- Email: [email protected]
Detection and quantitation of Aspergillus fumigatus in pure culture using polymerase chain reaction
Molecular and Cellular Probes (2001) 15, 81–88 doi:10.1006/mcpr.2000.0343, available online at http://www.idealibrary.com on
Detection and quantitation of Aspergillus fumigatus in pure culture using polymerase chain reaction P. Cruz-Perez, M. P. Buttner and L. D. Stetzenbach∗ Harry Reid Center for Environmental Studies, University of Nevada, Las Vegas 4505 S. Maryland Parkway, Las Vegas, NV 89154-4009, USA (Received 25 October 2000, Accepted 19 December 2000) Research was conducted with laboratory cultures to establish a protocol for the rapid detection and quantitation of the thermophilic fungus, Aspergillus fumigatus, using genetic amplification. Oligonucleotide primers and a fluorescently labelled probe were designed for use with quantitative polymerase chain reaction (QPCR). Primers and probe were tested for selectivity, specificity and sensitivity of detection of the target organism using a fluorogenic nuclease assay and a sequence detector. The DNA extraction protocol consisted of enzymatic treatment and boiling of fungal spore suspensions followed by DNA concentration and purification. The primer set developed was specific for A. fumigatus and had a sensitivity of <20 template copies. These primers amplified all A. fumigatus isolates tested and did not amplify DNA extracted from other Aspergillus species or 15 other fungal genera. However, one A. fumigatus sample was initially negative after PCR amplification. Incorporation of an internal positive control in the PCR reaction demonstrated the presence of inhibitors in this and other samples. PCR inhibitors were removed by dilution or further purification of the DNA samples. This research resulted in a QPCR method for detection and quantitation of A. fumigatus and demonstrated the presence of PCR inhibitors in several A. fumigatus isolates. 2001 Academic Press KEYWORDS: Aspergillus, PCR inhibitors, QPCR, TaqManTM.
INTRODUCTION Aspergillus fumigatus is a ubiquitous, thermophilic fungus that grows in damp environments. It is an opportunistic pathogen that affects cystic fibrosis patients and the immunocompromised.1,2 In addition, it is allergenic and has been implicated in several respiratory diseases.3 Inhalation of Aspergillus spores by susceptible individuals has been linked to the development of pulmonary disease.4,5 Girardin et al.6 refer to A. fumigatus as the most common airborne fungal pathogen, and Leenders et al.7 state that A. fumigatus is the predominant Aspergillus species involved in invasive infections. However, it is often
under-estimated in traditional culture analyses due to its specific growth temperature requirement and the expertise required in speciating members of the genus Aspergillus. Because numerous fungal spores exist in the air and on surfaces both indoors and outdoors, it is advantageous to accurately and rapidly detect organisms such as A. fumigatus in environmental samples. Due to the detection limitations associated with traditional culture analyses, molecular biology techniques can be utilized for the rapid and sensitive detection of target organisms in indoor environments. The research conducted in this study utilized an analytical method that has been demonstrated to rapidly and accurately detect airborne virus,8 bac-
∗ Author to whom all correspondence should be addressed at: 4505 S. Maryland Parkway, Las Vegas, NV, 89154-4009; USA. Tel: +1 702 895 1419; Fax: +1 702 895 2688; E-mail: [email protected]
