- Email: [email protected]
Detection and molecular characterization of Frog virus 3 in bullfrogs from frog farms in Brazil
Aquaculture xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Detection and molecular characterization of Frog virus 3 in bullfrogs from frog farms in Brazil Cinthia Rodrigues Oliveiraa, Sthefany Rosa Alfaiaa, Fernanda Lie Ikaria, Loiane Sampaio Tavaresb, Ricardo Luiz Moro de Sousab, Ricardo Harakavac, Claudia Maris Ferreiraa,∗ a
Fisheries Institute, APTA, SAA, São Paulo, SP, 05001-900, Brazil University of São Paulo, USP, FZEA, Pirassununga, SP, 13635-900, Brazil c Biological Institute, APTA, SAA, São Paulo, SP, 04014-900, Brazil b
A R T I C LE I N FO
A B S T R A C T
Keywords: FV3 Lithobates catesbeianus Anurans Rana catesbeiana
The objective of this study was to perform the molecular diagnosis of ranavirus Frog virus 3 (FV3) in bullfrogs (Lithobates catesbeianus) obtained from frog farms in the central-southern region of Brazil. From each frog farm, we collected adult animals with a mean weight of 120 g ± 8.0 and tadpoles with a mean weight of 7 g ± 1.2, totaling 235 animals. For the diagnosis, liver, kidney and spleen samples were collected from the animals and subjected to DNA extraction and conventional PCR. Positive samples were detected on one farm in the state of São Paulo. To confirm the results, we performed nucleotide sequencing of the MCP gene and phylogenetic analysis. The results revealed that FV3 strains are present in Brazil with their own phylogenetic profile, and that these strains differ from those affecting amphibians and reptiles described so far in other countries. Further studies are necessary to better understand the circulation of this pathogen in aquatic systems and the dynamics of the dissemination of this disease in Brazil.
1. Introduction Frog farming is an internationally profitable enterprise and the habit of eating frog meat is very important for subsistence in various communities around the world. The main species grown in commercial cultivation is the bullfrog (Lithobates catesbeianus). The custom of eating frog legs transcends borders and is shared by almost every continent by virtue of the taste and nutritional benefits of the meat (Altherr et al., 2011; Moreira et al., 2013). In Brazil, frog farming is a well-established activity since the 1980s, but there has been a decline in production in recent years. In 2006, 600 tons of meat were produced, and in 2012, production was only at 200 tons (FAO, 2015). Despite the good performance of the business, some producers face difficulties in maintaining health on the farms (Dias et al., 2009). Aquatic pathogens spread rapidly and the confinement of many animals during transport or in the commercial cultivation promote this process (Miocevic et al., 1993; Pavlin et al., 2009). The disappearance of amphibians is due to the decrease, fragmentation and pollution of habitats, but also two emerging diseases that have been causing substantial mortality in populations: chytridiomycosis and ranaviruses, both of which require mandatory reporting (OIE, 2017). In ranaculture facilities, ranavirus has been ∗
causing outbreaks in recent years. It has already been diagnosed on Brazilian frog farms, but without evidence until the moment of reaching the outside environment (Mazzoni et al., 2009; Neves et al., 2016). In addition, frequent bidirectional flow of specimens through escape, release of captives and entry of wild animals into farms poses a risk to captive frogs and to local fauna, since ranaviruses are not a pathogen restricted to amphibians and may affect other groups of ectotherms (Gray and Chinchar, 2015; Neves et al., 2016). In South America, there have been few studies on the virus, and the circulating genotypic profiles, distribution and severity of existing strains and their impact on the breeding of aquatic organisms as well are still unknown. Ranaviruses have been diagnosed on five continents, affecting approximately 200 species of ectotherms and the type species of the genus, known as Frog virus 3 (FV3) (Chinchar et al., 2017), is highly lethal to anurans (Duffus et al., 2015). In most cases, infection is systemic, with necrotic areas, and mortality is as high as 90% in the affected population (Behncke et al., 2013). Dissemination is facilitated by inherent behaviors of amphibians such as necrophagy and cannibalism (Crump, 1983), as well as by contact with infected individuals or contaminated water (Miller et al., 2011). The infectious process involves genetics, environmental factors (pollution, temperature and other stressors) and inherent biological characteristics of the host (age,
Corresponding author. Fisheries Institute, APTA, SAA, Av. Francisco Matarazzo, 455, 05001-900, São Paulo, SP, Brazil. E-mail address: [email protected] (C.M. Ferreira).
https://doi.org/10.1016/j.aquaculture.2019.734575 Received 27 March 2019; Received in revised form 20 September 2019; Accepted 4 October 2019 Available online 31 October 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Please cite this article as: Cinthia Rodrigues Oliveira, et al., Aquaculture, https://doi.org/10.1016/j.aquaculture.2019.734575
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
life stage, physiological aspects) that directly affect immune competence (Brunner et al., 2005; Brand et al., 2016; Wendel et al., 2017). The genus Ranavirus (family Iridoviridae, subfamily Alphairidovirinae) is formed by DNA viruses that have as a common characteristic of the taxa the presence of the structural gene of the main capsid protein (MCP), which is highly conserved (Chinchar et al., 2017). This gene is used as a molecular diagnostic tool for analyzing the disease via PCR (Sample et al., 2007). Ranaviruses caused by FV3 is usually severe in tadpoles and newly metamorphosed individuals, and occasionally, more virulent strains, high infectious doses, genetic factors of the host population, co-infection with other biological agents and the presence of abiotic and anthropogenic environmental stressors decimate populations independently of the stage of life (Daszak et al., 1999; Brunner et al., 2005; Landsberg et al., 2013; Love et al., 2016). The objective of the present study was to determine the presence of Frog virus 3 (FV3) on frog farms in the central-southern region of Brazil, and to determine the phylogenetic relationship of the strains detected comparing them with other species of ranavirus already described, based on the nucleotide sequence of the MCP gene.
Table 1 Properties of the primers and their purpose for detection and sequencing of FV3. Primer
Direction
Sequence (5′- 3′)
Product
Function
MCP1
Forward Reverse Forward Reverse Forward Reverse
AACCCGGCTTTCGGGCAGCA CGGGGCGGGGTTGATGAGAT ATGACCGTCGCCCTCATCAC CCATCGAGCCGTTCATGATG ATGTCTTCTGTAACTGGTTCA TTACAAGATTGGGAATCCCAT
321 bpa
Detection
MCP2 MCPRV
625 bpa 1392 bp
Detection b,c
Sequencing
a Marsh et al. (2002); b - (Correa, personal communication 2017† († Thais Camilo Correa: [email protected]); c- Mazzoni et al. (2009).
previously approved by the Committee of Ethics in Animal Experimentation of the Fisheries Institute under No. 04/2016. The spleen, liver and kidneys of the animals were removed, cut into 0.1 g portions and frozen at -20oC. To avoid cross-contamination between the specimens and samples collected, the utensils were cleansed with Virkon™ and flamed for 15 s. The tissue samples were submitted to molecular diagnosis in the Zootechnical Hygiene Laboratory of the Faculty of Animal Science and Food Engineering (FZEA) of the University of São Paulo, in Pirassununga, SP.
