- Email: [email protected]
Detection and mechanism of action of ESM-1 in rat kidney transplantation under various immune states
Cellular Immunology 283 (2013) 31–37
Contents lists available at SciVerse ScienceDirect
Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm
Detection and mechanism of action of ESM-1 in rat kidney transplantation under various immune states Shadan Li a,⇑,1, Ping Liang a,1, Youguang Zhao a,1, Xiaowei Li a, Yu Hu b, Wei Wu c, Yan Li d, Peng Zhou a, Qiwu Wang a, Wei Yang a, Liang Wang a,⇑, Qingtang Wang a, Hang Yang a, Weiguo Cheng a, Wenfeng Chao a, Binghong Zhang a, Fengshuo Jin e a
Department of Urology, The General Hospital of Chengdu Military Region, Chengdu, China Department of Anesthesiology, The 452nd Hospital of Chengdu Military Region, Chengdu, China Department of Anesthesiology, The General Hospital of Chengdu Military Region, Chengdu, China d Department of Stomatology, The General Hospital of Chengdu Military Region, Chengdu, China e Department of Urology, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University of Chinese PLA, Chongqing, China b c
a r t i c l e
i n f o
Article history: Received 27 March 2013 Accepted 8 May 2013 Available online 4 June 2013 Keywords: Kidney transplantation ESM-1 Rejection Rat
a b s t r a c t Objective: To investigate whether ESM-1 expression change reflects the impairment of endothelial cells and rejection after kidney transplantation, ESM-1 expression was detected under various immune states in this study. Methods: Kidney transplantations were performed from BN to LEW rats. Syngenic LEW-LEW grafts were used as controls. The LEW recipient rats were divided into acute rejection (AR) group, ciclosporin A (CsA) group and control group. In each group, 10 rats were sacrificed at 1, 5, and 7 d after operation, respectively, and blood and kidney samples were collected. In the rat model of kidney transplantation, ESM1 mRNA and ESM-1 protein expression were detected in various immune states to verify if ESM-1 can reflect endothelial cell impairment sensitively. Results: ESM-1 mRNA (1 d vs. 3 d, P < 0.01;3 d vs. 7 d, P = 0.018) and ESM-1 protein expression was upregulated significantly in the AR group (P < 0.01, 5 and 7 d), when compared to CsA group and control group. In CsA group, the cell apoptosis rate decreased when compared to AR group (P < 0.01). Pathological impairment was more serious in AR group than in CsA group (P < 0.01). Conclusions: Peripheral blood ESM-1 mRNA and ESM-1 protein expression in kidney grafts can reflect the severity of endothelial cell impairment. Thus, ESM-1 may be used as a new indicator for AR prediction and diagnosis. Nevertheless, further investigation is required to test if it meets the criteria for clinical utility. Ó 2013 Elsevier Inc. All rights reserved.
1. Introduction Rejection is one of the major factors influencing graft survival. Vascular endothelial cells are an important barrier between the blood and tissues, which is the place where the donor’s cells first contact the receipt’s cells and are first recognized by the receipt’s immune system. Hence, endothelial cells have unique biologic functions in rejections. Immune reaction between the receipt’s leukocytes and endothelial cells of kidney graft may lead to endothelial cell injury and desquamation of kidney graft, and endothelial ⇑ Corresponding authors. Address: Department of Urology, The General Hospital of Chengdu Military Region, 270# Rongdu Road, Chengdu 610083, China. Fax: +86 028 80570366. E-mail addresses: [email protected] (SD. Li), [email protected] (L. Wang). 1 These authors contributed equally to this work. 0008-8749/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellimm.2013.05.003
cells enter the receipt’s blood circulation and become CECs. CECs have been used as a surrogate marker of endothelial damage in a variety of vascular disorders including renal disease and may reflect vascular rejection [1,2]. ESM-1 is a common, characteristic molecule of vascular tissues such as capillary, arteriole, and venule, and it is expressed by endothelial cells in multiple normal tissues [3,4]. It has been reported that ESM-1 is highly restricted to endothelial cells, and it may contribute to the functions of endothelial cells and play a role in endothelial cell dependent pathologic processes [5,6]. Therefore, ESM-1 may serve as a new marker for endothelial cell activation [5,6]. However, its significance during acute rejection in renal transplantation is still unclear. In order to elucidate the alterations and mechanism of action of ESM-1 in kidney transplantation, we adopted a randomized, controlled design to detect ESM-1 expression in rat kidney transplantation models under various immune
32
S. Li et al. / Cellular Immunology 283 (2013) 31–37
states and investigate the usefulness of ESM-1 monitoring in acute rejection following kidney transplantation. 2. Materials and methods 2.1. Animals Specific, pathogen-free, inbred BN and LEW rats weighing 250– 300 g were used for transplantations. Thirty BN rats (with 60 renal allografts) and nine LEW (with 18 renal allografts) rats were selected as donors, not specific to genders; 78 male LEW rats were made as recipients, all rats were purchased from Beijing Vital River Laboratories (license no.: SCXK-(J)). They received regular rat food and tap water ad libitum, and were maintained on a 12-h light/ dark cycle. The treatment method to the animal conformed to the requirement of animal ethics. The LEW recipient rats were divided into three groups, with 30 rats in acute rejection group (AR group), 30 rats in ciclosporin A group (CsA group) and 18 rats in control group. The rats of the AR Group were not given antirejection treatment after operation. Those of the CsA group were administered with ciclosporin A(CsA, Sandimmun, Switzerland) afteroperation, gastric perfusion, 5 mg/kg/d. Syngenic LEW-LEW grafts were used as controls. 2.2. Establishment of animal model In our previously research, the establishment of the model of harvesting two renal allografts from one donor was established [7,8]. An end-to-end anastomosis of the donor and recipient renal veins to the recipient vena cava was performed using an epidural catheter as an stent. End-to-side anastomoses of the donor renal arteries were performed to the recipient abdominal aorta. The donor muscle flap containing ureteral and bladder was connected to the recipient’s bladder. Three days after the operation, the right renal vessels of the recipient were ligated by way of extracorporeal ligature. Ten rats of AR group and CsA group were sacrificed at the first, fifth and seventh day after operation respectively for kidney specimen collection. Blood samples of 0.5 mL were taken at the same time to examine the serum creatinine, the expression of ESM-1 mRNA and protein. Six rats of control group were sacrificed at every time point. 2.3. Apoptosis assays of transplanted kidney (In situ end labeling) Transplanted kidney tissue was collected on the 7th day after the operation. Apoptosis in renal allograft tissues was detected by means of TdT-Medicated dUTP nick end labeling (TUNEL). Samples were observed with photos taken under a light microscope (400) after the operation according to technical notes. The cell with karyon stained brown was dead. Ten non-overlapping fields of vision were selected for each slice, and 100 renal tubular epithelial cells were continuously counted under each field. The proportion of apoptotic cells should be the apoptotic index. 2.4. Histopathology examination Histopathological analysis was done in a blind review. The kidney grafts were bisected horizontally and fixed in 4% paraformaldehyde. The specimens were cut into 2-lmthick sections and stained with Mayer’s haematoxylin–eosin (HE). Acute rejection diagnosis with reference to the Banff 97 working classification [9], semiquantitative evaluation of severity level of acute rejection with reference to the method adopted by Watanabe et al. [10]. Semi-quantitative score and Banff 97 in acute rejection correspon-
