1954 USA, 1969

For reference viruses from laboratories classification is as described by Lowings + Positive, -, negative, nt, not tested.

5

2.3 I.1 1.1 1.1 I.1 2.3 1.2 2.1 2.3 2.3 2.2 2.3 I.1 1.1 I.1 2.3 0

1977 I977

41

of’ Virological Methods 64 (1997) 43-56

+ 3 + + + + + + 3 + + + + + + + + + + 3 4 + + + + + + + + + + + + + 5 + + + + + 7 + + + + 7 +

1.1 1.2 1.2 1.2 2.1 1.2 2.2 2.2 nt nt nt nt nt 1.1 1.1 I.1 2.3 2.3 2.3 I.1 1.1 I.1 I.1 ‘) 2.3 I.2 I.1 I.1 I.1 1.1 I.1

other than where et al. (1996).

they were isolated,

the country

and BVDV type I-specific

primer

pairs

with BVDV-

CSFV-primers

0 0

_ _ 3

_ + + + + + +

_ _ 0

3 4 + + +

0

_

+ + + + + +

+

_ _ 0 _ _ _ _ 0 _ _ _ _ 0 _

is given

in parenthesis.

The genetic

48

Table 3 Data of oligonucleotides

used as PCR primers

Designation

Sequence

P365R Pl03F

(5’.3’ direction)

Position

T,, “

Designed

TGTGCCATGTACAGCAGAGATT TAGCCATGCCCTTAGTAGGACT

386-365 NADL” 103- 124 in NADLh

64.5 64.9 1

280-284 bp from all pestiviruses

CACCCTATCAGGCTGTATTCGT AACAGTGGTGAGTTCGTTGGAT

335 314 in NADL” 145-166

65.2 65.2 1

191 bp from BVDV

B314R Bl45F

TATCAGGTCGTACCCCCATCAC CGTCAGTAGTTCGACGTGAGCA

306-285 I74- 195 in Alfort‘

68.0 67.7 I

133 bp from CSFV

S285R Sl74F “Primer hCollett ‘Meyers

melting temperature et al., 1988. et al., 1989.

in “C (calculated

with nearest

neighbor

concentrations of 20 mM Tris-HCI, 50 mM KCI, 1.5 mM M&l,, 0.2 mM dNTPs, as well as 25 pmol of each of the primers P103F and P365R, and 1 unit of Tuq DNA polymerase in 0.5 ml vials. The reaction was overlaid with 2 drops of mineral oil. The PCR mixtures were transferred directly from ice to a programmable thermocycler kept at 90°C and thereafter cycled 35 times between 94, 55 and 72°C with 1 min incubation steps at each temperature. Separate nested amplifications with either BVDV- or CSFV-specific primers were done in PCR-mixtures with identical ingredient concentrations, except that 0.551 ,~l volumes of pre-amplified cDNA targets were used. The temperature profile of the standard nested PCR was 94, 60 and 72°C each step also of 1 min duration, but for 30 cycles. For the BDV and atypical pestiviruses, nested amplifications with alternative annealing temperatures at 55 and eventually 50°C were also performed. In addition, six randomly selected generically amplified cDNAs were subjected to simultaneous nested PCR with both internal primer pairs in the PCR mixture. Amplified products were separated by electrophoresis in 2.5%~ agarose gels in Tris-acetate EDTA buffer, and identified by size comparison with a standard molecular weight ladder. 2.5. Comparative To examine assay, serially was tested for tures and with

sensitivity

assay

the detection limit of the RT-PCR diluted BVDV type I strain NADL both cytopathic effect in cell culthe nested BVDV-PCR. BFK cells

target

method).

in 96-well microplates were inoculated in quadruplicate with 100 /ll aliquots of virus diluted in log10 steps in Eagles MEM with 10% horse serum, and incubated for 5 days at 37°C in a 5% CO, atmosphere. From the observed cytopathic effect, the virus titer was calculated as a cell culture 50% infective dose (CUD,,,) per 100 ~11. Viral RNA was extracted from 100 111volumes of the serially diluted virus suspension, in two parallel series with or without 15-20 pug of yeast tRNA. For this quantitative assay, all of the extracted RNA was reverse transcribed. In the first round of amplification, 40% of the cDNA was amplified, and 20% of the amplification mixture was separated in the agarose electrophoresis, i.e. corresponding to 8’%) of the extracted viral nucleic acid.