0890–8508/01/020081+08 $35.00
2001 Academic Press
82
P. Cruz-Perez et al.
teria9,10 and, recently, fungi in indoor environments.5,7,11 This technique utilizes the polymerase chain reaction (PCR) to detect specific microorganisms by amplifying DNA sequences unique to the organism of interest. To use the PCR technique, sequence information must be identified for a specific target DNA segment. Once a unique DNA sequence has been identified, oligonucleotide primers are designed, synthesized, and then tested for sensitivity, specificity and selectivity. A fluorogenic nuclease assay in conjunction with a sequence detector (ABI PRISM 7700 Sequence Detection System, Applied Biosystems, Foster City, CA, USA) has recently been developed as a means to amplify and quantitate PCR products, eliminating the need for post-PCR manipulations for visualization of results.12 This assay uses a fluorescently labelled oligonucleotide probe that anneals between the primers of choice as the amplification reaction proceeds, allowing for the determination of starting copy number of target DNA. The TaqManTM assay that is integral to this quantitative technology has been validated previously by other researchers with DNA extracted from Listeria monocytogenes,13 Mycobacterium tuberculosis,14 and Salmonella.15 Due to its potential as a health hazard and the importance of a fast diagnosis, several investigators have published on the rapid detection of A. fumigatus in clinical samples using antigen assays16 and antibody production in response to these antigens.3 However, commercially available kits for the detection of Aspergillus sp. that utilize the latex agglutination principle have the disadvantage of low sensitivity, and enzyme-linked immunosorbent assays can produce false-positive results.16 More recently, researchers have utilized PCR as the detection mechanism for clinical or environmental samples but have targeted the Aspergillus genus rather than the species A. fumigatus.7,16–20 According to Verweij et al,16 the diagnostic value of many of the existing methods for the PCR detection of Aspergillus DNA cannot be established because of the limited number of controls and patients that were tested in those studies. Researchers have used post-PCR techniques such as denaturing gradient gel electrophoresis to differentiate A. fumigatus from Aspergillus niger,21 or single-strand conformational polymorphism for the differentiation of A. fumigatus from Aspergillus flavus and A. niger.22 Girardin et al.6 used DNA hybridization to detect A. fumigatus, and Bart-Delabesse et al.23 utilized microsatellites as PCR markers for differentiating A. fumigatus strains. Advances in the PCR detection of A. fumigatus have recently been reported with identification of the target organism based on analysis of the PCR products by gel electrophoresis.24 Here,
Table 1. Fungal isolates tested for PCR amplification using Aspergillus fumigatus primers and probe Organism
Source
Acremonium strictum Alternaria alternata Aspergillus flavus A. fumigatus A. fumigatus (14 isolates) A. glaucus A. nidulans A. nidulans A. niger A. niger A. parasiticus A. repens A. terreus A. versicolor Beauveria sp. Bipolaris sp. Chaetomium sp. Cladosporium herbarum Fusarium oxysporum Penicillium chrysogenum P. chrysogenum P. digitatum P. expansum P. frequentans Phoma sp. Rhizopus sp. Stachybotrys chartarum Trichoderma sp. Ustilago sp. Verticillium sp.
ATCC 10141 ATCC 6663 HRC/UNLV ATCC 36607 HRC/UNLV HRC/UNLV ATCC 10074 HRC/UNLV ATCC 10535 HRC/UNLV ATCC 15517 HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV ATCC 28987 ATCC 48112 ATCC 9480 Harvard HRC/UNLV ATCC 7861 HRC/UNLV HRC/UNLV HRC/UNLV ATCC 9182 HRC/UNLV HRC/UNLV HRC/UNLV
ATCC, American Type Culture Collection; HRC/UNLV, Harry Reid Center for Environmental Studies, University of Nevada-Las Vegas; Harvard, Harvard School of Public Health, Boston, MA, courtesy of Harriet Burge.
oligonucleotide primers and a probe were developed for the rapid detection and absolute quantitation of A. fumigatus in pure culture using quantitative PCR (QPCR).
MATERIALS AND METHODS Test organisms and culture media The fungus A. fumigatus served as the test organism for this study. Forty-three fungal isolates of interest, representing 15 genera, were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) or from laboratory stocks, and cultured in the laboratory (Table 1). Malt extract agar (MEA (pH 4·7), Difco Laboratories, Detroit, MI, USA) and potato dextrose agar (PDA (pH 5·6), Difco) were used for the culture of all fungal species. Aspergillus fumigatus
QPCR detection of Aspergillus fumigatus
isolates were incubated at 45°C for 2–3 days. All other fungal isolates were incubated at 23°C for 3–7 days.
Spore harvest Spores were harvested from pure cultures of A. fumigatus (ATCC 36607) to prepare standards of known concentration. Dry spore harvests were performed by inoculating at least four Petri dishes with A. fumigatus and incubating as described above. The dishes were inverted onto a sterile glass funnel and gently tapped to dislodge the spores into a sterile glass bottle. The spore harvest was stored dry at 4°C until ready for use.
83
DNA extraction and purification A boiling protocol developed for DNA extraction of bacterial endospores25 was used for the DNA extraction from A. fumigatus spores. This protocol consisted of treating the spore suspension with sodium dodecylsulfate (0·5% final concentration) and proteinase K (20 g/ml final concentration), followed by incubation at 50°C for 10 min and boiling for 15 min. The samples were chilled on ice for 2 min and bovine serum albumin was added to a final concentration of 0·05%. The samples were incubated for 5 min at 37°C in a rotary shaker at a speed of 225 rev min−1 followed by concentration of A. fumigatus DNA with the Pellet Paint Co-precipitant (Novagen, Madison, WI, USA). Selected samples were further purified with the DNeasy Plant kit (QIAGEN, Inc., Valencia, CA, USA). The concentration and purification protocols were performed following manufacturer’s specifications.