2. Material and methods 2.1. Collection of samples
2.2. DNA extraction and PCR Animals were collected from eight different commercial frog farms in the central-southern region of Brazil in the spring-summer period of 2016–2017, namely Pindamonhangaba/São Paulo (C1), Juquitiba/São Paulo (C2), Jaboticabal/São Paulo (C3), Ibaté/São Paulo (C4), Matão/ São Paulo (C5) Tapiratiba/São Paulo (C6), Imbé/Rio Grande do Sul (C7) and Paulo Lopes/Santa Catarina (C8) (Fig. 1). All the farms were visited once excepted C6 location was sampled twice. These farms were chosen according the time of commercial establishment and mortality reports in the last 3 years. Three farms (C1, C3 and C4) provided 20 adults and 20 tadpoles, while farm C2 provided 10 adults and 10 tadpoles, C5 20 tadpoles, C6 23 adults and 12 tadpoles, and C7 and C8 only 20 adult frogs, totaling 235 specimens. The adults had a mean weight of 120 ± 8 g and the mean weight of the tadpoles was 7 ± 1.2 g. The adults of each farm were transported live to the laboratory of the Fisheries Institute in São Paulo, in isothermal containers with a 5cm layer of water. The tadpoles of each farm were kept in a 16-L box container with aerated water. In the laboratory, the adults were acclimated for 24 h in a 100-L polyethylene box with dechlorinated water with a depth of 5 cm. The tadpoles were acclimated in 12-L aquariums, with dechlorinated water with constant aeration. The next day, the specimens were anesthetized with ice and benzocaine hydrochloride (4:1) and euthanized by cutting the cervical spine. This procedure was
Tissue samples of different organs (spleen, liver and kidney) of each animal were pooled, and DNA was extracted using the PROMEGA™ SV Wizard kit, following the manufacturer's recommendations, except for the elution of the DNA being reduced to a volume of 100 μL. PCR was performed with different primer pairs according to the purpose: detection or nucleotide sequencing (Table 1). For detection of FV3, all samples were subjected to PCR assays with two primer pairs, MCP1 and MCP2 (Marsh et al., 2002), for partial amplification of the MCP gene according to the following thermocycling protocol: 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min, and a final extension of 72 °C for 5 min. To obtain the fragment of the MCP gene to be sequenced, the primer pairs MCPRV and MCPRV2 were used along with the following thermocycling protocol: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 58 °C per 30 s and 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products were subjected to 1.5% agarose gel electrophoresis in Tris-acetate/EDTA buffer (TAE 1X) and observed under UV light using the L-Pix ST photodocumentation system and L-Pix Image software (Loccus Biotechnology, Brazil). The positive control used was an isolated strain of FV3 in BF2 cultured cells (bluegill fry ATCC CCL-91), from an outbreak that occurred in the city of Matão, SP, Brazil (Alencar, 2016). Fig. 1. Geopolitical map of Brazil. Noted are the states of the South region and São Paulo State, where the collections were carried out: Pindamonhangaba/São Paulo (C1), Juquitiba/São Paulo (C2), Jaboticabal/São Paulo (C3), Ibaté/São Paulo (C4), Matão/ São Paulo (C5), Tapiratiba/São Paulo (C6), Imbé/Rio Grande do Sul (C7) and Paulo Lopes/Santa Catarina (C8). Source: pixabay. com - adapted.
2
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
Table 2 Name of viral isolates and acronym, host class, common host name, scientific name of the host, GenBank code and corresponding country where the isolate was detected. Ranavirus (initials)
Host of isolate
Popular name (host)
Scientific name (host)
GenBank
Country
Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog
(FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3)
Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian
Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Giant toad Giant Toad Wood frog Wood frog Wood frog, Spring peepers, Red-spotted newts, Tree frogs
KT154965 KT154964 KT154966 DQ897669 MG573200 MG573201 EF101698.1 EF175670.1 EF101697.1 DQ906049.1 DQ906048.1 MH247258.1 MK204478.1 MK204477.1 MK204476.1 MK204475.1 AF157649.1 AF157648.1 GQ144408.1 GQ144407.1 FJ601916.1
Brazil Brazil Brazil Brazil Brazil Brazil USA USA USA USA USA Mexico Mexico Mexico Mexico Mexico Venezuela Venezuela Canada Canada USA
Frog virus 3 (FV3) Frog virus 3 (FV3) Frog virus 3 (FV3)
Amphibian Amphibian Amphibian
Spotted salamander Marbled salamandar Spotted salamander
Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Bufo marinus Bufo marinus Rana sylvatica Rana sylvatica Rana sylvatica, Pseudacris crucifer Notophthalmus viridescens, Hyla versicolor Ambystoma maculatum Ambystoma opacum Ambystoma maculatum
JQ361076.1 JQ361075.1 JQ771299.1
USA USA USA
virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus
3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3
50% of specimens were also PCR-positive (Table 3). The results were similar for both primers used (MCP1 and MCP2). These animals exhibited the following symptoms: repetitive circular movements, loss of appetite, prostration, swollen belly, ascites, prolapse of the bladder and loss of movement in the hind legs.
2.3. Nucleotide sequencing and phylogenetic reconstruction PCR products obtained with MCPRV2/MCPRV primers (1392 bp) were purified by PEG 6000 precipitation (Schmitz and Riesner, 2006) and sequenced by the Sanger method in an Applied Biosystems instrument (model 3500 xL). The sequences obtained were compared to those of species of the genus Ranavirus deposited in GenBank (Table 2) using BLAST software. The sequences were aligned by ClustalW in the BioEdit program. Phylogenetic tree construction by maximum likelihood was performed using IQ-TREE software with the evolutionary model of TPM2+G4 substitution and bootstrapping with 1000 replicates.
3.1. Phylogenetic analysis Nucleotide sequences obtained from samples of the C6 farm showed more than 99% identity with sequences of FV3 already found in Brazil and more than 94% with ranaviruses isolated from different species of amphibians, fish and reptiles in several countries. Sequences selected for the phylogenetic tree are listed in Table 2 and ClustalW alignments between sequences are presented in supplementary material Fig. S1. In the phylogenetic analysis, the sequences of frog farm C6 in Tapiratiba/ São Paulo (GenBank accession Nos. MG573200 and MG573201) clustered in the same clade as other Brazilian strains and separated from the clades formed by strains from other countries (Fig. 2).
3. Results PCR positive samples were detected on the frog farm of Tapiratiba, SP (C6). In the first sampling, during November 2016, five adults were investigated and 100% were PCR-positive. In the second sampling, during March 2017, others 18 adults and 23 tadpoles were sampled and
Table 3 Prevalence (%) of Frog virus 3 (FV3) on frog farms in the central-southern region of Brazil during spring-summer period of 2016–2017. (Results with MCP2). Sample site
Number of animals collected
FV3 PCR
Prevalence
95% confidence interval lower-upper
Pindamonhangaba/São Paulo (C1) (sampled in September 2016) Juquitiba/São Paulo (C2) (sampled in November 2016) Jaboticabal/São Paulo (C3) (sampled in May 2017) Ibaté/São Paulo (C4) (sampled in May 2017) Matão/São Paulo (C5) (sampled in May 2017) Tapiratiba/São Paulo (C6) (sampled in November 2016) and March 2017) Imbé/Rio Grande do Sul (C7) (sampled March 2017) Paulo Lopes/Santa Catarina (C8) (sampled March 2017) Total
20 20 10 10 20 20 20 20 20
– – – – – – – – –
– – – – – – – – –
– – – – – – – – –
23 adults 12 tadpoles 20 adults
+ + –
52.2% 50.0% –
0.19 - 0.55 0.25 - 0.72 –
20 adults
–
–
–
7.7%
0.05 - 0.12
tadpoles adults tadpoles adults tadpoles adults tadpoles adults tadpoles
235 frogs
3
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
Fig. 2. Phylogenetic analysis by maximum likelihood with the sequences found in Frog farm C6 in Tapiratiba/São Paulo (FV3_MG573200 and FV3_MG573201). FV3 isolates were obtained from GenBank. Highlighted is the clade of the Brazilian ranavirus sequences detected in the present study. The numbers on the nodes indicate the bootstrap values.