In parallel with sterile water and horse serum as negative controls, 13 (or 50) ml samples of commercial batches of fetal calf and sheep serum were ultracentrifugated for 2 h in a SW-41 (or 45-Ti) rotor at 39000 (or 35 000) rpm, after which the pellets were lysed in 0.5 ml guanidinium SCN and RNA extracted as outlined above. RNA was also extracted from blood leucocytes from a calf persistently infected with BVDV, both as pellets contaminated with erythrocytes, or washed with ammonium chloride and phosphate buffered saline to remove the hemoglobin. Finally, RNA was extracted from approximately 0.5 g samples of lymph node and spleen from a recently suspected case of CSF in Norway, as well as from organ

49

T. Sandtiik et al. / Journal of Virological Methods 64 (1997) 43-56

1 Mw p

2

nB nS

P

nB

3 nS

P

nB

4 nS

P

nB

6

5 nS

P

nB

nS

P

nB

nS

&

369 -

- 284 246 -191 -133

123-

Fig. 1. Single and nested PCR amplification of cDNA from various pestiviruses. For each virus, 5 pl PCR products amplified with pestivirus- (P), nested with BVDV- (nB) and nested with CSFV-primers (nS) are shown. Flanked by 123-bp ladder molecular weight markers, the viruses are: (I) Oregon C24V, a cytopathogenic BVDV; (2) 941515-200, a recent Norwegian BVDV; (3) 92/180, a Canadian type II BVDV; (4) Negative control, cDNA from uninoculated BFK cells; (5) UK ll/86, an English CSFV and (6) D 4990, an Italian CSFV.

samples from pigs infected with CSFV during the last three outbreaks in Norway in 1960-1963 (Sandvik and N~ess, 1994). From the latter samples, which had been kept frozen (at - 20, and later at - 70°C) frozen 0.5 g pieces were homogenized directly in 1 ml volumes of solution D.

3. Results 3.1. Qualitative

detection

of pestivirus

cDNA

With the pestivirus-specific primers, PCR products of the expected sizes (280-284 bp) were amplified from all of the examined viruses (Tables 1 and 2). With nested PCR of generically amplified cDNAs, the primer pair S174F/S285R amplified 133 bp PCR products from all 77 CSFV isolates, but from none of the 53 bovine virus isolates, including 5 BVDV type II isolates. Conversely, the B145F/B314R primer pair directed synthesis of 191 bp fragments from all bovine virus isolates, as well as from four CSFV isolates.

In some of the negative controls DNA was amplified non-specifically, but in agarose electrophoresis no distinct DNA bands could be resolved. Examples of PCR products from reference strains and from some field isolates separated in agarose electrophoresis are shown in Fig. 1. In nested PCR using both internal primer pairs simultaneously, PCR products corresponding to the homologous species-specific primer pair were amplified (Fig. 2). From the panel of ovine and unusual porcine pestiviruses, the 6 isolates classified with mAbs as BDV were amplified inconsistently in the nested amplification steps. Four of them were qualitatively amplified with the S174F/S285R primer pair, but only, or most efficiently with annealing temperatures of 55 or 50°C. One isolate (60226) was also amplified with the B145F/B314R primer pair, while isolate 135661 failed to be amplified with either of the nested primer pairs. The remaining ovine, as well as the unusual porcine isolates Vosges and Rutten were amplified with the B145F/B314R primer pair only (Table 2).

When nested PCR was carried out using large quantities of template from the first round of PCR amplification, secondary PCR products resulting from interference by the outer primers were seen near their predicted sizes of 233 and 242 bp for the primer combinations P103F/B314R and B145F/P365R, and 194 and 228 bp for the primers S174F/P365R and P103F/S28SR, respectively (Figs. 1 and 3b). However, at the detection limit of the first-round PCR, i.e. when no products were visible in agarose gels, single DNA products were amplified with the internal primers in positive samples. Some BVDV and CSFV cDNAs reverse transcribed from infected cell cultures were also tested in single PCR using the species-specific primers, resulting in single PCR products of the predicted sizes after gel electrophoresis (data not shown). Non-specific amplification of additional DNA bands in the range 450-700 bp was sometimes seen with nested PCR, a1234567

most frequently with the CSFV primers (Fig. 2). When the BVDV- and CSFV-specific primer pairs were combined and used simultaneously in a nested PCR, no additional PCR products were synthesized, as compared with use of a single internal primer pair. Varying other parameters reported to be of importance for the PCR had little influence on the reaction, e.g. comparable amounts of PCR products were synthesized with magnesium concentrations between 0.75 and 4 mM, with denaturing temperatures between 92 and 95°C and with 72°C elongation steps between 30 s and 2 min, and on several different thermocycling machines. 3.2. Sensitivity