Primer design and PCR amplification Aspergillus fumigatus sequences for the 18 S rRNA gene were obtained from GenBank and compared against all other sequences available on-line with the Basic Local Alignment Search Tool algorithm (BLAST, National Center for Biotechnology Information, National Institutes of Health). Primers and probes were designed using the Primer Express software (Applied Biosystems) and obtained from commercial sources (Operon Technologies, Alameda, CA, USA; Synthetic Genetics, San Diego, CA, USA). The ABI Prism 7700 Sequence Detection System (7700 SDS; Applied Biosystems) was used for PCR analysis. Amplification conditions using the Applied Biosystems reagents were as follows: fungal DNA template (5 l); 1×TaqManTM buffer A; 5 mM MgCl2; 0·1 mM dATP; 0·1 mM dCTP; 0·1 mM dGTP; 0·2 mM dUTP; 2·5 U Ampli Taq Gold; 0·5 U AmpErase Uracyl N-Glycosylase; 0·2 M each primer (Operon Technologies, Alameda, CA, USA); 0·2 M probe (Synthetic Genetics, San Diego, CA, USA), for a total reaction volume of 50 l. An internal positive control (IPC-Vic Probe, Applied Biosystems) was incorporated into the PCR reaction to determine whether if samples contained PCR inhibitors. The IPC kit contained control DNA, oligonucleotide primers and a fluorescent probe containing a dye different from that of the target DNA probe to allow for the differentiation of fluorescent signals generated during amplification. TaqManTM cycling conditions were as follows: 2 min at 50°C; 10 min at 95°C; 40 cycles of 15 s at 95°C followed by 1 min at 60°C. Aspergillus fumigatus (ATCC 36607) DNA was used for testing the A. fumigatus primers.
Specificity testing For PCR primer specificity testing, pure cultures (Table 1) were sampled by gently swabbing the surface of the fungal colony with a cotton swab and resuspending the swab in 3 ml of 0·01 M phosphate buffer with 0·05% (v/v) Tween 20 (Sigma Chemical Company, St. Louis, MO, USA) (PBT (pH 7·0)). After vortexing on maximum speed for 1 min, the swab was removed. Aliquots of 500 l were placed in 2-ml microcentrifuge tubes for subsequent DNA extraction and purification. Samples and aliquots were stored at −70°C. Extraction was performed as described above. The extracted DNA samples were subjected to PCR amplification using the designed primers and probe for A. fumigatus. An ethidium bromide dot quantitation method26 was utilized for the determination of the presence of DNA in samples prepared for specificity testing. DNA controls were prepared by serial dilutions of a 100bp DNA ladder (Promega, Madison, WI, USA) in TrisEDTA buffer (TE (pH 8·0)) to obtain concentrations of 1·3, 13·0 and 130·0 g/ml. Four microlitres of control or sample DNA was combined with an equal volume of ethidium bromide (1 g/ml, final concentration) and mixed by vortexing. Negative controls were prepared by substituting TE buffer for DNA. Mixed samples were applied as droplets onto a piece of plastic wrap stretched over the surface of an U.V. transilluminator. A permanent record of the results was obtained by photography with a Polaroid MP 4+ Instant Camera System (Fotodyne Inc., Hartland, WI, USA).