4. Discussion
used in frog farms. When crowded, continuous contact between infected and healthy individuals facilitates the spread of diseases (Haddad et al., 2002; Mazzoni et al., 2009; Reeve et al., 2013; Gray and Chinchar, 2015). It is interesting that in C6, the animals died gradually over four consecutive weeks, with repetitive circular movements, loss of appetite, prostration, swollen belly, ascites, prolapse of the bladder and loss of movement in the hind legs followed by swelling. All these symptoms caused by FV3-like have already been associated with this disease (Robert et al., 2005; Mazzoni et al., 2009; Miaud et al., 2016; Miller et al., 2011), with the exception of prolapse of the bladder (see video in supplementary material). It should be emphasized that the C5 ranaculture was sampled in the present study and the animals are currently healthy. In communication with the producer, we were informed that since the 2012 outbreak, all specimens were sacrificed by incineration, and new animals were acquired and allocated to the facility, which underwent prior disinfection with heat and sodium hypochlorite. Given the success in the decontamination process, the C6 ranaculture did the same with its animals to prevent the disease from spreading. These measures are recommended and necessary because, once circulating in the environment, the virus can spread by hiding in reservoir species and causing mortality outbreaks in other organisms (Waltzek et al., 2014). Preventive testing for ranaviruses and other pathogens is necessary to ensure the health of commercial frog breeding by uncovering the presence of asymptomatic infections that are a potential silent threat (Robert et al., 2007; Whittington et al., 2010). Supplementary video related to this article can be found at https:// doi.org/10.1016/j.aquaculture.2019.734575. The ranavirus sequences found in the present study were similar to those of FV3 and were grouped in the same clade as the other strains already found in Brazil. This finding demonstrated that the virus has already established itself in the country and may have undergone minor genomic changes, probably due to different environmental adaptations. A total of three hundred pairs of bullfrogs were introduced to Brazil for commercial farming in 1935, where they were imported from Canada. Officially, only a second importation of 20 pairs from North America (Michigan, USA) occurred in 1970 (Schloegel et al., 2010). On the other
FV3 outbreaks can trigger high mortality for wild and captive anurans, with the number of deaths in the population being almost 100% within a few days (Wheelwright et al., 2014). Reports of ranaviruses epizootics have increased in recent years (Claytor et al., 2017; Duffus et al., 2015; Waltzek et al., 2014). New species of the genus Ranavirus have been recorded and outbreaks have resulted in damages to frog farms around the world. For example a ranavirus strain infected the frog farms of seven Thai provinces in a single year, causing mortality in Rana tigrina (Kanchanakhan, 1998). In North America, a frog farm was affected by a ranavirus similar to CMTV in 1998, and 8 years later, the same farm suffered a second ranavirus infection by a more virulent strain than the previous one. After isolation and sequencing of the virus, it was found to be the first reported case of ranavirus chimerism, with FV3 and CMTV parental strains (Claytor et al., 2017). In Brazil, ranavirus has been detected by molecular techniques and electron microscopy since the beginning of the 2000s, but no official notification to the legal authorities has been made so far (Hipolito et al., 2003; Mazzoni et al., 2009; Neves et al., 2016; Alencar, 2016). In this study, we investigated the presence of FV3 on frog farms in the centralsouthern region of Brazil. Of the eight farms investigated, FV3 was found on one (C6 - Tapiratiba/SP). This population was sampled twice in different periods: spring and summer. During the anamnesis with the frog farmer, we were informed that C6 ranaculture acquired breeding animals from the C5 farm in 2014, prior to the low-mortality outbreak reported by Alencar (2016). However, no abnormalities were detected in the C6 stock until December 2016, when a dam nearby collapsed and flooded the facility with poor-quality water contaminated with animal feces and organic matter. Days later, after such stressor event, adult frog mortality skyrocketed, resulting in the death of 90% of the population. Ranaviruses cause variable consequences sometimes associated with stressors, leading to greater fragility of hosts, since hormones released in stress situations may attenuate the immune response. Captive hosts are exposed to a variety of stress factors from captivity. Among the stressors in amphibians, we can list temperature extremes, low-quality water, the metamorphosis process of amphibians and the high density 4
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
hand, amphibians have been introduced over the years, destined for the pet market. Extensive studies are needed to determine if there are different strains of FV3 with different virulence genes circulating in Brazil. Future studies aimed at addressing such concerns would also be interesting to elucidate the history of ranaviruses in Brazil. For more indepth analyses, the sequencing of the complete genome of these strains is recommended. FV3 was detected on a Brazilian commercial frog farm, and the disease may be spreading throughout the country. This is the first official notification of ranavirus reported to the Brazilian Government and, consequently, to OIE. Sequencing of the MCP gene indicates that these Brazilian strains differ from other strains worldwide, stressing the need for further studies to understand the circulation of this pathogen in aquatic systems and the dynamics of the dissemination of this disease in Brazil.
Haddad, J.J., Saadé, N.E., Safieh-Garabedian, B., 2002. Cytokines and neuro–immune–endocrine interactions: a role for the hypothalamic–pituitary–adrenal revolving axis. J. Neuroimmunol. 133, 1–19. Hipolito, M., Catroxo, M.H.B., Curi, N.A., Bach, E.E., 2003. Detecção ao microscópio eletrônico de transmissão de partículas virais semelhantes ao grupo Iridovírus em rãstouro (Rana catesbeiana Shaw, 1802) criadas comercialmente. Primeira observação no Brasil. vol. 70 Arquivos do Instituto Biológico (CD-R). Kanchanakhan, S., 1998. An ulcerative disease of the cultured tiger frog, Rana tigrina, in Thailand: virological examination. Aquatic Animal Health Research Institute Newsletter 7, 1–2. Landsberg, J., Kiryu, Y., Tabuchi, M., Waltzek, T., Enge, K., Reintjes-Tolen, S., Preston, A., Pessier, A., 2013. Co-infection by alveolate parasites and Frog virus 3-like ranavirus during an amphibian larval mortality event in Florida, USA. DAO (Dis. Aquat. Org.) 105, 89–99. https://doi.org/10.3354/dao02625. Love, C., Winzeler, M., Beasley, R., Scott, D., Nunziata, S., Lance, S., 2016. Patterns of amphibian infection prevalence across wetlands on the Savannah River Site, South Carolina, USA. DAO (Dis. Aquat. Org.) 121, 1–14. https://doi.org/10.3354/ dao03039. Marsh, I.B., Whittington, R.J., O'Rourke, B., Hyatt, A.D., Chisholm, O., 2002. Rapid 271 differentiation of Australian, European and American ranaviruses based on 272 variation in major capsid protein gene sequence. Mol. Cell. Probes 16, 