ussessment

of BVDV

PCR

In the cell culture assay, the titer of the BVDV NADL test virus was 105.25 CCID,,/lOO ~1. When viral RNA was extracted with yeast carrier RNA, samples corresponding to dilutions down to 10 _ ’ CCID,,,/lOO ~1 were positive in the single PCR, and to lo- 7 CCID,,/lOO ,~l in the nested PCR (Fig. 3). With viral RNA extracted without yeast carrier RNA, the sensitivity was lo-100 times lower, both for the single and nested PCR. Generally, the detection limit varied more between different RT-PCR experiments than with the virus titration in cell cultures. 3.3. Detection organ sampks

of BVDV

and CSFV

in .sera und

369 -

246 -

- 284 -191

123-

-133

Fig. 2. Nested PCR amplification of generically amplified CSFV and BVDV cDNAs, with simultaneous use of both internal primer pairs. Rightwards from a I23-bp ladder molecular weight marker, 5 ,uI PCR producta of (I) CSFV Baker A; (2) CSFV Glentorf; (3) CSFV Svelvik (Norwegian): (4) BVDV NADL; (5) BVDV 941392-386 (Norwegian) and (6) BVDV type II 92!180 (Canadian) were separated along with a notarget negative control in lane 7.

Of 15 examined batches of fetal calf serum, 13 were positive after the first round of amplification, and all were positive after nested amplification with the BVDV primer pair. The two sheep serum batches, as well as the water and horse serum negative controls were negative after both rounds of PCR. BVDV-specific PCR products were amplified from both preparations of blood leucocytes (data not shown). With cDNA synthesised from archival organ samples from CSFV-infected pigs, a pestivirus PCR product was easily amplified from one of the samples. After first-round amplification, no pestivirus-specific DNA band, but a smear of nonspecifically amplified DNA was seen with samples

T. Sundcik

ut al. /Journal

of’ Virological

Metiwd.~ 64 (1997) 43-56

369

264

246123-

hII‘

2‘

3

4

5

6

7

8

9

IO

11

369 246

191

123

Fig. 3. Sensitivity of the RT-PCR on serially diluted BVD virus. RNA was extracted with yeast carrier-RNA, and after reverse transcription and PCR 5 ~1 samples were separated in 2..5”/1)agarose gels. (A) Amplification with pestivirus-specific primers; lane I. 123 bp molecular weight ladder; lanes 2-10, RNA corresponding to IO -’ to IO- “’ dilutions of BVDV NADL; lane I I, negative control. (B) nested amplification of I ~1 aliquots of the PCR products separated above with BVDV-specific primers.

from the other two organ samples. Repeat amplifications of cDNA reverse transcribed from smaller (20”/;1) amounts of extracted RNA, resulted in detection of weak bands of pestivirus PCR products from the latter two organ samples. All three archival organ samples were positive after nested amplification with the CSFV-primers. cDNA synthesised from the recent case of sus-

petted nested

CSF was negative in single PCR with all primer pairs.

as well

as

4. Discussion Although data from sequence analysis of the PCR products obtained with the P103F/P365R

primer pair would provide conclusive information on differences between the 5’-UTRs of pestiviruses, the amplification results obtained with our internal primer pairs suggest that the sequences important for primer-directed amplification are sufficiently conserved in BVD and CSF viruses to allow them to be identified as such. In other pestivirus PCR studies, BVDV and CSFV have more or less successfully been identified; both Katz et al. (1993) and Wirz et al. (1993) detected pestiviruses with 5’-UTR primers and used primers specific for coding regions of CSFV to identify the latter, but in spite of a high specificity all tested viruses were not detected. Some of the most conserved parts of the pestivirus genome are in the 5’-UTR, and several authors have earlier selected PCR primer pairs from the same conserved regions as our generic primers (Boye et al., 1991; Harasawa and Tomiyama, 1994; VilEek et al., 1994; Horner et al., 1995). Between these primer recognition sites, other regions conserved among pestiviruses have also been used for generic amplification of pestiviruses (Harasawa and Tomiyama, 1994; Hofmann et al., 1994; Schmitt et al., 1994; Hamel et al., 1995; Radwan et al., 1995). In several of the published PCR protocols intended to detect BVDV, the most successful PCR primers were in fact pestivirus-specific (Schmitt et al., 1994; Hamel et al., 1995; Horner et al., 1995; Radwan et al., 1995). With clinical samples from cattle, CSFV is unlikely to be encountered, but if a pestivirus-specific PCR is to be used to screen cell cultures for BVDV contamination then CSFV should also be checked for. Recently, CSFV was identified as a contaminant in a commercially available cell line (Bolin et al., 1994). Hofmann et al. (1994) and VilCek et al. (1994) both used 5’-UTR generic primers to amplify cDNA from all tested pestiviruses, and identified CSF viruses by nucleotide sequencing or by digestion of the PCR products with the restriction endonucleases (REs) AvuI and B&I, respectively. Using a similar approach, Boye et al. (1991) digested amplified 5’-UTR cDNA with the RE X!zoI, but were not able to digest PCR products amplified from their Alfort or ALD strains. Since both published CSFV nucleotide sequences include an X/z01 RE site at this