84
P. Cruz-Perez et al.
PCR quantitation standards and analysis Quantitation using the 7700 SDS was accomplished by the use of standards of known concentration. Total concentrations of A. fumigatus (ATCC 36607) spore suspensions were determined using a Coulter Multisizer II electronic particle counter (Beckman Coulter, Inc., Miami, FL, USA). Several loopfuls of the dry A. fumigatus spores were resuspended in 3 ml of PBT and vortexed at maximum speed for 1 min. An aliquot of this spore suspension was diluted in filtered Isoton II solution (Beckman Coulter, Inc.) and enumerated using the Coulter Multisizer II. The data were automatically adjusted for coincidence correction by the instrument and the particles corresponding to the spore peak (1·9 to 3·5 m) were counted. The data from five 50 l aliquots of the sample were averaged and the concentration of total spores per ml in the spore suspension was determined. Aliquots of the A. fumigatus spore suspension of known concentration (100 to 105 spores/PCR reaction) were serially diluted in PBT and stored at −70°C for DNA extraction. Standards were treated using the same extraction and purification methods used to process samples to more accurately quantify fungal DNA in test samples. Standards (100 to 105 templates/reaction) were amplified in duplicate with replicate unknown samples. After amplification, the data were analysed using the software provided with the 7700 SDS. The concentration of the standards was designated and the software constructed a standard curve of Ct value vs concentration. Ct refers to the PCR cycle number where detectable amplification product is measured; the Ct value is inversely proportional to initial DNA template concentration. Concentration values for the unknown samples were extrapolated from the standard curve by the software and reported as the mean of two replicates. ATCC and laboratory A. fumigatus isolates were enumerated with the Coulter Multisizer II and quantified with the 7700 SDS to test the efficiency of the quantitation standards prepared.
RESULTS Primer selection and specificity BLAST search results on the internal transcribed spacer regions (ITS1 and ITS2) of the 18 S rRNA gene of A. fumigatus (GenBank accession # AF138288) revealed a high degree of sequence homology with several species of the genus Penicillium. Two regions unique to A. fumigatus were found at the beginning and the end of the ITS2 region. Primers and probes
were designed for the ITS2 region using the Primer Express software (Applied Biosystems). One primer and probe set was selected. The forward primer (5′CGCGTCCGGTCCTCG3′) was completely homologous with A. fumigatus and several Penicillium sp., and had one base difference with A. niger. The reverse primer (5′TTAGAAAAATAAAGTTGGGTGTCGG3′) was unique for A. fumigatus. The fluorescent probe selected (6-FAM-5′TGTCACCTGCTCTGTAGGCCCG3′-TAMRA) had one base difference with Penicillium chrysogenum and five-bases difference with the A. niger sequence. This primer set produced an 87-bp amplicon. The A. fumigatus primers amplified one ATCC and 14 A. fumigatus laboratory isolates (Table 2). The primers did not amplify fungal DNA extracted from 28 other fungal species (comprising 15 other fungal genera), including eight non-fumigatus Aspergillus species and four Penicillium species. One of 14 A. fumigatus isolates from the Las Vegas area initially showed negative amplification with the A. fumigatus primer set. A 10-fold dilution of this DNA sample produced positive PCR results which indicated the presence of PCR inhibitors. Further purification of this sample through the DNeasy Plant Kit did not remove the PCR inhibitors present. All fungal extracts tested for presence of DNA with the dot quantitation method produced positive results with one exception (data not shown). The A. niger DNA sample, which contained a black pigment, did not emit fluorescence under U.V. transillumination; however, a 10-fold dilution of this sample produced positive results. PCR quantitation standards Aspergillus fumigatus (ATCC 36607) PCR quantitation standards (100 to 105 spores/PCR reaction) were prepared from spore suspensions enumerated with the Coulter Multisizer II. The DNA from spore suspensions of known concentration was extracted by the boiling/Pellet Paint protocol developed. The A. fumigatus quantitation standards produced a linear standard curve with a correlation coefficient (r2) of 0·982. QPCR sensitivity using these standards was <20 templates per PCR reaction. ATCC and laboratory A. fumigatus isolates enumerated with the Coulter Multisizer II and quantitated with the 7700 SDS showed comparable enumeration by the two methods (Table 3). PCR inhibition An internal positive control (IPC) produced a Ct of 26-27 (Table 4) when amplified alone but a higher
QPCR detection of Aspergillus fumigatus Table 2. PCR results obtained for the specificity testing of Aspergillus fumigatus primers Organism Aspergillus fumigatus (ATCC 36607) A. fumigatus (HRC/UNLV 1) A. fumigatus (HRC/UNLV 2) A. fumigatus (HRC/UNLV 3) A. fumigatus (HRC/UNLV 4) A. fumigatus (HRC/UNLV 5) A. fumigatus (HRC/UNLV 6) A. fumigatus (HRC/UNLV 7) A. fumigatus (HRC/UNLV 8) A. fumigatus (HRC/UNLV 9) A. fumigatus (HRC/UNLV 10) A. fumigatus (HRC/UNLV 11) A. fumigatus (HRC/UNLV 12) A. fumigatus (HRC/UNLV 13) A. fumigatus (HRC/UNLV 14) A. flavus A. glaucus A. nidulans (ATCC 10074) A. nidulans A. niger (ATCC 10535) A. niger A. parasiticus (ATCC 15517) A. repens A. terreus A. versicolor Acremonium strictum (ATCC 10141) Alternaria alternata (ATCC 6663) Beauveria sp. Bipolaris sp. Chaetomium sp. Cladosporium herbarum (ATCC 28987) Fusarium oxysporum (ATCC 48112) Penicillium chrysogenum (ATCC 9480) P. chrysogenum P. digitatum P. expansum (ATCC 7861) P. frequentans Phoma sp. Rhizopus sp. Stachybotrys chartarum (ATCC 9182) Trichoderma sp. Ustilago sp. Verticillium sp.