137–151. https://doi.org/10.1006/mcpr.2001.0400. Mazzoni, R., Mesquita, A.J., Fleury, L.F.F., Brito, W.M.E.D., Nunes, I.A., Robert, J., Morales, H., Coelho, A.S.G., Barthasson, D.L., Galli, L., Catroxo, M.H.B., 2009. Mass mortality associated with a Frog virus 3-like Ranavirus infection in farmed tadpoles Rana catesbeiana from Brazil. DAO (Dis. Aquat. Org.) 86, 181–191. https://doi.org/ 10.3354/dao02096. Miaud, C., Pozet, F., Gaudin, N.C.G., Martel, A., Pasmans, F., Labrut, S., 2016. Ranavirus causes mass die-offs of alpine amphibians in the southwestern Alps, France. J. Wildl. Dis. 52, 242–252. Miller, D., Gray, M., Storfer, A., 2011. Ecopathology of ranaviruses infecting Amphibians. Viruses 3, 2351–2373. https://doi.org/10.3390/v3112351. Miocevic, I., Smith, J., Owens, L.S.R., 1993. Ultraviolet sterilisation of model viruses important to finfish aquaculture in Australia. Aust. Vet. J. 70, 25–27. Moreira, C.R., Henriques, M.B., Ferreira, C.M., 2013. Frog Farms as Proposed in Agribusiness Aquaculture: Economic Viability Based in Feed Conversion, vol. 39. Boletim do Instituto de Pesca, pp. 389–399. Neves, P.V., Catroxo, M.H., Hipolito, M., Rodrigues, C.O., Ferreira, C.M., 2016. Use of Polyclonal Antibodies, Electron Microscopy and Histopathology to Detect Iridoviruslike Particles in Bullfrogs, vol. 42. Boletim do Instituto de Pesca, pp. 523–531. OIE, 2017. The organization for animal health 2017. Infection with ranavirus. September 2017, Retrieved from. http://www.oie.int/fileadmin/Home/eng/Health_standards/ aahm/current/chapitre_ranavirus.pdf. Pavlin, B.I., Schloegel, L.M., Daszak, P., 2009. Risk of importing zoonotic diseases through wildlife trade, United States. Emerg. Infect. Dis. 15 (11), 1721–1726. https://doi.org/10.3201/eid1511.090467. Reeve, B.C., Crespi, E.J., Whipps, C.M., Brunner, J.L., 2013. Natural stressors and ranavirus susceptibility in larval wood frogs (Rana sylvatica). EcoHealth 10, 190–200. https://doi.org/10.1007/s10393-013-0834-6. Robert, J., Abramowitz, L., Gantress, J., Morales, H.D., 2007. Xenopus laevis: a possible vector of Ranavirus infection? J. Wildl. Dis. 43, 645–652. https://doi.org/10.7589/ 0090-3558-43.4.645. Robert, J., Morales, H., Buck, W., Cohen, N., Marr, S., Gantress, J., 2005. Adaptive immunity and histopathology in Frog virus 3-infected Xenopus. Virology 332, 667–675. https://doi.org/10.1016/j.virol.2004.12.012. Sample, R., Bryan, L., Long, S., Majji, S., Hoskins, G., Sinning, A., Olivier, J., Chinchar, V.G., 2007. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II. Virology 358, 311–320. https://doi.org/10.1016/j.virol.2006.07.009. Schmitz, A., Riesner, D., 2006. Purification of nucleic acids by selective precipitation with polyethylene glycol 6000. Analytical Biochemistry 354, 311–313. https://doi.org/10. 1016/j.ab.2006.03.014. Schloegel, L.M., Ferreira, C.M., James, T.Y., Hipolito, M., Longcore, J.E., Hyatt, A.D., Yabsley, M., Martins, A.M.C.R.P.F., Mazzoni, R., Davies, A.J., Daszak, P., 2010. The North American bullfrog as a reservoir for the spread of Batrachochytrium dendrobatidis in Brazil. Anim. Conserv. 13, 53–61. https://doi.org/10.1111/j.1469-1795. 2009.00307.x. Waltzek, T., Miller, D., Gray, M., Drecktrah, B., Briggler, J., MacConnell, B., Hudson, C., Hopper, L., Friary, J., Yun, S., Malm, K., Weber, E., Hedrick, R., 2014. New disease records for hatchery-reared sturgeon. I. Expansion of Frog virus 3 host range into Scaphirhynchus albus. DAO (Dis. Aquat. Org.) 111, 219–227. https://doi.org/10. 3354/dao02761. Wendel, E.S., Yaparla, A., Koubourli, D.V., Grayfer, L., 2017. Amphibian (Xenopus laevis) tadpoles and adult frogs mount distinct interferon responses to the Frog virus 3 ranavirus. Virology 503, 12–20. https://doi.org/10.1016/j.virol.2017.01.001. Wheelwright, N.T., Gray, M.J., Hill, R.D., Miller, D.L., 2014. Sudden mass die-off of a large population of wood frog (Lithobates sylvaticus) tadpoles in Maine, USA, likely due to ranavirus. Herpetol. Rev. 45, 71–104. Whittington, R.J., Becker, J.A., Dennis, M.M., 2010. Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J. Fish Dis. 33, 95–122. https://doi.org/ 10.1111/j.1365-2761.2009.01110.x.
Declaration of competing interest Cinthia Rodrigues Oliveira, Sthefany Rosa Alfaia, Fernanda Lie Ikari, Loiane Sampaio Tavares, Ricardo Luiz Moro de Sousa, Ricardo Harakava, Claudia Maris Ferreira. Acknowledgments We thank Fundação de Amparo à Pesquisa Científica no Estado de São Paulo (FAPESP) for financial support (Process No. 2015/24590-7) and Mr. Igor Dias for editing the supplementary material. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.734575. References Alencar, A.L.F., 2016. Isolamento e caracterização de estirpe de Frog virus 3-símile detectada em rãs-touro gigante (Lithobates catesbeianus) no Estado de São Paulo. University of São Paulo (USP), São Paulo, SP, Brazil MSc dissertation. Altherr, S., Goyenechea, A., Schubert, D.J., 2011. Canapés to Extinction the International Trade in Frog's Legs and its Ecological Impact. Pro Wildlife, Defenders Wildl Anim Welf Inst, Munich (Germany), Washington, DC A Rep by. Behncke, H., Stöhr, A.C., Heckers, K.O., Ball, I., Marschang, R.E., 2013. Mass-mortality in green striped tree dragons (Japalura splendida) associated with multiple viral infections. Vet. Rec. 173, 248. https://doi.org/10.1136/vr.101545. Brand, M.D., Hill, R.D., Brenes, R., Chaney, J.C., Wilkes, R.P., Grayfer, L., Miller, D.L., Gray, M.J., 2016. Water temperature affects susceptibility to ranavirus. EcoHealth 13, 350–359. https://doi.org/10.1007/s10393-016-1120-1. Brunner, J.L., Richards, K., Collins, J.P., 2005. Dose and host characteristics influence virulence of ranavirus infections. Oecologia 144, 399–406. Claytor, S.C., Subramaniam, K., Landrau-Giovannetti, N., Chinchar, V.G., Gray, M.J., Miller, D.L., Mavian, C., Salemi, M., Wisely, S., Waltzek, T.B., 2017. Ranavirus phylogenomics: signatures of recombination and inversions among bullfrog ranaculture isolates. Virology 511, 330–343. Chinchar, V.G., Hick, P., Ince, I.A., Jancovich, J.K., Marschang, R., Qin, Q., Subramaniam, K., Waltzek, T.B., Whittington, R., Williams, T., Zhang, Q., ICTV, 2017. Report Consortium, ICTV virus taxonomy profiles: Iridoviridae. J. Gen. Virol. 98, 890–891. https://doi.org/10.1099/jgv.0.000818. Crump, M.L., 1983. Opportunistic cannibalism by Amphibian larvae in temporary aquatic environments. Am. Nat. 121, 281–289. Daszak, P., Berger, L., Cunningham, A.A., Hyatt, A.D., Green, D.E., Speare, R., 1999. Emerging infectious diseases and amphibian population declines. Emerging Infectious Diseases journal 5, 735–748. https://doi.org/10.3201/eid0506.990601. Dias, D.C., Stéfani, M.V. De, Ferreira, C.M., França, F.M., Ranzani-Paiva, M.J.T., Santos, A.A., 2009. Haematologic and immunologic parameters of bullfrogs, Lithobates catesbeianus , fed probiotics. Aquactic Research 41, 1064–1071. https://doi.org/10. 1111/j.1365-2109.2009.02390.x. Duffus, A.L.J., Waltzek, T.B., Stöhr, A.C., Allender, M.C., Gotesman, M., Whittington, R.J., Hick, P., Hines, M.K., Marschang, R.E., 2015. Distribution and host range of ranaviruses. In: Ranaviruses. Springer International Publishing, Cham, pp. 9–57. FAO, 2015. FAO yearbook of fishery and aquaculture statistics. September 2017, Retrieved from. http://www.fao.org/fishery/statistics/yearbook/en. Gray, M.J., Chinchar, V.G., 2015. Ranaviruses : Lethal Pathogens of Ectothermic Vertebrates. Springer International Publishing.