position, the RE digestion approach of species identification should be used with care, since a single point mutation, induced by propagation of the virus in cell cultures or even by the Tuy polymerase during an early PCR amplification step, may invalidate the species-discriminating principle. DNA sequencing is important for characterization of new virus isolates, but a speciesspecific PCR approach is technically simpler, and more rapid to perform. Using degenerate PCR primers, Lowings et al. (1994, 1996) successfully amplified parts of the El/E2 and putative polymerase genes from a representative panel of CSFV isolates, but from none of the tested ruminant pestiviruses. Similarly, Canal et al. (1996) were able to distinguish CSFV from BVDV and BDV with PCR primers from the 5’-UTR. However, with the latter assay the detection limit with the CSFV-specific primers was 100 times lower than with the BVDV-specific primers. Although specific, and suitable for identification of a pestivirus isolate, the detection limit of these assays might not be sufficient for direct detection of CSFV or BVDV in clinical samples. Our nested PCR approach proved particularly valuable for the clinical samples and for the fetal calf sera. For selective amplification of related cDNA sequences, the choices of and working conditions for the PCR primer pairs are important. Beyond the general requirements of similar melting temperatures, low tendencies of hybridization to self or to other parts of the targeted or host genome, the number of and positions of mismatches between the primers and the target sequences define the discriminating properties of the primers. Our findings of positive nested amplifications with both BVDV and CSFV primers on four of the CSF viruses do not necessarily indicate poor specificity of the BVDV primers. While the Eystrup strain in Oslo was positive with the BVDV primers, the same virus strain kept at Weybridge was negative. The three CSFV field isolates which were BVDV-positive in nested PCR had earlier shown to react with BVDV type Ispecific mAbs (Edwards and Sands, unpublished results), strongly indicating contamination with BVDV. Although BVDV naturally infects swinejt is very unlikely that BVDV and CSFV would be isolated from pigs simultaneously infected with

T. Sundcik

et al. / Journal of Virological

both viruses. The most likely source of this BVDV contamination is fetal calf serum used as cell culture medium supplement. Regarding the ovine viruses, it is interesting that the isolates which were weakly amplified with the CSFV primers, had earlier, based on mAb typing (Paton et al., 1994) and p20 sequence comparison (Roehe et al., 1992) been allocated to the BDV genogroup, which has been described as more similar to CSFV than to BVDV (Lowings and Paton, 1993). This group also included the porcine BDV isolate 87/6 which reacted similarly. However, two ovine BDV isolates reacted enigmatically. One, 135661, failed to be amplified with either of the nested primer pairs, whilst the other, 60226, was amplified with both of our nested PCR primers. The inconsistent results obtained with the BDV group probably illustrate that only small sequence differences may be responsible for a positive or a negative amplification. No information on the antigenic classification of the Norwegian ovine virus isolates is available. The three virus isolates in question originated from farms where both sheep and cattle were kept, and on all three farms cattle persistently infected with BVDV were identified in the same year. Transmission of BVDV from cattle to sheep is well documented (Carlsson, 1991), and even if losses of E2 epitopes have been described after reisolation of BVDV from sheep (Paton et al., 1995) no mechanism for alteration of the 5’-UTR after adaption to a new host species has been described. Without having conclusive evidence, our amplification results support the view that the Norwegian ovine pestivirus isolates are BVDVs. Our PCR primers were designed to distinguish between CSFV and BVDV type I. In the event, they showed the same specificity for BVDV type II as for BVDV type I, since all of the BVD type II viruses were only amplified with the BVDV primer pair. Since BVDV types I and II are the only pestiviruses so far shown to occur naturally in cattle, the generic and BVDV-specific primer sets should be very useful for pestivirus diagnosis in this species. The tendency of the CSFV primer pair to weakly amplify some BDV isolates could occasionally lead to a false positive diagnosis of CSFV in pigs. This might also be the case for