dence, that is: 0 = normal, 1 = borderline change, 2 = IA, 3 = IB, 4 = IIA, 5 = IIB, 6 = III. 2.5. Real-time PCR analysis of rat ESM-1 mRNA Peripheral blood sampling: 3–4 ml of venous blood was drawn from the heart on days 1, 5, 7 after transplantation in each group. Within 24 h after blood sampling, monocyte suspension was prepared, followed by total RNA extraction, RNA identification, reverse transcription of cDNA and real-time PCR amplification. The accession number and mRNA sequence of rat ESM-1 were retrieved from the NCBI(NM_007036). The primers were designed by TAKARA with reference to the literature and synthesized by Shanghai Sangon Co., Ltd. The mRNA analysis was performed using Bio-Rad fluorescence PCR cycler and Bio-Rad Opticon monitor 3 software. The primers used for ESM-1 real-time RT-PCR were: 50 ACTTCCCCTTCTTCCAGTATGC–30 (sense),50 -CGGTCTCCAATCTCTTCT CTCAC–30 (antisense). GAPDH served as internal control, and the relative quantity of ESM-1 mRNA was expressed in the ratio of ESM-1/GAPDH. 2.6. Detection of ESM-1 protein in serum(ELISA assay) ESM-1 EIA kits were obtained (DIYEK EndoMark R1 (ELISA kit to detect rat endocan), Lunginnov S.A.S Inc., France) and serum ESM-1 was detected according to the manufacturer’s instructions. The absorbance was measured at 450 nm on a spectrophotometer. 2.7. Immunofluorescence detection of ESM-1 protein Rat kidney graft tissue specimens were obtained on days 1, 5, 7 after transplantation, and were stored in liquid nitrogen. Immunofluorescence assay was performed routinely with the use of primary antibody against ESM-1 (Anti-ESM-1, clone CSLEX1, Santa Cruz) and FITC-labeled rabbit anti-murine secondary antibody. Five glomeruli were sampled randomly from each specimen of each group in high-power field using Image-pro plus 5.0 software (Media Cybernetics, USA), and mean fluorescence intensity (MFI) of glomeruli for each specimen was used to express the relative quantity of ESM-1 protein. 2.8. Western blotting detection of ESM-1 protein Kidney samples (100 mg) were homogenized on day 7 after transplantation by a hand-held homogenizer in ice-cold tissue protein extraction buffer (Pierce, Rockford, IL, USA) with 1 mM EDTA and 1:100 protease inhibitor (Sigma, St. Louis, MO, USA). The contents were transferred to QIA shredder (Qiagen, Valencia, CA, USA). Fifty microgram of protein from kidney samples was mixed with 1 LDS buffer and reducing agent (both Invitrogen, Carlsbad, CA, USA) and heated at 65 °C for 5 min. The mixture was then subjected to SDS–PAGE. Following electrophoretic separation, the protein was transferred to a nitrocellulose membrane and probed with an antibody specific for ESM-1 or actin (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by an HRP-conjugated secondary antibody. The protein levels were compared by the ratio of measured protein band density and reference protein (actin) band density. 2.9. Statistical analysis Statistical analysis was performed using SPSS 13.0 software (SPSS, Chicago, IL, USA). The results are expressed as mean ± SE, and P < 0.05 was accepted as significant. The significance between groups was determined with single factor variance analysis and
33
S. Li et al. / Cellular Immunology 283 (2013) 31–37
Statistics-Bonferroni correction was used in multiple comparison tests. 2.10. Main outcome measures Pathological changes of transplanted kidney after the transplant, protein content of ESM-1, expression of ESM-1 mRNA, protein, and serum creatinine level in each group. 3. Result
3.2. Function of the transplanted kidney, see Fig. 1A Urine formation was started for all transplanted kidneys 3–5 min after blood flow was reestablished. On the fifth and seventh day afteroperation, serum creatinine level of the AR group was higher than those of the CsA group and the control group (P < 0.01). And the serum levels of creatinine were higher in the CsA group than those in the control group on the fifth day postoperation (P < 0.01). 3.3. Results of apoptosis assays in renal allograft, see Fig. 1
3.1. Quantitative analysis of animals Cold ischemia time for all organs was 0.5 ± 0.8 h. Warm ischemia time was 24.6 ± 5.2 min. There were no differences in cold or warm ischemia times among the treatment groups. Four rats died during and after operation; two rats of the acute rejection (AR) group died of anesthesia accident and hemorrhagic shock; one rat of the CsA group died of abdominal infection; and one rat in the CsA group died of anastomotic thrombus. The success rate of the operation was 92.5%. Two recipient rats died during sample collection, and the main cause was anesthesia accident. Additional operations were carried out for another two rats.
A
The positive rate of apoptotic cells in the AR group [(28.49 ± 5.41)%] was higher than those of the CsA group [(3.14 ± 1.47)%] and the control group [(2.03 ± 0.71)%] (P < 0.01), and There were no differences between the CsA group and the control group (P > 0.05). 3.4. For histopathological changes, see Figs. 1C and 2. Significant difference existed for paired evaluation within groups on the first, fifth and seventh day after transplantation (P < 0.01). The scores of the AR group on the fifth and seventh day were higher than
B
D
C
E
G
F
H
I
Fig. 1. (A) Function of the transplanted kidney, ⁄P < 0.01 vs. CsA group and control group, N P < 0.05 vs. control group; (B) Apoptosis in renal allograft tissues (TUNEL) (the positive rate of apoptic cells, %), ⁄P < 0.01 vs. CsA group and control group; (C) Results of histopathological changes in renal allograft, ⁄P < 0.01 vs. CsA group and control group; (D) ESM-1 mRNA expression in rat peripheral blood, ⁄P < 0.01 vs. CsA group and control group,N P < 0.05 vs. 1d; (E) ESM-1 protein expression in peripheral blood(ELISA assay), ⁄ P < 0.01 vs. CsA group and control group, N P < 0.05 vs. 1d; (F) Immunofluorescence detection results of ESM-1 protein,⁄P < 0.01 vs. CsA group and control group, N P < 0.05 vs. 1d; (G) Western blotting results of ESM-1 protein (ESM-1/b-actin). ⁄P < 0.01 vs. CsA group and control group. (H) The expression of ESM-1 protein in the rat kidney after transplantation, indicated by Western-blot examination on the 7th day after operation. (I) ROC curves of AR rats versus other subjects.
34
S. Li et al. / Cellular Immunology 283 (2013) 31–37
A
B
C
D
E
F
G
H
I
Fig. 2. (A) With patchy interstitial hemorrhage and necrosis in the kidney graft for the AR group (HE,10); (B and C) with hemorrhage and thrombus formation in the glomeruli in the kidney graft for the AR group. renal tubular epithelial cell vacuolation, luminal distension, exfoliation of some renal tubular epithelial cells, focal inflammatory cell infiltration (HE,40); (D and E) with severe infiltrate of inflammatory cells in glomerulus, interstitium, and vascular wall for the AR group (HE,40); (F) characterized by intimal thickening and necrosis of arterioles in the AR group (HE,40); (G) renal interstitium of the CsA group (HE,40); (H) vascular wall of renal tissue in the CsA group (HE,40); (I) infiltrate of inflammatory cells not obvious in glomerulus, interstitium, and vascular wall for normal rats (HE,40).