5
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Detection and molecular characterization of Frog virus 3 in bullfrogs from frog farms in Brazil Cinthia Rodrigues Oliveiraa, Sthefany Rosa Alfaiaa, Fernanda Lie Ikaria, Loiane Sampaio Tavaresb, Ricardo Luiz Moro de Sousab, Ricardo Harakavac, Claudia Maris Ferreiraa,∗ a
Fisheries Institute, APTA, SAA, São Paulo, SP, 05001-900, Brazil University of São Paulo, USP, FZEA, Pirassununga, SP, 13635-900, Brazil c Biological Institute, APTA, SAA, São Paulo, SP, 04014-900, Brazil b
A R T I C LE I N FO
A B S T R A C T
Keywords: FV3 Lithobates catesbeianus Anurans Rana catesbeiana
The objective of this study was to perform the molecular diagnosis of ranavirus Frog virus 3 (FV3) in bullfrogs (Lithobates catesbeianus) obtained from frog farms in the central-southern region of Brazil. From each frog farm, we collected adult animals with a mean weight of 120 g ± 8.0 and tadpoles with a mean weight of 7 g ± 1.2, totaling 235 animals. For the diagnosis, liver, kidney and spleen samples were collected from the animals and subjected to DNA extraction and conventional PCR. Positive samples were detected on one farm in the state of São Paulo. To confirm the results, we performed nucleotide sequencing of the MCP gene and phylogenetic analysis. The results revealed that FV3 strains are present in Brazil with their own phylogenetic profile, and that these strains differ from those affecting amphibians and reptiles described so far in other countries. Further studies are necessary to better understand the circulation of this pathogen in aquatic systems and the dynamics of the dissemination of this disease in Brazil.
1. Introduction Frog farming is an internationally profitable enterprise and the habit of eating frog meat is very important for subsistence in various communities around the world. The main species grown in commercial cultivation is the bullfrog (Lithobates catesbeianus). The custom of eating frog legs transcends borders and is shared by almost every continent by virtue of the taste and nutritional benefits of the meat (Altherr et al., 2011; Moreira et al., 2013). In Brazil, frog farming is a well-established activity since the 1980s, but there has been a decline in production in recent years. In 2006, 600 tons of meat were produced, and in 2012, production was only at 200 tons (FAO, 2015). Despite the good performance of the business, some producers face difficulties in maintaining health on the farms (Dias et al., 2009). Aquatic pathogens spread rapidly and the confinement of many animals during transport or in the commercial cultivation promote this process (Miocevic et al., 1993; Pavlin et al., 2009). The disappearance of amphibians is due to the decrease, fragmentation and pollution of habitats, but also two emerging diseases that have been causing substantial mortality in populations: chytridiomycosis and ranaviruses, both of which require mandatory reporting (OIE, 2017). In ranaculture facilities, ranavirus has been ∗
causing outbreaks in recent years. It has already been diagnosed on Brazilian frog farms, but without evidence until the moment of reaching the outside environment (Mazzoni et al., 2009; Neves et al., 2016). In addition, frequent bidirectional flow of specimens through escape, release of captives and entry of wild animals into farms poses a risk to captive frogs and to local fauna, since ranaviruses are not a pathogen restricted to amphibians and may affect other groups of ectotherms (Gray and Chinchar, 2015; Neves et al., 2016). In South America, there have been few studies on the virus, and the circulating genotypic profiles, distribution and severity of existing strains and their impact on the breeding of aquatic organisms as well are still unknown. Ranaviruses have been diagnosed on five continents, affecting approximately 200 species of ectotherms and the type species of the genus, known as Frog virus 3 (FV3) (Chinchar et al., 2017), is highly lethal to anurans (Duffus et al., 2015). In most cases, infection is systemic, with necrotic areas, and mortality is as high as 90% in the affected population (Behncke et al., 2013). Dissemination is facilitated by inherent behaviors of amphibians such as necrophagy and cannibalism (Crump, 1983), as well as by contact with infected individuals or contaminated water (Miller et al., 2011). The infectious process involves genetics, environmental factors (pollution, temperature and other stressors) and inherent biological characteristics of the host (age,
Corresponding author. Fisheries Institute, APTA, SAA, Av. Francisco Matarazzo, 455, 05001-900, São Paulo, SP, Brazil. E-mail address: [email protected] (C.M. Ferreira).
https://doi.org/10.1016/j.aquaculture.2019.734575 Received 27 March 2019; Received in revised form 20 September 2019; Accepted 4 October 2019 Available online 31 October 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Please cite this article as: Cinthia Rodrigues Oliveira, et al., Aquaculture, https://doi.org/10.1016/j.aquaculture.2019.734575
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
life stage, physiological aspects) that directly affect immune competence (Brunner et al., 2005; Brand et al., 2016; Wendel et al., 2017). The genus Ranavirus (family Iridoviridae, subfamily Alphairidovirinae) is formed by DNA viruses that have as a common characteristic of the taxa the presence of the structural gene of the main capsid protein (MCP), which is highly conserved (Chinchar et al., 2017). This gene is used as a molecular diagnostic tool for analyzing the disease via PCR (Sample et al., 2007). Ranaviruses caused by FV3 is usually severe in tadpoles and newly metamorphosed individuals, and occasionally, more virulent strains, high infectious doses, genetic factors of the host population, co-infection with other biological agents and the presence of abiotic and anthropogenic environmental stressors decimate populations independently of the stage of life (Daszak et al., 1999; Brunner et al., 2005; Landsberg et al., 2013; Love et al., 2016). The objective of the present study was to determine the presence of Frog virus 3 (FV3) on frog farms in the central-southern region of Brazil, and to determine the phylogenetic relationship of the strains detected comparing them with other species of ranavirus already described, based on the nucleotide sequence of the MCP gene.
Table 1 Properties of the primers and their purpose for detection and sequencing of FV3. Primer
Direction
Sequence (5′- 3′)
Product
Function
MCP1
Forward Reverse Forward Reverse Forward Reverse
AACCCGGCTTTCGGGCAGCA CGGGGCGGGGTTGATGAGAT ATGACCGTCGCCCTCATCAC CCATCGAGCCGTTCATGATG ATGTCTTCTGTAACTGGTTCA TTACAAGATTGGGAATCCCAT
321 bpa
Detection
MCP2 MCPRV
625 bpa 1392 bp
Detection b,c
Sequencing
a Marsh et al. (2002); b - (Correa, personal communication 2017† († Thais Camilo Correa: [email protected]); c- Mazzoni et al. (2009).
previously approved by the Committee of Ethics in Animal Experimentation of the Fisheries Institute under No. 04/2016. The spleen, liver and kidneys of the animals were removed, cut into 0.1 g portions and frozen at -20oC. To avoid cross-contamination between the specimens and samples collected, the utensils were cleansed with Virkon™ and flamed for 15 s. The tissue samples were submitted to molecular diagnosis in the Zootechnical Hygiene Laboratory of the Faculty of Animal Science and Food Engineering (FZEA) of the University of São Paulo, in Pirassununga, SP.