Methods

64 (1997) 43-56

53

other presumed CSFV-specific PCR assays as well, unless the ovine pestivirus isolates used for specificity testing actually have been typed as true BD viruses. As typed with monoclonal antibodies, the ovine pestivirus Weybridge is a BVDV type I pestivirus, and therefore questionable for the specificity testing of the CSFV-specific primer used by Canal et al. (1996). Similarly, Katz et al. (1993) used diagnostic isolates of BDV, which might not represent the diversity seen in European BD viruses. Both for verification of their taxonomic status, and to allow specific criteria for identification to be defined, more sequence data from a larger number of ovine isolates is needed. Most investigators have reported low detection limits for pestivirus PCRs, i.e. between 10 - ’ and 10 _ 2 CCIDst,. Although the maximal sensitivities of the single and nested PCR were 5 and 50 times higher than virus detection in cell cultures, other experiments resulted in lo- 100 times lower sensitivity than with the cell cultures. Such variations in sensitivity are frequently encountered with the PCR, and may be caused by variable reaction conditions, enzyme inhibitors or degradation of the DNA templates (Clementi et al., 1995). The nature of the sample material from which RNA is extracted has been shown to have influence on the sensitivity; with a quantitative PCR for detection of hepatitis C virus in blood, Manzin et al. (1994) found consistently lower levels of viral RNA in serum than in EDTA plasma samples from the same patients. So far, our data does not allow conclusions to be drawn regarding which factors influence the detection limit most. However, the fact that yeast RNA added to the RNA extraction step resulted in lo-100 times higher sensitivity indicates that our RNA extraction protocol either is suboptimal for cell-free samples, or that RNAse contamination may have degraded some of the target RNA before reverse transcription. The generic PCR products amplified from organ samples of pigs infected with CSFV were not amplified as efficiently as from inoculated cell cultures. High concentrations of RNA are reported to inhibit the PCR (Pikaart and Villeponteau, 1993) but if RNA extracted from organ samples is diluted to minimize this inhibition it will affect the sensitivity of the PCR as well. As

seen in agarose gels, the weakly amplified firstround PCR products of two of the CSFV-infected organ samples were mixed with residual RNA migrating at a size corresponding to 150&200 bp of DNA. This smear may conceal weak bands of directly amplified cDNA, or eventually smaller RE products from detection in agarose gels. After the second round of amplification, the contaminant RNA was diluted sufficiently not to interfere, and even weak bands of generic PCR products were strongly amplified. Despite the observed variations in sensitivity with serially diluted virus suspensions, all the tested fetal calf serum (FCS) batches were positive with the nested PCR. In previous screenings for BVDV in FCS (CVL, Oslo, unpublished observations), about 50% of the batches have usually been positive after four or five passages in cell cultures. The latter findings are in accordance with those of Bolin et al. (1991) who detected BVDV in 20&49’% of raw and commercial lots of FCS in a cell culture assay, respectively, as well as neutralizing antibodies in 14% of the lots of raw FCS. Although the PCR should be able to detect nucleic acid from BVDV neutralized by specific antibodies, little information is available on the risk the latter poses for contamination of cell cultures. For further evaluation of the PCR assay for detection of BVDV in FCS, simultaneous comparisons of RT-PCR and cultural viral detection are warranted. Currently, PCR assays are not alternatives for routine diagnosis of pestivirus infections. If carefully addressed, the risk of cross-contaminating negative samples with previously amplified, or simultaneously investigated positive samples can be controlled by appropriate means, but still, the cost of the assay restricts the use to samples giving inconclusive results with routine methods. Cattle persistently infected with BVDV may sometimes have low levels of antigen or virus in their blood, eventually giving negative results in cell culture assays (Waxweiler et al., 1991; Frey et al.. 199 1; Sandvik, unpublished observations). Antigen capture ELISAs have proved to be reliable for routine identification of cattle persistently infected with BVDV, but cannot be used on samples from calves with high levels of maternal

antibodies. For such samples, the PCR assay is an obvious alternative. Recently, several pestivirus antigen capture ELISAs were compared for early diagnosis of CSFV using blood samples (Depner et al., 1995). The PCR assay might be a useful supplement to these ELISAs, as well as to the routinely used immunofluorescence tests on cryostat sections. An unintended advantage of the PCR assay, as compared with cell culture diagnostic work for CSFV, is the inactivation of pestiviruses with guanidinium thiocyanate and phenol/chloroform during the RNA extraction, allowing samples to be handled in laboratories without the appropriate containment facilities for handling infectious virus. Further work with the described PCR assay should include examination of more BDV isolates, including sequence analysis in order to find alternative PCR primers specific for BDV. In addition, the simultaneous use of both nested PCR primer pairs should be tested more extensively, since this approach may simplify the PCR protocol significantly.

Acknowledgements Initial discussions with Dr E. Rimstad on PCR in general, and on strategy for PCR primer design are greatly appreciated. This work was partially supported by grant no 103081/l 30 from the Norwegian Research Council.

References Alansari. H., Brock. K.V. and Potgieter, L.N.D. (1993) Single and double polymerase chain reaction for detection of bovine viral diarrhea virus in tissue culture and sera. J. Vet. Diagn. Invest. 5, 148-153. Baker. J. (1987) Bovine viral diarrhea virus: a review. J. Am. Vet. Med. Assoc. 190, 1449 1458. Becher. P.. Konig, M., Paton. D.J. and Thiel. H.-J. (1995) Further characterization of Border Disease virus isolates: evidence for the presence of more than three species within the genus pestivirus. Virology 209, 200-206. Belak, S. and Ballagi-Pordany. A. (1993) Application of the polymerase chain reaction (PCR) in veterinary diagnostic virology. Vet. Res. Commun. 17, 55-72.