those on the first day respectively (P < 0.01), with the seventh day higher than that of the fifth day in AR group (P < 0.01). On the first day after operation, the structure and shape of glomerulus and renal tubule were basically normal in all groups; in the AR group, a few scattered interstitial lymphocytic infiltrates appeared in six rats. No abnormity was observed for the interstitium in the CsA group and control group. Pathological examination was carried out afterwards, which indicated a mild quantity increase of mononuclear cell infiltrates in some samples, without significantly extended scope. On the fifth day in the AR group, mononuclear cells were observed to infiltrate into renal tubule, caused tubulitis. And the capillary and glomerulus were affected in some samples. On the seventh day, mononuclear cell were observed to infiltrate into capillary for most renal allograft, which led to endarteritis and interstitial hemorrhagic necrosis. See Fig. 2. 3.5. ESM-1 mRNA expression in rat peripheral blood, refer to Fig. 1,D Real-time PCR results indicated ESM-1 mRNA expression upregulation in all the three groups afteroperation, and significant upregulation in ESM-1 mRNA expression in AR group on days 5(P = 1.23E05) and 7 (P = 4.20E15) when compared with CsA group. The results were higher on the 5th day than that on the first
day after surgery in the CsA group (P = 1.04E10) and the Control group (P = 1.18E05) respectively. However, ESM-1 mRNA expression was not significantly higher in CSA group than control group (P > 0.05). 3.6. Serum expression of ESM-1 protein, refer to Fig. 1E The ESM-1 concentration in serum was then measured by ESM1 ELISA kit according to the manufacturer’s instructions. The analyzed, summarized results are shown in Fig. 1,E. Serum ESM-1 concentrations were significantly elevated in AR group as when compared to CsA group(day 5, P = 8.37E09; day 7,P = 1.42E12) and control group(day 5, P = 6.89E-10; day 7, P = 2.68E-13). The results were higher on the 5th day than that on the first day after surgery in the CsA group (p = 0.019) and the Control group (p = 0.036) respectively. These results are verified by the dynamic changes of mRNA expression of ESM-1 in peripheral blood. 3.7. Immunofluorescence detection results of ESM-1 protein, refer to Figs. 1E and 3 Localization of ESM-1 expression in kidney by confocal microscope. Subcellular localization of ESM-1 in kidney was detected
35
S. Li et al. / Cellular Immunology 283 (2013) 31–37
ESM-1 FITC
DAPI
Merge
AR group Bars=100
A
B
m
C
AR group Bars=100
D
E
m
F
CsA group Bars=500
G
H
m
I
CsA group Bars=100
J
K
m
L
Control group Bars=100
M
O
m
P
Control group Bars=100
Q
R
m
S
Fig. 3. The expression of ESM-1 protein in the rat kidney after transplantation, indicated by immunofluorescence examination on the 7th day after operation. Localization of ESM-1 expression in kidney by confocal microscope. Subcellular localization of ESM-1 in kidney was detected with FITC-conjugated secondary antibodies to capture ESM-1. Nuclei were counterstained by DAPI (Invitrogen). (A–F): ESM-1 protein expression upregulation in glomeruli in the presence of acute rejection (Bars = 100 lm); (G–L): Moderate upregulation express of ESM-1 protein in CsA group (G–I, Bars = 500 lm; J-L, Bars = 100 lm); M-S: ESM-1 protein expression was weak in normal kidneys (Bars = 100 lm).
36
S. Li et al. / Cellular Immunology 283 (2013) 31–37
with FITC-conjugated secondary antibodies to capture ESM-1. Nuclei were counterstained by DAPI (Invitrogen).ESM-1 protein expression was weak in normal kidneys. See Fig. 3 M-S. Image analysis revealed ESM-1 protein expression upregulation in glomeruli in all the three groups afteroperation, particularly, in the presence of acute rejection. MFI increased significantly in AR groups when compared to CsA group (day 5, P = 1.54E-13; day 7, P = 1.17E-17) and control group(day 5, P = 2.28E-14; day 7, P = 4.79E-18). The results were higher on the 5th day than that on the first day after surgery in the CsA group (P = 0.012) and the Control group (P = 0.011) respectively. However, ESM-1 mRNA expression was not significantly higher in CSA group than in control group (P > 0.05). See Fig. 1E. 3.8. Western blotting results of ESM-1 protein, refer to Fig. 1,G,H ESM-1 protein expression was upregulated significantly in AR groups (0.49 ± 0.06) when compared to CsA group (0.24 ± 0.05) (P = 1.26E-09) and control group (0.20 ± 0.04) (P = 4.88E-10) on days 7. ESM-1 protein expression was not significantly higher in CSA group than in control group (P = 0.209). ROC curve of ESM-1 sensitivity in AR diagnosis, refer to Fig. 1I. We next analyzed the receiver operator characteristics (ROC) of the expression of ESM-1 mRNA. In order to distinguish between AR and other samples, we used an ESM-1 cutoff value of 6.41. The specificity of ESM-1 was 100% and sensitivity was 93.8% at the cutoff value. For ESM-1, the area under the curve was 0.991 (Fig. 1,I). We analyzed the specificity and sensitivity of ESM-1 in AR group. The specificity of ESM-1 was 91% and sensitivity was 95%. We performed Pearson correlation analysis for pathohistological scores of renal grafts, peripheral blood ESM-1 mRNA, ESM-1 protein, and the relative content of ESM-1 protein in the kidney (IF) in the AR group. The results were (P = 0.046, r = 0.997), (P = 0.049, r = 0.988), and (P = 0.038, r = 0.993), respectively. It was suggested that in the AR group, ESM-1 expression correlated positively to the severity of rejection. 4. Discussion AR is classified into ACR (acute cellular rejection) and AVR (acute vascular rejection) according to pathological findings [11]. AR of rat kidney graft in this study involves both ACR and AVR, according to the Banff97 criteria [9]. This was similar with the findings by Savikko et al. [12]. Pathologic changes were significantly worse in AR group than CsA group and control group on days 5 and 7. In addition, Pathologic scores increased in CsA group and control group, but they did not change significantly on days 5 and 7(P > 0.05). ESM-1 is a 50 kDa soluble proteoglycan, which is expressed by the vascular endothelium and freely circulates in the bloodstream [13]. And it is a key player in the regulation of cell adhesion, inflammatory disorders, and tumor progression [14–16]. Recent data have suggested that ESM-1 is known to be a diagnostic marker for sepsis [17]. What‘s more, it has been identified as a potential novel endothelial cell marker and a new target for cancer therapy because of its high specificity to endothelial cells [18–25]. Vascular endothelium is the place where the donor’s cells first contact the receipt’s cells and are first recognized by the receipt’s immune system. During the acute rejection, immune reaction between the receipt’s leukocytes and endothelial cells of kidney graft may lead to endothelial cell injury and desquamation. The relationship between EC and AR has become a focus of research recently. There have been few clinical research reports on ESM-1, and the role of ESM-1 in graft rejection remains unclear. It was reported that ESM-1 can dose-dependently suppress the