85
Table 3. QPCR results obtained for Aspergillus fumigatus samples enumerated with the Coulter Multisizer II and quantitated with the 7700 Sequence Detection System
PCR results + + + +a + + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − − − − −
+, amplification; −, no amplification. a results following sample dilution; ATCC, American Type Culture Collection; HRC/UNLV, Harry Reid Center for Environmental Studies, University of Nevada-Las Vegas.
Ct when PCR inhibitors were present. A previously amplified A. fumigatus sample (UNLV/HRC 3) produced negative PCR results when undiluted and positive results when diluted. Amplification of this undiluted DNA using the IPC produced negative results of both the sample and the internal positive control, indicating total inhibition. Amplification of 11 of the A. fumigatus isolates using the IPC produced positive results of the undiluted samples but Cts
Strain
ATCC HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV
1 2 3 5 6 9 10 13
7700 Quantitation (template/ml)
Coulter enumeration (spores/ml)
5·78×107 1·75×107 1·23×107 2·51×107 5·42×107 3·19×107 1·19×107 1·20×107 7·61×107
3·00×107 9·39×107 4·60×107 1·55×107 4·33×107 3·50×107 3·24×107 3·12×107 3·62×107
ATCC and laboratory A. fumigatus isolates were sampled and the DNA was extracted and purified with the developed protocol to test the comparability of the quantitation methods. HRC, Harry Reid Center for Environmental Studies; ATCC strain, American Type Culture Collection strain 36607.
greater than 26 for the internal positive control, indicating partial inhibition. Inhibitors were removed in one of these samples (UNLV/HRC 4) that was further purified with the DNeasy Plant Kit (Table 4).
DISCUSSION Few unique DNA sequences for fungi of environmental significance and no species-specific primers for A. fumigatus that are compatible with the TaqManTM technology are currently available in the scientific literature. For the development of specific PCR primers, emphasis was placed on searching sequences for the 18 S rRNA gene, which contain both highly variable and highly conserved regions that have been used for the development of speciesspecific and genus-specific markers, respectively.27,28 BLAST search results on the internal transcribed spacer regions (ITS1 and ITS2) of the 18 S rRNA gene of A. fumigatus revealed a high degree of sequence homology with several species of the genus Penicillium. Two regions unique to A. fumigatus were found at the beginning and the end of the ITS2 region. Gaskell et al.29 state that the ITS2 region of the 18 S rRNA gene is very similar among members of the genera Aspergillus and Penicillium, and that sequence data for the ITS1 region is necessary to distinguish between Aspergillus and Penicillium species. Henry et al.30 conclude that both ITS regions are necessary for accurate identification of Aspergillus species. Other researchers31 have been able to detect A. fumigatus by PCR of the ITS2 region followed by fluorescent capillary electrophoresis. The results of this study
86
P. Cruz-Perez et al. Table 4. PCR results of Aspergillus fumigatus samples amplified with an internal positive control (IPC) PCR Results (Ct values) Sample Aspergillus fumigatus HRC/UNLV 3 A. fumigatus HRC/UNLV 4 A. fumigatus HRC/UNLV 5 A. fumigatus HRC/UNLV 6 A. fumigatus HRC/UNLV 7 A. fumigatus HRC/UNLV 8 A. fumigatus HRC/UNLV 9 A. fumigatus HRC/UNLV 10 A. fumigatus HRC/UNLV 11 A. fumigatus HRC/UNLV 12 A. fumigatus HRC/UNLV 13 A. fumigatus HRC/UNLV 14 Positive control Negative control No amplification control
Sample 40·00 21·55 19·76 20·26 20·34 20·27 21·74 21·82 20·57 20·20 18·85 19·31 22·20 40·00 40·00
40·00 21·22 19·89 20·27 20·38 19·96 21·92 21·89 20·51 20·16 18·89 19·42 22·06 40·00 40·00
IPC 40·00 26·61 32·46 29·39 30·69 29·71 27·37 27·18 28·93 29·74 32·14 30·96 26·69 26·11 40·00
40·00 26·72 32·13 29·10 30·96 30·41 27·02 26·96 29·31 29·14 33·36 30·46 26·44 26·04 40·00
Ct values represent replicates of the same sample. The positive control contained Aspergillus fumigatus (ATCC 36607) control DNA, and the negative control contained sterile water instead of DNA. The no amplification control contained no target DNA, IPC DNA and a blocking reagent to prevent amplification of IPC DNA (Ct of 40=negative result).