T. Sandcik rt al. / Journal of Vimlogical Methods 64 (1997) 4.3656 Bolin, S.R., Black, J.W., Frey, M.L., Katz, J.B., Ridpath, J.F. and Roblin, R.O. (1994) Detection of a cell line contaminated with hog cholera virus. J. Am. Vet. Med. Assoc. 205, 1422145. Bolin, S.R., Matthews, P.J. and Ridpath, J.F. (1991) Methods for detection and frequency of contamination of fetal calf serum with bovine viral diarrhea virus and antibodies against bovine viral diarrhea virus. J. Vet. Diagn. Invest. 3. 1999203. Boye, M., Kamstrup, S. and Dalsgaard, K. (1991) Specific sequence amplification of bovine virus diarrhea virus (BVDV) and hog cholera virus and sequencing of BVDV nucleic acid. Vet. Microbial. 29, l-13. Canal, C.W., Hotzel, I., de Almeida, L.L., Roehe, P.M. and Masuda, A. (1996) Differentiation of classical swine fever virus from ruminant pestiviruses by reverse transcription and polymerase chain reaction (RT-PCR). Vet. Microbial. 48, 313-379. Carlsson, U. (1991) Border disease in sheep caused by transmission of virus from cd& persistently infected with bovine virus diarrhoea virus. Vet. Rec. 128. 1455147. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal. Biochem. 162, 1566 159. Clementi, M., Menzo, S., Manzin, A. and Bagnarelli, P. (1995) Quantitative molecular methods in virology. Arch. Virol. 140, 152331539. Collett, M.S., Larson, R., Gold, C., Strick, D., Anderson, D.K. and Purchio, A.F. (1988) Molecular cloning and nucleotide sequence of the pestivirus bovine viral diarrhea virus. Virology 165, 191-199. Corapi, W.V., Elliott, R.D., French, T.W., Arthur. D.G., Bezek, D.M. and Dubovi, E.J. (1990) Thrombocytopenia and hemorrhages in veal calves infected with bovine viral diarrhea virus. J. Am. Vet. Med. Assoc. 196, 590-596. Da Silva, N., Zardoya, R., Santurde, Cl., Solana, A. and Castro, J.M. (1995) Rapid and sensitive detection of the bovine viral diarrhea virus genome in semen. J. Virol. Methods 55, 2099218. David, G.P., Crawshaw, T.R.. Gunning, R.F., Hibberd, R.C., Lloyd, G.M. and Marsh, P.R. (1994) Severe disease in adult dairy cattle in three UK dairy herds associated with BVD virus infection. Vet. Rec. 134, 468472. De Moerlooze, L., Lecomte, C., Brown-Schimmer, S., Schmetz, D., Guiot, C., Vandenbergh, D., Allaer, D., Rossius, M., Chappuis, G., Dina, D.. Renard, A. and Martial, J.A. (1993) Nucleotide sequence of the bovine viral diarrhoea virus Osloss strain: comparison with related viruses and identification of specific DNA probes in the 5’ untranslated region. J. Gen. Viral. 74. 1433-1438. Deng, R. and Brock, K.V. (1992) Molecular cloning and nucleotide sequence of a pestivirus genome, noncytopathic bovine viral diarrhea virus strain SD-l. Virology 191, 867-879. Deng, R. and Brock, K.V. (1993) 5’ and 3’ untranslated regions of pestivirus genome: primary and secondary structure analysis. Nucleic Acids Res. 21, 1949- 1957.