specific binding of soluble ICAM-1 to lymphocytes, thus inhibiting lymphocyte adhesion and /or activation through the LFA-1 pathway [16]. Thus, it has perhaps immunomodulatory function after transplantation and does not only reflect vascular endothelium damage and inflammation in acute rejection. In a rat model for inflammation, increased ESM-1 levels in the circulating blood suppressed the adhesion of lymphocytes to endothelium [26]. In this study, ESM-1 mRNA and protein expression in peripheral blood and ESM-1 protein expression in kidney graft tissues were detected, and it was found that ESM-1 expression increased significantly in the AR group than in control rats and rats treated with CsA. Otherwise, the result of ESM-1 expression was also upregulated to a certain degree in the CsA group and control group on the day 5 afteroperation, which indicates that the up-regulated expression of ESM-1 is also associated with regenerative processes after vascular injury. But the degree of upregulation in the CsA group and control group is not significant than in the AR group. 5. Conclusion These findings support that ESM-1 may reflect the degree of endothelial cell injury and immune states after kidney transplantation. Therefore, ESM-1 may serve as a new predictive marker for acute rejection. Nevertheless, further investigation is required to test if it meets the criteria for clinical utility. Acknowledgements Supported by the grant from the General Hospital of Chengdu Military Region (No: 2011YG-04), the grant from the 12th Five Year Program of Chengdu Military Region of China (No: C12033) and the General Hospital of Chengdu Military Region (No: 2013YG-B022). References [1] A. Woywodt, T. Kirsch, M. Haubitz, Circulating endothelial cells in renal disease: markers and mediators of vascular damage, Nephrol. Dial. Transplant. 23 (2008) 7–10. [2] U. Erdbruegger, M. Haubitz, A. Woywodt, Circulating endothelial cells: a novel marker of endothelial damage, Clin. Chim. Acta 373 (2006) 17–26. [3] J.C. Tsai, J. Zhang, T. Minami, C. Voland, S. Zhao, X. Yi, et al., Cloning and characterization of the human lung endothelial-cell-specific molecule-1 promoter, J. Vasc. Res. 39 (2002) 148–159. [4] M. Aitkenhead, WSJ, Nakatsu MN MJ, Heard C HCC. Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM, Microvasc. Res. 63 (2002) 159–171. [5] D. Bechard, V. Meignin, A. Scherpereel, S. Oudin, G. Kervoaze, P. Bertheau, et al., Characterization of the secreted form of endothelial-cell-specific molecule 1 by specific monoclonal antibodies, J. Vasc. Res. 37 (2000) 417–425. [6] P. Lassalle, S. Molet, A. Janin, J.V. Heyden, J. Tavernier, W. Fiers, R. Devos, A.B. Tonnel, ESM-1 is a novel human endothelial cellspecific molecule expressed in lung and regulated by cytokines, J. Biol. Chem. 271 (1996) 20458–20464. [7] Li SD JFS, Li QS. Establishment of a rat model of bilateral renal allograft. J. Clin. Rehabil. Tissue Eng. Res. 2008; 12: 853–6. [8] L.W. Shadan Li, Kuiying Wea, Oxygenase-1 expression and its significance for acute rejection following kidney transplantation in rats, Transplant Proc. 43 (2011) 1980–1984. [9] L.C. Racusen, K. Solez, R.B. Colvin, S.M. Bonsib, M.C. Castro, T. Cavallo, et al., The Banff 97 working classification of renal allograft pathology, Kidney Int. 55 (1999) 713–723. [10] Y. Watanabe, R. Yoshimura, S. Wada, J. Chargui, J. Suzuki, T. Kishimoto, et al., Expression of nonmuscle myosin heavy chain B (SMemb) in rat allogeneic kidney transplantation, Nephron 91 (2002) 316–323. [11] C. Jianghua, X. Wenqing, W. Huiping, J. Juan, W. Jianyong, H. Qiang, C4d as a significant predictor for humoral rejection in renal allografts, Clin. Transplant. 19 (2005) 785–791. [12] J.E.E.V. Savikko, Early induction of platelet-derived growth factor ligands and receptors in acuter rat renal allograft rejection, Transplantation 72 (2001) 31– 37. [13] S. Sarrazin, E. Adam, M. Lyon, F. Depontieu, V. Motte, C. Landolfi, H. LortatJacob, D. Bechard, P. Lassalle, M. Delehedde, Endocan or endothelial cell specific molecule-1 (ESM-1): a potential novel endothelial cell marker and a new target for cancer therapy, Biochim. Biophys. Acta 1765 (2006) 25–37. [14] D. Bechard, T. Gentina, M. Delehedde, A. Scherpereel, M. Lyon, M. Aumercier, et al., Endocan is a novel chondroitin sulfate/dermatan sulfate proteoglycan
S. Li et al. / Cellular Immunology 283 (2013) 31–37
[15]
[16]
[17] [18]
[19]
[20]
that promotes hepatocyte growth factor/scatter factor mitogenic activity, J. Biol. Chem. 276 (2001) 48341–48349. M. Murakami, A. Horowitz, S. Tang, J.A. Ware, M. Simons, Protein kinase C (PKC) delta regulates PKCalpha activity in a syndecan-4-dependent manner, J. Biol. Chem. 277 (2002) 20367–20371. D. Bechard, A. Scherpereel, H. Hammad, T. Gentina, A. Tsicopoulos, M. Aumercier, et al., Human endothelial-cell specific molecule-1 binds directly to the integrin CD11a/CD18 (LFA-1) and blocks binding to intercellular adhesion molecule-1, J. Immunol. 167 (2001) 3099–3106. J.G. Filep, Endocan or endothelial cell-specific molecule-1: a novel prognostic marker of sepsis, Crit. Care Med. 34 (2006) 574–575. B.D. Grigoriu, F. Depontieu, A. Scherpereel, D. Gourcerol, P. Devos, T. Ouatas, et al., Endocan expression and relationship with survival in human non-small cell lung cancer, Clin. Cancer Res. 12 (2006) 4575–4582. N.Y. Ji, Y.H. Kim, Y.J. Jang, Y.H. Kang, C.I. Lee, J.W. Kim, et al., Identification of endothelial cell-specific molecule-1 as a potential serum marker for colorectal cancer, Cancer Sci. 101 (2010) 2248–2253. X. Leroy, L. Zini, H. Franquet, G. Kervoaze, A. Villers, M. Delehedde, M.C. Copin, P. Lassalle, Vascular endocan (ESM-1) is markedly overexpressed in clear cell renal cell carcinoma, Histopathology 56 (2010) 180–187.
37
[21] N. Liu, L.H. Zhang, H. Du, Y. Hu, G.G. Zhang, X.H. Wang, et al., Overexpression of endothelial cell specific molecule-1 (ESM-1) in gastric cancer, Ann. Surg. Oncol. 17 (2010) 2628–2639. [22] A. Scherpereel, T. Gentina, B. Grigoriu, S. Senechal, A. Janin, A. Tsicopoulos, et al., Overexpression of endocan induces tumor formation, Cancer Res. 63 (2003) 6084–6089. [23] S. Amatschek, U. Koenig, H. Auer, P. Steinlein, M. Pacher, A. Gruenfelder, et al., Tissue-wide expression profiling using cDNA subtraction and microarrays to identify tumor-specific genes, Cancer Res. 64 (2004) 844–856. [24] L.J. van ‘Veer, H. Dai, M.J. van de Vijver, Y.D. He, A.A. Hart, M. Mao, Gene expression profiling predicts clinical outcome of breast cancer, Nature 415 (2002) 530–536. [25] M.E. Lenburg, L.S. Liou, N.P. Gerry, G.M. Frampton, H.T. Cohen, M.F. Christman, Previously unidentified changes in renal cell carcinoma gene expression identified by parametric analysis of microarray data, BMC Cancer 3 (2003) 31. [26] S. Tissier, S. Lancel, X. Marechal, S. Mordon, F. Depontieu, A. Scherpereel, et al., Calpain inhibitors improve myocardial dysfunction and inflammation induced by endotoxin in rats, Shock 21 (2004) 352–357.