2. Material and methods 2.1. Collection of samples
2.2. DNA extraction and PCR Animals were collected from eight different commercial frog farms in the central-southern region of Brazil in the spring-summer period of 2016–2017, namely Pindamonhangaba/São Paulo (C1), Juquitiba/São Paulo (C2), Jaboticabal/São Paulo (C3), Ibaté/São Paulo (C4), Matão/ São Paulo (C5) Tapiratiba/São Paulo (C6), Imbé/Rio Grande do Sul (C7) and Paulo Lopes/Santa Catarina (C8) (Fig. 1). All the farms were visited once excepted C6 location was sampled twice. These farms were chosen according the time of commercial establishment and mortality reports in the last 3 years. Three farms (C1, C3 and C4) provided 20 adults and 20 tadpoles, while farm C2 provided 10 adults and 10 tadpoles, C5 20 tadpoles, C6 23 adults and 12 tadpoles, and C7 and C8 only 20 adult frogs, totaling 235 specimens. The adults had a mean weight of 120 ± 8 g and the mean weight of the tadpoles was 7 ± 1.2 g. The adults of each farm were transported live to the laboratory of the Fisheries Institute in São Paulo, in isothermal containers with a 5cm layer of water. The tadpoles of each farm were kept in a 16-L box container with aerated water. In the laboratory, the adults were acclimated for 24 h in a 100-L polyethylene box with dechlorinated water with a depth of 5 cm. The tadpoles were acclimated in 12-L aquariums, with dechlorinated water with constant aeration. The next day, the specimens were anesthetized with ice and benzocaine hydrochloride (4:1) and euthanized by cutting the cervical spine. This procedure was
Tissue samples of different organs (spleen, liver and kidney) of each animal were pooled, and DNA was extracted using the PROMEGA™ SV Wizard kit, following the manufacturer's recommendations, except for the elution of the DNA being reduced to a volume of 100 μL. PCR was performed with different primer pairs according to the purpose: detection or nucleotide sequencing (Table 1). For detection of FV3, all samples were subjected to PCR assays with two primer pairs, MCP1 and MCP2 (Marsh et al., 2002), for partial amplification of the MCP gene according to the following thermocycling protocol: 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min, and a final extension of 72 °C for 5 min. To obtain the fragment of the MCP gene to be sequenced, the primer pairs MCPRV and MCPRV2 were used along with the following thermocycling protocol: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 58 °C per 30 s and 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products were subjected to 1.5% agarose gel electrophoresis in Tris-acetate/EDTA buffer (TAE 1X) and observed under UV light using the L-Pix ST photodocumentation system and L-Pix Image software (Loccus Biotechnology, Brazil). The positive control used was an isolated strain of FV3 in BF2 cultured cells (bluegill fry ATCC CCL-91), from an outbreak that occurred in the city of Matão, SP, Brazil (Alencar, 2016). Fig. 1. Geopolitical map of Brazil. Noted are the states of the South region and São Paulo State, where the collections were carried out: Pindamonhangaba/São Paulo (C1), Juquitiba/São Paulo (C2), Jaboticabal/São Paulo (C3), Ibaté/São Paulo (C4), Matão/ São Paulo (C5), Tapiratiba/São Paulo (C6), Imbé/Rio Grande do Sul (C7) and Paulo Lopes/Santa Catarina (C8). Source: pixabay. com - adapted.
2
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
Table 2 Name of viral isolates and acronym, host class, common host name, scientific name of the host, GenBank code and corresponding country where the isolate was detected. Ranavirus (initials)
Host of isolate
Popular name (host)
Scientific name (host)
GenBank
Country
Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog Frog
(FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3) (FV3)
Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian Amphibian
Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Bullfrog Giant toad Giant Toad Wood frog Wood frog Wood frog, Spring peepers, Red-spotted newts, Tree frogs
KT154965 KT154964 KT154966 DQ897669 MG573200 MG573201 EF101698.1 EF175670.1 EF101697.1 DQ906049.1 DQ906048.1 MH247258.1 MK204478.1 MK204477.1 MK204476.1 MK204475.1 AF157649.1 AF157648.1 GQ144408.1 GQ144407.1 FJ601916.1
Brazil Brazil Brazil Brazil Brazil Brazil USA USA USA USA USA Mexico Mexico Mexico Mexico Mexico Venezuela Venezuela Canada Canada USA
Frog virus 3 (FV3) Frog virus 3 (FV3) Frog virus 3 (FV3)
Amphibian Amphibian Amphibian
Spotted salamander Marbled salamandar Spotted salamander
Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Lithobates catesbeianus Bufo marinus Bufo marinus Rana sylvatica Rana sylvatica Rana sylvatica, Pseudacris crucifer Notophthalmus viridescens, Hyla versicolor Ambystoma maculatum Ambystoma opacum Ambystoma maculatum
JQ361076.1 JQ361075.1 JQ771299.1
USA USA USA
virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus virus
3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3
50% of specimens were also PCR-positive (Table 3). The results were similar for both primers used (MCP1 and MCP2). These animals exhibited the following symptoms: repetitive circular movements, loss of appetite, prostration, swollen belly, ascites, prolapse of the bladder and loss of movement in the hind legs.
2.3. Nucleotide sequencing and phylogenetic reconstruction PCR products obtained with MCPRV2/MCPRV primers (1392 bp) were purified by PEG 6000 precipitation (Schmitz and Riesner, 2006) and sequenced by the Sanger method in an Applied Biosystems instrument (model 3500 xL). The sequences obtained were compared to those of species of the genus Ranavirus deposited in GenBank (Table 2) using BLAST software. The sequences were aligned by ClustalW in the BioEdit program. Phylogenetic tree construction by maximum likelihood was performed using IQ-TREE software with the evolutionary model of TPM2+G4 substitution and bootstrapping with 1000 replicates.
3.1. Phylogenetic analysis Nucleotide sequences obtained from samples of the C6 farm showed more than 99% identity with sequences of FV3 already found in Brazil and more than 94% with ranaviruses isolated from different species of amphibians, fish and reptiles in several countries. Sequences selected for the phylogenetic tree are listed in Table 2 and ClustalW alignments between sequences are presented in supplementary material Fig. S1. In the phylogenetic analysis, the sequences of frog farm C6 in Tapiratiba/ São Paulo (GenBank accession Nos. MG573200 and MG573201) clustered in the same clade as other Brazilian strains and separated from the clades formed by strains from other countries (Fig. 2).
3. Results PCR positive samples were detected on the frog farm of Tapiratiba, SP (C6). In the first sampling, during November 2016, five adults were investigated and 100% were PCR-positive. In the second sampling, during March 2017, others 18 adults and 23 tadpoles were sampled and
Table 3 Prevalence (%) of Frog virus 3 (FV3) on frog farms in the central-southern region of Brazil during spring-summer period of 2016–2017. (Results with MCP2). Sample site
Number of animals collected
FV3 PCR
Prevalence
95% confidence interval lower-upper
Pindamonhangaba/São Paulo (C1) (sampled in September 2016) Juquitiba/São Paulo (C2) (sampled in November 2016) Jaboticabal/São Paulo (C3) (sampled in May 2017) Ibaté/São Paulo (C4) (sampled in May 2017) Matão/São Paulo (C5) (sampled in May 2017) Tapiratiba/São Paulo (C6) (sampled in November 2016) and March 2017) Imbé/Rio Grande do Sul (C7) (sampled March 2017) Paulo Lopes/Santa Catarina (C8) (sampled March 2017) Total
20 20 10 10 20 20 20 20 20
– – – – – – – – –
– – – – – – – – –
– – – – – – – – –
23 adults 12 tadpoles 20 adults
+ + –
52.2% 50.0% –
0.19 - 0.55 0.25 - 0.72 –
20 adults
–
–
–
7.7%
0.05 - 0.12
tadpoles adults tadpoles adults tadpoles adults tadpoles adults tadpoles
235 frogs
3
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
Fig. 2. Phylogenetic analysis by maximum likelihood with the sequences found in Frog farm C6 in Tapiratiba/São Paulo (FV3_MG573200 and FV3_MG573201). FV3 isolates were obtained from GenBank. Highlighted is the clade of the Brazilian ranavirus sequences detected in the present study. The numbers on the nodes indicate the bootstrap values.