55

Depner, K., Paton, D.J., Cruciere, C., de Mia, G.M., Miiller, A., Koenen, F., Stark, R. and Liess, B. (1995) Evaluation of the enzyme-linked immunosorbent assay for the rapid screening and detection of classical swine fever virus antigens in the blood of pigs, Rev. Sci. Technol. Off. Int. Epiz. 14, 6777689. Edwards. S. (1990) The diagnosis of bovine virus diarrhoea mucosal disease in cattle. Rev. Sci. Technol. Off. Int. Epiz. 9, 115-130. Edwards, S., Moennig, V. and Wensvoort, G. (1991) The development of an international reference panel of monoclonal antibodies for the differentiation of hog cholera virus from other pestiviruses. Vet. Microbial. 29, 101~ 108. Entrican, Cl., Dand, A. and Nettleton, P.F. (1995) A double monoclonal antibody ELISA for detecting pestivirus antigen in the blood of viraemic cattle and sheep. Vet. Microbiol. 43, 65514. Frey, H.-R., Depner, K.R., Gelfert, CC. and Liess. B. (1991) BVD virus isolation techniques for routine use in cattle herds with or without previous BVD history. Arch. Virol. Suppl. 3, 257-260. Frey, H.-R., Roder, B., Depner, K. and Liess, B. (1995) Epidemiologische Charakterisierung eines Pestivirus-Isolates von einem virimischen Schwein in einem gemischten Schweine-Rinderbestand. D. Tierarztl. Woch. 102, 179218. Hamel, A.L., Wasylyshen, M.D. and Nayar, G.S. (1995) Rapid detection of bovine viral diarrhea virus by using RNA extracted directly from assorted specimens and a one-tube reverse transcription PCR assay. J. Clin. Microbiol. 33, 287-291. Harasawa, R. and Tomiyama, T. (1994) Evidence of pestivirus RNA in human vaccines. J. Clin. Microbial. 32, 16041605. Hofmann, M.A., Brechtbiihl, K. and Stauber, N. (1994) Rapid characterization of new pestivirus strains by direct sequencing of PCR-amplified cDNA from the 5’ noncoding region. Arch. Viral. 139, 2177229. Horner, G.W., Tham, K.-M., Orr, D., Ralston, J.. Rowe, S. and Houghton, T. (1995) Comparison of an antigen capture enzyme-linked assay with reverse transcription - polymerase chain reaction and cell culture immunoperoxidase tests for the diagnosis of ruminant pestivirus infections. Vet. Microbial. 43, 75584. Juntti, N., Larsson, B. and Fossum, C. (1987) The use of monoclonal antibodies in enzyme linked immunosorbent assays for detection of antibodies to bovine viral diarrhoea virus. J. Vet. Med. B. 34, 3566363. Kato. N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T. and Shimotohno, K. (1990) Molecular cloning of the human hepatitis C genome from Japanese patients with non-A, non-B hepatitis. Proc. Nat]. Acad. Sci. USA. 87. 952449528. Katz, J.B., Ridpath, J. and Bolin, S.R. (1993) Presumptive diagnostic differentiation of hog cholera virus from bovine viral diarrhea and border disease viruses by using a cDNA nested-amplification approach. J. Clin. Microbial. 3 I, 565568.

Le. S.-Y., Sonenberg, N. and Maize], J.V. jr. (1995) Unusual folding regions and ribosome landing pad within hepatitis C virus and pestivirus RNAs. Gene 154, 137-143. Lowings, J.P. and Paton, D.J. (1993) Amino acid sequence 01 the border disease virus (Moredun strain) major glycoprotein. In: S. Edwards (Ed.), Proceedings of the Second Symposium on Pestiviruses, Annecy l-3 Ott 1992. Fondation Marcel Mkrieux. Lyon, pp 65- 67. Louings, J.P.. Paton. D.J., Sands. J.J., De Mia, G.M. and Rutili, D. (1994) Classical swine fever: genetic detection and analysis of differences between virus isolates. J. Gen. Viral. 75. 3461 -3468. Lowings. P., Ibata. G., Needham, J. and Paton D. (1996) Classical swine fever diversity and evolution. J. Gen. Viral. 77, 1311~1321. Lcrken, T., Krogsrud. J. and Bjerkis. I. (1991) Outbreaks of border disease in goats induced by a pestivirus-contaminated orf vaccine, with virus transmission to sheep and cattle. J. Comp. Path. 104, 195-209. Manzin, A.. Bagnarelli, P., Menzo. S., Giostra, F.. Brugia, M.. Francesconi. R.. Bianchi, F. B., Clementi, M. (1994) Quantitation of hepatitis C genome molecules in plasma samples. J. Clin. Microbial. 32. 1939-1944. Meyers, G., Riimenapf, T. and Thiel. H.J. (1989) Molecular cloning and nucleotide sequence of the genome of hog cholera virus. Virology 171. 555 567. Moormann. R.J.M., Warmerdam. P.A.M., van der Meer, B.. Schaaper. W.M.. Wensvoort. G. and Hulst. M.M. (1990) Molecular cloning and nucleotidc sequence of hog cholera virus strain Brescia and mapping of the genomic region encoding envelope protein El. Virology 177. I& 198. Paton. D.J. (1995) Pestivirus diversity. J. Comp. Pdthol. 112. 215 236. Paton. D.J., Carlsson, U.. Lowings. J.P.. Sands, J.J., Viii-ek. S. and Alenius. S. (I 995) Identification of herd-specific bovine viral diarrhoea virus isolates from infected cattle and sheep. Vet. Microbial. 43, 283-294. Paton. D.J., Sands, J.J. and Edwards. S. (1994) Border disease virus: delineation by monoclonal antibodies. Arch. Viral. 135, 241 252. Paton. D.J., Simpson. V. and Done. S.H. (1992) Infections of pigs and cattle with bovine viral diarrhoea virus on a farm in England. Vet. Rec. 131. I85 188. Pellerin. C., van den Hurk. J., Lecomte. J. and Tijssen. P. (1994) Identification of a IICW group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203, 260-268. Pikaart. M.J. and Villeponteau, B. (1993) Suppression of PCR amplification by high levels of RNA. BioTechniques 14. 24 25. Radwan, G.S.. Brock, K.V., Hogan. J.S. and Smith. K.L. (1995) Development of a PCR amplification assay as a screening tes( using bulk milk samples for identifying dairy herds infected with bovine viral diarrhea virus. Vet. Microbiol. 44, 77-92. Renard. A., Dina, D., Martial, J. (1987)Vaccines and diagnostics derived from bovine diarrhea virus. Eur. Pdtent application no. 86870095.6. publication no. 0208672.