Contents lists available at SciVerse ScienceDirect
Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm
Detection and mechanism of action of ESM-1 in rat kidney transplantation under various immune states Shadan Li a,⇑,1, Ping Liang a,1, Youguang Zhao a,1, Xiaowei Li a, Yu Hu b, Wei Wu c, Yan Li d, Peng Zhou a, Qiwu Wang a, Wei Yang a, Liang Wang a,⇑, Qingtang Wang a, Hang Yang a, Weiguo Cheng a, Wenfeng Chao a, Binghong Zhang a, Fengshuo Jin e a
Department of Urology, The General Hospital of Chengdu Military Region, Chengdu, China Department of Anesthesiology, The 452nd Hospital of Chengdu Military Region, Chengdu, China Department of Anesthesiology, The General Hospital of Chengdu Military Region, Chengdu, China d Department of Stomatology, The General Hospital of Chengdu Military Region, Chengdu, China e Department of Urology, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University of Chinese PLA, Chongqing, China b c
a r t i c l e
i n f o
Article history: Received 27 March 2013 Accepted 8 May 2013 Available online 4 June 2013 Keywords: Kidney transplantation ESM-1 Rejection Rat
a b s t r a c t Objective: To investigate whether ESM-1 expression change reflects the impairment of endothelial cells and rejection after kidney transplantation, ESM-1 expression was detected under various immune states in this study. Methods: Kidney transplantations were performed from BN to LEW rats. Syngenic LEW-LEW grafts were used as controls. The LEW recipient rats were divided into acute rejection (AR) group, ciclosporin A (CsA) group and control group. In each group, 10 rats were sacrificed at 1, 5, and 7 d after operation, respectively, and blood and kidney samples were collected. In the rat model of kidney transplantation, ESM1 mRNA and ESM-1 protein expression were detected in various immune states to verify if ESM-1 can reflect endothelial cell impairment sensitively. Results: ESM-1 mRNA (1 d vs. 3 d, P < 0.01;3 d vs. 7 d, P = 0.018) and ESM-1 protein expression was upregulated significantly in the AR group (P < 0.01, 5 and 7 d), when compared to CsA group and control group. In CsA group, the cell apoptosis rate decreased when compared to AR group (P < 0.01). Pathological impairment was more serious in AR group than in CsA group (P < 0.01). Conclusions: Peripheral blood ESM-1 mRNA and ESM-1 protein expression in kidney grafts can reflect the severity of endothelial cell impairment. Thus, ESM-1 may be used as a new indicator for AR prediction and diagnosis. Nevertheless, further investigation is required to test if it meets the criteria for clinical utility. Ó 2013 Elsevier Inc. All rights reserved.
1. Introduction Rejection is one of the major factors influencing graft survival. Vascular endothelial cells are an important barrier between the blood and tissues, which is the place where the donor’s cells first contact the receipt’s cells and are first recognized by the receipt’s immune system. Hence, endothelial cells have unique biologic functions in rejections. Immune reaction between the receipt’s leukocytes and endothelial cells of kidney graft may lead to endothelial cell injury and desquamation of kidney graft, and endothelial ⇑ Corresponding authors. Address: Department of Urology, The General Hospital of Chengdu Military Region, 270# Rongdu Road, Chengdu 610083, China. Fax: +86 028 80570366. E-mail addresses: [email protected] (SD. Li), [email protected] (L. Wang). 1 These authors contributed equally to this work. 0008-8749/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellimm.2013.05.003
cells enter the receipt’s blood circulation and become CECs. CECs have been used as a surrogate marker of endothelial damage in a variety of vascular disorders including renal disease and may reflect vascular rejection [1,2]. ESM-1 is a common, characteristic molecule of vascular tissues such as capillary, arteriole, and venule, and it is expressed by endothelial cells in multiple normal tissues [3,4]. It has been reported that ESM-1 is highly restricted to endothelial cells, and it may contribute to the functions of endothelial cells and play a role in endothelial cell dependent pathologic processes [5,6]. Therefore, ESM-1 may serve as a new marker for endothelial cell activation [5,6]. However, its significance during acute rejection in renal transplantation is still unclear. In order to elucidate the alterations and mechanism of action of ESM-1 in kidney transplantation, we adopted a randomized, controlled design to detect ESM-1 expression in rat kidney transplantation models under various immune
32
S. Li et al. / Cellular Immunology 283 (2013) 31–37
states and investigate the usefulness of ESM-1 monitoring in acute rejection following kidney transplantation. 2. Materials and methods 2.1. Animals Specific, pathogen-free, inbred BN and LEW rats weighing 250– 300 g were used for transplantations. Thirty BN rats (with 60 renal allografts) and nine LEW (with 18 renal allografts) rats were selected as donors, not specific to genders; 78 male LEW rats were made as recipients, all rats were purchased from Beijing Vital River Laboratories (license no.: SCXK-(J)). They received regular rat food and tap water ad libitum, and were maintained on a 12-h light/ dark cycle. The treatment method to the animal conformed to the requirement of animal ethics. The LEW recipient rats were divided into three groups, with 30 rats in acute rejection group (AR group), 30 rats in ciclosporin A group (CsA group) and 18 rats in control group. The rats of the AR Group were not given antirejection treatment after operation. Those of the CsA group were administered with ciclosporin A(CsA, Sandimmun, Switzerland) afteroperation, gastric perfusion, 5 mg/kg/d. Syngenic LEW-LEW grafts were used as controls. 2.2. Establishment of animal model In our previously research, the establishment of the model of harvesting two renal allografts from one donor was established [7,8]. An end-to-end anastomosis of the donor and recipient renal veins to the recipient vena cava was performed using an epidural catheter as an stent. End-to-side anastomoses of the donor renal arteries were performed to the recipient abdominal aorta. The donor muscle flap containing ureteral and bladder was connected to the recipient’s bladder. Three days after the operation, the right renal vessels of the recipient were ligated by way of extracorporeal ligature. Ten rats of AR group and CsA group were sacrificed at the first, fifth and seventh day after operation respectively for kidney specimen collection. Blood samples of 0.5 mL were taken at the same time to examine the serum creatinine, the expression of ESM-1 mRNA and protein. Six rats of control group were sacrificed at every time point. 2.3. Apoptosis assays of transplanted kidney (In situ end labeling) Transplanted kidney tissue was collected on the 7th day after the operation. Apoptosis in renal allograft tissues was detected by means of TdT-Medicated dUTP nick end labeling (TUNEL). Samples were observed with photos taken under a light microscope (400) after the operation according to technical notes. The cell with karyon stained brown was dead. Ten non-overlapping fields of vision were selected for each slice, and 100 renal tubular epithelial cells were continuously counted under each field. The proportion of apoptotic cells should be the apoptotic index. 2.4. Histopathology examination Histopathological analysis was done in a blind review. The kidney grafts were bisected horizontally and fixed in 4% paraformaldehyde. The specimens were cut into 2-lmthick sections and stained with Mayer’s haematoxylin–eosin (HE). Acute rejection diagnosis with reference to the Banff 97 working classification [9], semiquantitative evaluation of severity level of acute rejection with reference to the method adopted by Watanabe et al. [10]. Semi-quantitative score and Banff 97 in acute rejection correspon-