4. Discussion
used in frog farms. When crowded, continuous contact between infected and healthy individuals facilitates the spread of diseases (Haddad et al., 2002; Mazzoni et al., 2009; Reeve et al., 2013; Gray and Chinchar, 2015). It is interesting that in C6, the animals died gradually over four consecutive weeks, with repetitive circular movements, loss of appetite, prostration, swollen belly, ascites, prolapse of the bladder and loss of movement in the hind legs followed by swelling. All these symptoms caused by FV3-like have already been associated with this disease (Robert et al., 2005; Mazzoni et al., 2009; Miaud et al., 2016; Miller et al., 2011), with the exception of prolapse of the bladder (see video in supplementary material). It should be emphasized that the C5 ranaculture was sampled in the present study and the animals are currently healthy. In communication with the producer, we were informed that since the 2012 outbreak, all specimens were sacrificed by incineration, and new animals were acquired and allocated to the facility, which underwent prior disinfection with heat and sodium hypochlorite. Given the success in the decontamination process, the C6 ranaculture did the same with its animals to prevent the disease from spreading. These measures are recommended and necessary because, once circulating in the environment, the virus can spread by hiding in reservoir species and causing mortality outbreaks in other organisms (Waltzek et al., 2014). Preventive testing for ranaviruses and other pathogens is necessary to ensure the health of commercial frog breeding by uncovering the presence of asymptomatic infections that are a potential silent threat (Robert et al., 2007; Whittington et al., 2010). Supplementary video related to this article can be found at https:// doi.org/10.1016/j.aquaculture.2019.734575. The ranavirus sequences found in the present study were similar to those of FV3 and were grouped in the same clade as the other strains already found in Brazil. This finding demonstrated that the virus has already established itself in the country and may have undergone minor genomic changes, probably due to different environmental adaptations. A total of three hundred pairs of bullfrogs were introduced to Brazil for commercial farming in 1935, where they were imported from Canada. Officially, only a second importation of 20 pairs from North America (Michigan, USA) occurred in 1970 (Schloegel et al., 2010). On the other
FV3 outbreaks can trigger high mortality for wild and captive anurans, with the number of deaths in the population being almost 100% within a few days (Wheelwright et al., 2014). Reports of ranaviruses epizootics have increased in recent years (Claytor et al., 2017; Duffus et al., 2015; Waltzek et al., 2014). New species of the genus Ranavirus have been recorded and outbreaks have resulted in damages to frog farms around the world. For example a ranavirus strain infected the frog farms of seven Thai provinces in a single year, causing mortality in Rana tigrina (Kanchanakhan, 1998). In North America, a frog farm was affected by a ranavirus similar to CMTV in 1998, and 8 years later, the same farm suffered a second ranavirus infection by a more virulent strain than the previous one. After isolation and sequencing of the virus, it was found to be the first reported case of ranavirus chimerism, with FV3 and CMTV parental strains (Claytor et al., 2017). In Brazil, ranavirus has been detected by molecular techniques and electron microscopy since the beginning of the 2000s, but no official notification to the legal authorities has been made so far (Hipolito et al., 2003; Mazzoni et al., 2009; Neves et al., 2016; Alencar, 2016). In this study, we investigated the presence of FV3 on frog farms in the centralsouthern region of Brazil. Of the eight farms investigated, FV3 was found on one (C6 - Tapiratiba/SP). This population was sampled twice in different periods: spring and summer. During the anamnesis with the frog farmer, we were informed that C6 ranaculture acquired breeding animals from the C5 farm in 2014, prior to the low-mortality outbreak reported by Alencar (2016). However, no abnormalities were detected in the C6 stock until December 2016, when a dam nearby collapsed and flooded the facility with poor-quality water contaminated with animal feces and organic matter. Days later, after such stressor event, adult frog mortality skyrocketed, resulting in the death of 90% of the population. Ranaviruses cause variable consequences sometimes associated with stressors, leading to greater fragility of hosts, since hormones released in stress situations may attenuate the immune response. Captive hosts are exposed to a variety of stress factors from captivity. Among the stressors in amphibians, we can list temperature extremes, low-quality water, the metamorphosis process of amphibians and the high density 4
Aquaculture xxx (xxxx) xxxx
C.R. Oliveira, et al.
hand, amphibians have been introduced over the years, destined for the pet market. Extensive studies are needed to determine if there are different strains of FV3 with different virulence genes circulating in Brazil. Future studies aimed at addressing such concerns would also be interesting to elucidate the history of ranaviruses in Brazil. For more indepth analyses, the sequencing of the complete genome of these strains is recommended. FV3 was detected on a Brazilian commercial frog farm, and the disease may be spreading throughout the country. This is the first official notification of ranavirus reported to the Brazilian Government and, consequently, to OIE. Sequencing of the MCP gene indicates that these Brazilian strains differ from other strains worldwide, stressing the need for further studies to understand the circulation of this pathogen in aquatic systems and the dynamics of the dissemination of this disease in Brazil.
Haddad, J.J., Saadé, N.E., Safieh-Garabedian, B., 2002. Cytokines and neuro–immune–endocrine interactions: a role for the hypothalamic–pituitary–adrenal revolving axis. J. Neuroimmunol. 133, 1–19. Hipolito, M., Catroxo, M.H.B., Curi, N.A., Bach, E.E., 2003. Detecção ao microscópio eletrônico de transmissão de partículas virais semelhantes ao grupo Iridovírus em rãstouro (Rana catesbeiana Shaw, 1802) criadas comercialmente. Primeira observação no Brasil. vol. 70 Arquivos do Instituto Biológico (CD-R). Kanchanakhan, S., 1998. An ulcerative disease of the cultured tiger frog, Rana tigrina, in Thailand: virological examination. Aquatic Animal Health Research Institute Newsletter 7, 1–2. Landsberg, J., Kiryu, Y., Tabuchi, M., Waltzek, T., Enge, K., Reintjes-Tolen, S., Preston, A., Pessier, A., 2013. Co-infection by alveolate parasites and Frog virus 3-like ranavirus during an amphibian larval mortality event in Florida, USA. DAO (Dis. Aquat. Org.) 105, 89–99. https://doi.org/10.3354/dao02625. Love, C., Winzeler, M., Beasley, R., Scott, D., Nunziata, S., Lance, S., 2016. Patterns of amphibian infection prevalence across wetlands on the Savannah River Site, South Carolina, USA. DAO (Dis. Aquat. Org.) 121, 1–14. https://doi.org/10.3354/ dao03039. Marsh, I.B., Whittington, R.J., O'Rourke, B., Hyatt, A.D., Chisholm, O., 2002. Rapid 271 differentiation of Australian, European and American ranaviruses based on 272 variation in major capsid protein gene sequence. Mol. Cell. Probes 16, 