Ridpath, J.F.. Bolin, S.R. and Katz, J. (1993) Comparison of nucleic acid hybridization and nucleic acid amplification using conserved sequences from the 5’ noncoding region for detection of bovine viral diarrhea virus. J. Clin. Microbiol. 31. 986-989. Roehe, P.M., Woodward, M.J. and Edwards, S. (1992) Characterization of p20 gene sequences from a border diseaselike pestivirus isolated from pigs. Vet. Microbial. 33, 231-238. Sandvik. 0. and NESS, B. (1994) Animal Health Standards in Norway: A Historical Perspective and Assessment of the Existing Situation. The Royal Ministry of Agriculture, Norway, pp. 45-46. Schmitt. B.J., Lopez. O.J., Ridpath, J.F., Galeota-Wheeler, J. and Osorio, F.A. (1994) Evaluation of PCR for diagnosis of bovine viral diarrhea virus in tissue homogenates. J. Vet, Diagn. Invest. 6, 44 47. Stallcup. M.R. and Washington. L.D. (1983) Region-specific initiation of mouse mammary tumor virus RNA synthesis b) cndogenous RNA polymerase II in preparations of cell nuclei. J. Biol. Chem. 258. 2802-2807. Sullivan, D.G. and Akkina, R.K. (1995) A nested polymerase chain reaction assay to differentiate pestiviruses. Virus Res. 38. 23 I m-239. Tajima, M.. Kirisawa, R., Taguchi. M., Iwai. H., Kawakami. Y., Hagiwara. K.. Ohtsuka, H., Sentsui. H. and Takahashi. K. (1995) Attempt to discriminate between bovine viral-diarrhoea virus strains using polymerase chain reaction. J. Vet. Med. B. 42, 257 265. Terpstra, C. (1991) Hog cholera: an update of present knowledge. Br. Vet. J. 147. 397-406. Tcrpstra. C. and Wensvoort, G. (1988) Natural infections of pigs with bovine viral diarrhoea virus associated with signs resembling swine fever. Res. Vet. Sci. 45. I37 -142. Van Oirschot. J.T. (1988) Description of the virus infection. In: B. Liess (Ed.), Classical swine fever and related viral infections. Martinus Nijhoff, Boston. pp. I 25. Vilcek, S., Herring, A.J., Herring. J.A., Nettlcton. P.F.. Lowings, J.P. and Paton, D.J. (1994) Pesliviruses isolated from pigs? caltIc and sheep can be allocated into at least three genogroups using polymerase chain reaction and restriction endonuclease analysis. Arch. Virol. 136, 309 323. Waxweiler, S.. Mignon, B., Boulanger, D., Greimcrs. R.. Defresne, M.P., Boniver, J., Karelle Bui-Thi. L. and Pastoret. P.P. ( 1991) Variations de I’antiginiimie dans I’infection persistante des bovins par le virus de la diarrhec viralc bovine (BVD). Ann. M&d. VCt. 135, 559 565. Wensvoort. G.. Bloemraad, M. and Terpstra, C. (1988) An enzyme immunoassay employing monoclonal antibodies and detecting specifically antibodies to classical swine fever Lirus. Vet. Microbial. 17. l29- 140. Wensvoort. G. and Terpstrd. C. (1988) Bovine viral diarrhoea infections in piglets born to sows vaccinated against swine fever with contaminated vaccine. Res. Vet. Sci. 45, l43148. Wirz. B., Tratschin. J.-D.. Miiller, H.K. and Mitchell, D.B. (1993) Detection of hog cholera virus and differentiation of other pcstiviruses by polymerase chain reaction. J. Clin. Microbial. 31. I I48 1154.