dence, that is: 0 = normal, 1 = borderline change, 2 = IA, 3 = IB, 4 = IIA, 5 = IIB, 6 = III. 2.5. Real-time PCR analysis of rat ESM-1 mRNA Peripheral blood sampling: 3–4 ml of venous blood was drawn from the heart on days 1, 5, 7 after transplantation in each group. Within 24 h after blood sampling, monocyte suspension was prepared, followed by total RNA extraction, RNA identification, reverse transcription of cDNA and real-time PCR amplification. The accession number and mRNA sequence of rat ESM-1 were retrieved from the NCBI(NM_007036). The primers were designed by TAKARA with reference to the literature and synthesized by Shanghai Sangon Co., Ltd. The mRNA analysis was performed using Bio-Rad fluorescence PCR cycler and Bio-Rad Opticon monitor 3 software. The primers used for ESM-1 real-time RT-PCR were: 50 ACTTCCCCTTCTTCCAGTATGC–30 (sense),50 -CGGTCTCCAATCTCTTCT CTCAC–30 (antisense). GAPDH served as internal control, and the relative quantity of ESM-1 mRNA was expressed in the ratio of ESM-1/GAPDH. 2.6. Detection of ESM-1 protein in serum(ELISA assay) ESM-1 EIA kits were obtained (DIYEK EndoMark R1 (ELISA kit to detect rat endocan), Lunginnov S.A.S Inc., France) and serum ESM-1 was detected according to the manufacturer’s instructions. The absorbance was measured at 450 nm on a spectrophotometer. 2.7. Immunofluorescence detection of ESM-1 protein Rat kidney graft tissue specimens were obtained on days 1, 5, 7 after transplantation, and were stored in liquid nitrogen. Immunofluorescence assay was performed routinely with the use of primary antibody against ESM-1 (Anti-ESM-1, clone CSLEX1, Santa Cruz) and FITC-labeled rabbit anti-murine secondary antibody. Five glomeruli were sampled randomly from each specimen of each group in high-power field using Image-pro plus 5.0 software (Media Cybernetics, USA), and mean fluorescence intensity (MFI) of glomeruli for each specimen was used to express the relative quantity of ESM-1 protein. 2.8. Western blotting detection of ESM-1 protein Kidney samples (100 mg) were homogenized on day 7 after transplantation by a hand-held homogenizer in ice-cold tissue protein extraction buffer (Pierce, Rockford, IL, USA) with 1 mM EDTA and 1:100 protease inhibitor (Sigma, St. Louis, MO, USA). The contents were transferred to QIA shredder (Qiagen, Valencia, CA, USA). Fifty microgram of protein from kidney samples was mixed with 1 LDS buffer and reducing agent (both Invitrogen, Carlsbad, CA, USA) and heated at 65 °C for 5 min. The mixture was then subjected to SDS–PAGE. Following electrophoretic separation, the protein was transferred to a nitrocellulose membrane and probed with an antibody specific for ESM-1 or actin (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by an HRP-conjugated secondary antibody. The protein levels were compared by the ratio of measured protein band density and reference protein (actin) band density. 2.9. Statistical analysis Statistical analysis was performed using SPSS 13.0 software (SPSS, Chicago, IL, USA). The results are expressed as mean ± SE, and P < 0.05 was accepted as significant. The significance between groups was determined with single factor variance analysis and
33
S. Li et al. / Cellular Immunology 283 (2013) 31–37
Statistics-Bonferroni correction was used in multiple comparison tests. 2.10. Main outcome measures Pathological changes of transplanted kidney after the transplant, protein content of ESM-1, expression of ESM-1 mRNA, protein, and serum creatinine level in each group. 3. Result
3.2. Function of the transplanted kidney, see Fig. 1A Urine formation was started for all transplanted kidneys 3–5 min after blood flow was reestablished. On the fifth and seventh day afteroperation, serum creatinine level of the AR group was higher than those of the CsA group and the control group (P < 0.01). And the serum levels of creatinine were higher in the CsA group than those in the control group on the fifth day postoperation (P < 0.01). 3.3. Results of apoptosis assays in renal allograft, see Fig. 1
3.1. Quantitative analysis of animals Cold ischemia time for all organs was 0.5 ± 0.8 h. Warm ischemia time was 24.6 ± 5.2 min. There were no differences in cold or warm ischemia times among the treatment groups. Four rats died during and after operation; two rats of the acute rejection (AR) group died of anesthesia accident and hemorrhagic shock; one rat of the CsA group died of abdominal infection; and one rat in the CsA group died of anastomotic thrombus. The success rate of the operation was 92.5%. Two recipient rats died during sample collection, and the main cause was anesthesia accident. Additional operations were carried out for another two rats.
A
The positive rate of apoptotic cells in the AR group [(28.49 ± 5.41)%] was higher than those of the CsA group [(3.14 ± 1.47)%] and the control group [(2.03 ± 0.71)%] (P < 0.01), and There were no differences between the CsA group and the control group (P > 0.05). 3.4. For histopathological changes, see Figs. 1C and 2. Significant difference existed for paired evaluation within groups on the first, fifth and seventh day after transplantation (P < 0.01). The scores of the AR group on the fifth and seventh day were higher than
B
D
C
E
G
F
H
I
Fig. 1. (A) Function of the transplanted kidney, ⁄P < 0.01 vs. CsA group and control group, N P < 0.05 vs. control group; (B) Apoptosis in renal allograft tissues (TUNEL) (the positive rate of apoptic cells, %), ⁄P < 0.01 vs. CsA group and control group; (C) Results of histopathological changes in renal allograft, ⁄P < 0.01 vs. CsA group and control group; (D) ESM-1 mRNA expression in rat peripheral blood, ⁄P < 0.01 vs. CsA group and control group,N P < 0.05 vs. 1d; (E) ESM-1 protein expression in peripheral blood(ELISA assay), ⁄ P < 0.01 vs. CsA group and control group, N P < 0.05 vs. 1d; (F) Immunofluorescence detection results of ESM-1 protein,⁄P < 0.01 vs. CsA group and control group, N P < 0.05 vs. 1d; (G) Western blotting results of ESM-1 protein (ESM-1/b-actin). ⁄P < 0.01 vs. CsA group and control group. (H) The expression of ESM-1 protein in the rat kidney after transplantation, indicated by Western-blot examination on the 7th day after operation. (I) ROC curves of AR rats versus other subjects.
34
S. Li et al. / Cellular Immunology 283 (2013) 31–37
A
B
C
D
E
F
G
H
I
Fig. 2. (A) With patchy interstitial hemorrhage and necrosis in the kidney graft for the AR group (HE,10); (B and C) with hemorrhage and thrombus formation in the glomeruli in the kidney graft for the AR group. renal tubular epithelial cell vacuolation, luminal distension, exfoliation of some renal tubular epithelial cells, focal inflammatory cell infiltration (HE,40); (D and E) with severe infiltrate of inflammatory cells in glomerulus, interstitium, and vascular wall for the AR group (HE,40); (F) characterized by intimal thickening and necrosis of arterioles in the AR group (HE,40); (G) renal interstitium of the CsA group (HE,40); (H) vascular wall of renal tissue in the CsA group (HE,40); (I) infiltrate of inflammatory cells not obvious in glomerulus, interstitium, and vascular wall for normal rats (HE,40).