137–151. https://doi.org/10.1006/mcpr.2001.0400. Mazzoni, R., Mesquita, A.J., Fleury, L.F.F., Brito, W.M.E.D., Nunes, I.A., Robert, J., Morales, H., Coelho, A.S.G., Barthasson, D.L., Galli, L., Catroxo, M.H.B., 2009. Mass mortality associated with a Frog virus 3-like Ranavirus infection in farmed tadpoles Rana catesbeiana from Brazil. DAO (Dis. Aquat. Org.) 86, 181–191. https://doi.org/ 10.3354/dao02096. Miaud, C., Pozet, F., Gaudin, N.C.G., Martel, A., Pasmans, F., Labrut, S., 2016. Ranavirus causes mass die-offs of alpine amphibians in the southwestern Alps, France. J. Wildl. Dis. 52, 242–252. Miller, D., Gray, M., Storfer, A., 2011. Ecopathology of ranaviruses infecting Amphibians. Viruses 3, 2351–2373. https://doi.org/10.3390/v3112351. Miocevic, I., Smith, J., Owens, L.S.R., 1993. Ultraviolet sterilisation of model viruses important to finfish aquaculture in Australia. Aust. Vet. J. 70, 25–27. Moreira, C.R., Henriques, M.B., Ferreira, C.M., 2013. Frog Farms as Proposed in Agribusiness Aquaculture: Economic Viability Based in Feed Conversion, vol. 39. Boletim do Instituto de Pesca, pp. 389–399. Neves, P.V., Catroxo, M.H., Hipolito, M., Rodrigues, C.O., Ferreira, C.M., 2016. Use of Polyclonal Antibodies, Electron Microscopy and Histopathology to Detect Iridoviruslike Particles in Bullfrogs, vol. 42. Boletim do Instituto de Pesca, pp. 523–531. OIE, 2017. The organization for animal health 2017. Infection with ranavirus. September 2017, Retrieved from. http://www.oie.int/fileadmin/Home/eng/Health_standards/ aahm/current/chapitre_ranavirus.pdf. Pavlin, B.I., Schloegel, L.M., Daszak, P., 2009. Risk of importing zoonotic diseases through wildlife trade, United States. Emerg. Infect. Dis. 15 (11), 1721–1726. https://doi.org/10.3201/eid1511.090467. Reeve, B.C., Crespi, E.J., Whipps, C.M., Brunner, J.L., 2013. Natural stressors and ranavirus susceptibility in larval wood frogs (Rana sylvatica). EcoHealth 10, 190–200. https://doi.org/10.1007/s10393-013-0834-6. Robert, J., Abramowitz, L., Gantress, J., Morales, H.D., 2007. Xenopus laevis: a possible vector of Ranavirus infection? J. Wildl. Dis. 43, 645–652. https://doi.org/10.7589/ 0090-3558-43.4.645. Robert, J., Morales, H., Buck, W., Cohen, N., Marr, S., Gantress, J., 2005. Adaptive immunity and histopathology in Frog virus 3-infected Xenopus. Virology 332, 667–675. https://doi.org/10.1016/j.virol.2004.12.012. Sample, R., Bryan, L., Long, S., Majji, S., Hoskins, G., Sinning, A., Olivier, J., Chinchar, V.G., 2007. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II. Virology 358, 311–320. https://doi.org/10.1016/j.virol.2006.07.009. Schmitz, A., Riesner, D., 2006. Purification of nucleic acids by selective precipitation with polyethylene glycol 6000. Analytical Biochemistry 354, 311–313. https://doi.org/10. 1016/j.ab.2006.03.014. Schloegel, L.M., Ferreira, C.M., James, T.Y., Hipolito, M., Longcore, J.E., Hyatt, A.D., Yabsley, M., Martins, A.M.C.R.P.F., Mazzoni, R., Davies, A.J., Daszak, P., 2010. The North American bullfrog as a reservoir for the spread of Batrachochytrium dendrobatidis in Brazil. Anim. Conserv. 13, 53–61. https://doi.org/10.1111/j.1469-1795. 2009.00307.x. Waltzek, T., Miller, D., Gray, M., Drecktrah, B., Briggler, J., MacConnell, B., Hudson, C., Hopper, L., Friary, J., Yun, S., Malm, K., Weber, E., Hedrick, R., 2014. New disease records for hatchery-reared sturgeon. I. Expansion of Frog virus 3 host range into Scaphirhynchus albus. DAO (Dis. Aquat. Org.) 111, 219–227. https://doi.org/10. 3354/dao02761. Wendel, E.S., Yaparla, A., Koubourli, D.V., Grayfer, L., 2017. Amphibian (Xenopus laevis) tadpoles and adult frogs mount distinct interferon responses to the Frog virus 3 ranavirus. Virology 503, 12–20. https://doi.org/10.1016/j.virol.2017.01.001. Wheelwright, N.T., Gray, M.J., Hill, R.D., Miller, D.L., 2014. Sudden mass die-off of a large population of wood frog (Lithobates sylvaticus) tadpoles in Maine, USA, likely due to ranavirus. Herpetol. Rev. 45, 71–104. Whittington, R.J., Becker, J.A., Dennis, M.M., 2010. Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J. Fish Dis. 33, 95–122. https://doi.org/ 10.1111/j.1365-2761.2009.01110.x.
Declaration of competing interest Cinthia Rodrigues Oliveira, Sthefany Rosa Alfaia, Fernanda Lie Ikari, Loiane Sampaio Tavares, Ricardo Luiz Moro de Sousa, Ricardo Harakava, Claudia Maris Ferreira. Acknowledgments We thank Fundação de Amparo à Pesquisa Científica no Estado de São Paulo (FAPESP) for financial support (Process No. 2015/24590-7) and Mr. Igor Dias for editing the supplementary material. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.734575. References Alencar, A.L.F., 2016. Isolamento e caracterização de estirpe de Frog virus 3-símile detectada em rãs-touro gigante (Lithobates catesbeianus) no Estado de São Paulo. University of São Paulo (USP), São Paulo, SP, Brazil MSc dissertation. Altherr, S., Goyenechea, A., Schubert, D.J., 2011. Canapés to Extinction the International Trade in Frog's Legs and its Ecological Impact. Pro Wildlife, Defenders Wildl Anim Welf Inst, Munich (Germany), Washington, DC A Rep by. Behncke, H., Stöhr, A.C., Heckers, K.O., Ball, I., Marschang, R.E., 2013. Mass-mortality in green striped tree dragons (Japalura splendida) associated with multiple viral infections. Vet. Rec. 173, 248. https://doi.org/10.1136/vr.101545. Brand, M.D., Hill, R.D., Brenes, R., Chaney, J.C., Wilkes, R.P., Grayfer, L., Miller, D.L., Gray, M.J., 2016. Water temperature affects susceptibility to ranavirus. EcoHealth 13, 350–359. https://doi.org/10.1007/s10393-016-1120-1. Brunner, J.L., Richards, K., Collins, J.P., 2005. Dose and host characteristics influence virulence of ranavirus infections. Oecologia 144, 399–406. Claytor, S.C., Subramaniam, K., Landrau-Giovannetti, N., Chinchar, V.G., Gray, M.J., Miller, D.L., Mavian, C., Salemi, M., Wisely, S., Waltzek, T.B., 2017. Ranavirus phylogenomics: signatures of recombination and inversions among bullfrog ranaculture isolates. Virology 511, 330–343. Chinchar, V.G., Hick, P., Ince, I.A., Jancovich, J.K., Marschang, R., Qin, Q., Subramaniam, K., Waltzek, T.B., Whittington, R., Williams, T., Zhang, Q., ICTV, 2017. Report Consortium, ICTV virus taxonomy profiles: Iridoviridae. J. Gen. Virol. 98, 890–891. https://doi.org/10.1099/jgv.0.000818. Crump, M.L., 1983. Opportunistic cannibalism by Amphibian larvae in temporary aquatic environments. Am. Nat. 121, 281–289. Daszak, P., Berger, L., Cunningham, A.A., Hyatt, A.D., Green, D.E., Speare, R., 1999. Emerging infectious diseases and amphibian population declines. Emerging Infectious Diseases journal 5, 735–748. https://doi.org/10.3201/eid0506.990601. Dias, D.C., Stéfani, M.V. De, Ferreira, C.M., França, F.M., Ranzani-Paiva, M.J.T., Santos, A.A., 2009. Haematologic and immunologic parameters of bullfrogs, Lithobates catesbeianus , fed probiotics. Aquactic Research 41, 1064–1071. https://doi.org/10. 1111/j.1365-2109.2009.02390.x. Duffus, A.L.J., Waltzek, T.B., Stöhr, A.C., Allender, M.C., Gotesman, M., Whittington, R.J., Hick, P., Hines, M.K., Marschang, R.E., 2015. Distribution and host range of ranaviruses. In: Ranaviruses. Springer International Publishing, Cham, pp. 9–57. FAO, 2015. FAO yearbook of fishery and aquaculture statistics. September 2017, Retrieved from. http://www.fao.org/fishery/statistics/yearbook/en. Gray, M.J., Chinchar, V.G., 2015. Ranaviruses : Lethal Pathogens of Ectothermic Vertebrates. Springer International Publishing.
5