those on the first day respectively (P < 0.01), with the seventh day higher than that of the fifth day in AR group (P < 0.01). On the first day after operation, the structure and shape of glomerulus and renal tubule were basically normal in all groups; in the AR group, a few scattered interstitial lymphocytic infiltrates appeared in six rats. No abnormity was observed for the interstitium in the CsA group and control group. Pathological examination was carried out afterwards, which indicated a mild quantity increase of mononuclear cell infiltrates in some samples, without significantly extended scope. On the fifth day in the AR group, mononuclear cells were observed to infiltrate into renal tubule, caused tubulitis. And the capillary and glomerulus were affected in some samples. On the seventh day, mononuclear cell were observed to infiltrate into capillary for most renal allograft, which led to endarteritis and interstitial hemorrhagic necrosis. See Fig. 2. 3.5. ESM-1 mRNA expression in rat peripheral blood, refer to Fig. 1,D Real-time PCR results indicated ESM-1 mRNA expression upregulation in all the three groups afteroperation, and significant upregulation in ESM-1 mRNA expression in AR group on days 5(P = 1.23E05) and 7 (P = 4.20E15) when compared with CsA group. The results were higher on the 5th day than that on the first
day after surgery in the CsA group (P = 1.04E10) and the Control group (P = 1.18E05) respectively. However, ESM-1 mRNA expression was not significantly higher in CSA group than control group (P > 0.05). 3.6. Serum expression of ESM-1 protein, refer to Fig. 1E The ESM-1 concentration in serum was then measured by ESM1 ELISA kit according to the manufacturer’s instructions. The analyzed, summarized results are shown in Fig. 1,E. Serum ESM-1 concentrations were significantly elevated in AR group as when compared to CsA group(day 5, P = 8.37E09; day 7,P = 1.42E12) and control group(day 5, P = 6.89E-10; day 7, P = 2.68E-13). The results were higher on the 5th day than that on the first day after surgery in the CsA group (p = 0.019) and the Control group (p = 0.036) respectively. These results are verified by the dynamic changes of mRNA expression of ESM-1 in peripheral blood. 3.7. Immunofluorescence detection results of ESM-1 protein, refer to Figs. 1E and 3 Localization of ESM-1 expression in kidney by confocal microscope. Subcellular localization of ESM-1 in kidney was detected
35
S. Li et al. / Cellular Immunology 283 (2013) 31–37
ESM-1 FITC
DAPI
Merge
AR group Bars=100
A
B
m
C
AR group Bars=100
D
E
m
F
CsA group Bars=500
G
H
m
I
CsA group Bars=100
J
K
m
L
Control group Bars=100
M
O
m
P
Control group Bars=100
Q
R
m
S
Fig. 3. The expression of ESM-1 protein in the rat kidney after transplantation, indicated by immunofluorescence examination on the 7th day after operation. Localization of ESM-1 expression in kidney by confocal microscope. Subcellular localization of ESM-1 in kidney was detected with FITC-conjugated secondary antibodies to capture ESM-1. Nuclei were counterstained by DAPI (Invitrogen). (A–F): ESM-1 protein expression upregulation in glomeruli in the presence of acute rejection (Bars = 100 lm); (G–L): Moderate upregulation express of ESM-1 protein in CsA group (G–I, Bars = 500 lm; J-L, Bars = 100 lm); M-S: ESM-1 protein expression was weak in normal kidneys (Bars = 100 lm).
36
S. Li et al. / Cellular Immunology 283 (2013) 31–37
with FITC-conjugated secondary antibodies to capture ESM-1. Nuclei were counterstained by DAPI (Invitrogen).ESM-1 protein expression was weak in normal kidneys. See Fig. 3 M-S. Image analysis revealed ESM-1 protein expression upregulation in glomeruli in all the three groups afteroperation, particularly, in the presence of acute rejection. MFI increased significantly in AR groups when compared to CsA group (day 5, P = 1.54E-13; day 7, P = 1.17E-17) and control group(day 5, P = 2.28E-14; day 7, P = 4.79E-18). The results were higher on the 5th day than that on the first day after surgery in the CsA group (P = 0.012) and the Control group (P = 0.011) respectively. However, ESM-1 mRNA expression was not significantly higher in CSA group than in control group (P > 0.05). See Fig. 1E. 3.8. Western blotting results of ESM-1 protein, refer to Fig. 1,G,H ESM-1 protein expression was upregulated significantly in AR groups (0.49 ± 0.06) when compared to CsA group (0.24 ± 0.05) (P = 1.26E-09) and control group (0.20 ± 0.04) (P = 4.88E-10) on days 7. ESM-1 protein expression was not significantly higher in CSA group than in control group (P = 0.209). ROC curve of ESM-1 sensitivity in AR diagnosis, refer to Fig. 1I. We next analyzed the receiver operator characteristics (ROC) of the expression of ESM-1 mRNA. In order to distinguish between AR and other samples, we used an ESM-1 cutoff value of 6.41. The specificity of ESM-1 was 100% and sensitivity was 93.8% at the cutoff value. For ESM-1, the area under the curve was 0.991 (Fig. 1,I). We analyzed the specificity and sensitivity of ESM-1 in AR group. The specificity of ESM-1 was 91% and sensitivity was 95%. We performed Pearson correlation analysis for pathohistological scores of renal grafts, peripheral blood ESM-1 mRNA, ESM-1 protein, and the relative content of ESM-1 protein in the kidney (IF) in the AR group. The results were (P = 0.046, r = 0.997), (P = 0.049, r = 0.988), and (P = 0.038, r = 0.993), respectively. It was suggested that in the AR group, ESM-1 expression correlated positively to the severity of rejection. 4. Discussion AR is classified into ACR (acute cellular rejection) and AVR (acute vascular rejection) according to pathological findings [11]. AR of rat kidney graft in this study involves both ACR and AVR, according to the Banff97 criteria [9]. This was similar with the findings by Savikko et al. [12]. Pathologic changes were significantly worse in AR group than CsA group and control group on days 5 and 7. In addition, Pathologic scores increased in CsA group and control group, but they did not change significantly on days 5 and 7(P > 0.05). ESM-1 is a 50 kDa soluble proteoglycan, which is expressed by the vascular endothelium and freely circulates in the bloodstream [13]. And it is a key player in the regulation of cell adhesion, inflammatory disorders, and tumor progression [14–16]. Recent data have suggested that ESM-1 is known to be a diagnostic marker for sepsis [17]. What‘s more, it has been identified as a potential novel endothelial cell marker and a new target for cancer therapy because of its high specificity to endothelial cells [18–25]. Vascular endothelium is the place where the donor’s cells first contact the receipt’s cells and are first recognized by the receipt’s immune system. During the acute rejection, immune reaction between the receipt’s leukocytes and endothelial cells of kidney graft may lead to endothelial cell injury and desquamation. The relationship between EC and AR has become a focus of research recently. There have been few clinical research reports on ESM-1, and the role of ESM-1 in graft rejection remains unclear. It was reported that ESM-1 can dose-dependently suppress the
specific binding of soluble ICAM-1 to lymphocytes, thus inhibiting lymphocyte adhesion and /or activation through the LFA-1 pathway [16]. Thus, it has perhaps immunomodulatory function after transplantation and does not only reflect vascular endothelium damage and inflammation in acute rejection. In a rat model for inflammation, increased ESM-1 levels in the circulating blood suppressed the adhesion of lymphocytes to endothelium [26]. In this study, ESM-1 mRNA and protein expression in peripheral blood and ESM-1 protein expression in kidney graft tissues were detected, and it was found that ESM-1 expression increased significantly in the AR group than in control rats and rats treated with CsA. Otherwise, the result of ESM-1 expression was also upregulated to a certain degree in the CsA group and control group on the day 5 afteroperation, which indicates that the up-regulated expression of ESM-1 is also associated with regenerative processes after vascular injury. But the degree of upregulation in the CsA group and control group is not significant than in the AR group. 5. Conclusion These findings support that ESM-1 may reflect the degree of endothelial cell injury and immune states after kidney transplantation. Therefore, ESM-1 may serve as a new predictive marker for acute rejection. Nevertheless, further investigation is required to test if it meets the criteria for clinical utility. Acknowledgements Supported by the grant from the General Hospital of Chengdu Military Region (No: 2011YG-04), the grant from the 12th Five Year Program of Chengdu Military Region of China (No: C12033) and the General Hospital of Chengdu Military Region (No: 2013YG-B022). References [1] A. Woywodt, T. Kirsch, M. Haubitz, Circulating endothelial cells in renal disease: markers and mediators of vascular damage, Nephrol. Dial. Transplant. 23 (2008) 7–10. [2] U. Erdbruegger, M. Haubitz, A. Woywodt, Circulating endothelial cells: a novel marker of endothelial damage, Clin. Chim. Acta 373 (2006) 17–26. [3] J.C. Tsai, J. Zhang, T. Minami, C. Voland, S. Zhao, X. Yi, et al., Cloning and characterization of the human lung endothelial-cell-specific molecule-1 promoter, J. Vasc. Res. 39 (2002) 148–159. [4] M. Aitkenhead, WSJ, Nakatsu MN MJ, Heard C HCC. Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM, Microvasc. Res. 63 (2002) 159–171. [5] D. Bechard, V. Meignin, A. Scherpereel, S. Oudin, G. Kervoaze, P. Bertheau, et al., Characterization of the secreted form of endothelial-cell-specific molecule 1 by specific monoclonal antibodies, J. Vasc. Res. 37 (2000) 417–425. [6] P. Lassalle, S. Molet, A. Janin, J.V. Heyden, J. Tavernier, W. Fiers, R. Devos, A.B. Tonnel, ESM-1 is a novel human endothelial cellspecific molecule expressed in lung and regulated by cytokines, J. Biol. Chem. 271 (1996) 20458–20464. [7] Li SD JFS, Li QS. Establishment of a rat model of bilateral renal allograft. J. Clin. Rehabil. Tissue Eng. Res. 2008; 12: 853–6. [8] L.W. Shadan Li, Kuiying Wea, Oxygenase-1 expression and its significance for acute rejection following kidney transplantation in rats, Transplant Proc. 43 (2011) 1980–1984. [9] L.C. Racusen, K. Solez, R.B. Colvin, S.M. Bonsib, M.C. Castro, T. Cavallo, et al., The Banff 97 working classification of renal allograft pathology, Kidney Int. 55 (1999) 713–723. [10] Y. Watanabe, R. Yoshimura, S. Wada, J. Chargui, J. Suzuki, T. Kishimoto, et al., Expression of nonmuscle myosin heavy chain B (SMemb) in rat allogeneic kidney transplantation, Nephron 91 (2002) 316–323. [11] C. Jianghua, X. Wenqing, W. Huiping, J. Juan, W. Jianyong, H. Qiang, C4d as a significant predictor for humoral rejection in renal allografts, Clin. Transplant. 19 (2005) 785–791. [12] J.E.E.V. Savikko, Early induction of platelet-derived growth factor ligands and receptors in acuter rat renal allograft rejection, Transplantation 72 (2001) 31– 37. [13] S. Sarrazin, E. Adam, M. Lyon, F. Depontieu, V. Motte, C. Landolfi, H. LortatJacob, D. Bechard, P. Lassalle, M. Delehedde, Endocan or endothelial cell specific molecule-1 (ESM-1): a potential novel endothelial cell marker and a new target for cancer therapy, Biochim. Biophys. Acta 1765 (2006) 25–37. [14] D. Bechard, T. Gentina, M. Delehedde, A. Scherpereel, M. Lyon, M. Aumercier, et al., Endocan is a novel chondroitin sulfate/dermatan sulfate proteoglycan
S. Li et al. / Cellular Immunology 283 (2013) 31–37
[15]
[16]
[17] [18]
[19]
[20]
that promotes hepatocyte growth factor/scatter factor mitogenic activity, J. Biol. Chem. 276 (2001) 48341–48349. M. Murakami, A. Horowitz, S. Tang, J.A. Ware, M. Simons, Protein kinase C (PKC) delta regulates PKCalpha activity in a syndecan-4-dependent manner, J. Biol. Chem. 277 (2002) 20367–20371. D. Bechard, A. Scherpereel, H. Hammad, T. Gentina, A. Tsicopoulos, M. Aumercier, et al., Human endothelial-cell specific molecule-1 binds directly to the integrin CD11a/CD18 (LFA-1) and blocks binding to intercellular adhesion molecule-1, J. Immunol. 167 (2001) 3099–3106. J.G. Filep, Endocan or endothelial cell-specific molecule-1: a novel prognostic marker of sepsis, Crit. Care Med. 34 (2006) 574–575. B.D. Grigoriu, F. Depontieu, A. Scherpereel, D. Gourcerol, P. Devos, T. Ouatas, et al., Endocan expression and relationship with survival in human non-small cell lung cancer, Clin. Cancer Res. 12 (2006) 4575–4582. N.Y. Ji, Y.H. Kim, Y.J. Jang, Y.H. Kang, C.I. Lee, J.W. Kim, et al., Identification of endothelial cell-specific molecule-1 as a potential serum marker for colorectal cancer, Cancer Sci. 101 (2010) 2248–2253. X. Leroy, L. Zini, H. Franquet, G. Kervoaze, A. Villers, M. Delehedde, M.C. Copin, P. Lassalle, Vascular endocan (ESM-1) is markedly overexpressed in clear cell renal cell carcinoma, Histopathology 56 (2010) 180–187.
37
[21] N. Liu, L.H. Zhang, H. Du, Y. Hu, G.G. Zhang, X.H. Wang, et al., Overexpression of endothelial cell specific molecule-1 (ESM-1) in gastric cancer, Ann. Surg. Oncol. 17 (2010) 2628–2639. [22] A. Scherpereel, T. Gentina, B. Grigoriu, S. Senechal, A. Janin, A. Tsicopoulos, et al., Overexpression of endocan induces tumor formation, Cancer Res. 63 (2003) 6084–6089. [23] S. Amatschek, U. Koenig, H. Auer, P. Steinlein, M. Pacher, A. Gruenfelder, et al., Tissue-wide expression profiling using cDNA subtraction and microarrays to identify tumor-specific genes, Cancer Res. 64 (2004) 844–856. [24] L.J. van ‘Veer, H. Dai, M.J. van de Vijver, Y.D. He, A.A. Hart, M. Mao, Gene expression profiling predicts clinical outcome of breast cancer, Nature 415 (2002) 530–536. [25] M.E. Lenburg, L.S. Liou, N.P. Gerry, G.M. Frampton, H.T. Cohen, M.F. Christman, Previously unidentified changes in renal cell carcinoma gene expression identified by parametric analysis of microarray data, BMC Cancer 3 (2003) 31. [26] S. Tissier, S. Lancel, X. Marechal, S. Mordon, F. Depontieu, A. Scherpereel, et al., Calpain inhibitors improve myocardial dysfunction and inflammation induced by endotoxin in rats, Shock 21 (2004) 352–357.