show that it is possible to specifically detect and quantitate A. fumigatus by using primers designed for the ITS2 region of the 18S rRNA gene. The protocol developed has a sensitivity of <20 template copies per PCR reaction and allows the detection and quantitation of A. fumigatus from pure culture in less than a day compared with culture analysis that may take several days. Here, several A. fumigatus isolates were found to contain potent PCR inhibitors co-extracting with the DNA and remaining in the sample after purification. Ten and 100-fold dilutions of the most inhibited of these samples produced positive PCR results upon re-amplification, indicating that the sample was A. fumigatus and that dilution of the inhibitors was accomplished by diluting the DNA. These results were also corroborated by the use of an internal positive control in the PCR reaction. To our knowledge, the presence of PCR inhibitors associated with A. fumigatus has not been reported in the literature. The use of absolute standards allows for a more accurate quantitation of the target organism, eliminating the need for post-PCR manipulations necessary with conventional and non-fluorogenic PCR. Determination of the concentration of quantitation standards was based on the enumeration of spores with an electronic particle sizer, a methodology faster and more accurate than microscopic enumeration methods. The quantitation standards prepared offered an accurate representation of the template copies
present in the spore suspensions of several A. fumigatus isolates enumerated with the electronic particle sizer. Fluorescently labelled probes have recently been utilized for the detection of A. fumigatus; however, these methodologies were not quantitative32 or their quantitation was relative to dilutions of fungal cells adjusted to 106 CFU/ml.33 A QPCR-based method was devised in this study for the rapid detection and enumeration of A. fumigatus in pure culture. QPCR analysis using the 7700 SDS can provide accurate quantitation of target nucleic acid sequences present in a sample, with decreased analysis time and increased sensitivity over conventional PCR.12,34 The results of this research demonstrate the capabilities of QPCR to enhance detection and enumeration of fungi of significance in indoor environments. Additional studies designed for the detection of A. fumigatus in environmental samples and the removal of PCR inhibitors would increase the field applicability for the detection of fungi in indoor environments.
ACKNOWLEDGEMENTS This research was funded in part by the Department of Energy under grant # DE-FG03-98ER62574 to the Harry Reid Center for Environmental Studies, University of Nevada, Las Vegas, and a National Science Foundation grant
QPCR detection of Aspergillus fumigatus (# 1330-153-52ED) to the Department of Environmental and Resource Sciences, University of Nevada, Reno. 15.
REFERENCES 16. 1. Kwon-Chung, K. J. & Bennett, J. E. (1992). Medical Mycology. Philadelphia: Lea & Febiger. 2. Yang, C. S. & Johanning, E. (1997). Airborne fungi and mycotoxins. In Manual of Environmental Microbiology (Hurst, C. J., Knudsen, G. R., McInerney, M. J., Stetzenbach, L. D. & Walter, M. V., eds). Pp. 651–60. Washington, DC.: ASM Press. 3. Kurup, V. P. & Kumar, A. (1991). Immunodiagnosis of aspergillosis. Clinical Microbiology Reviews 4, 439– 56. 4. Aufauvre-Brown, A., Cohen, J. & Holden, D. W. (1992). Use of randomly amplified polymorphic DNA markers to distinguish isolates of Aspergillus fumigatus. Journal of Clinical Microbiology 30, 2991–3. 5. Leenders, A., Van Belkum, A., Janssen, S., De Marie, S., Kluytmans, J., Wielenga, J. et al. (1996). Molecular epidemiology of apparent outbreak of invasive aspergillosis in a hematology ward. Journal of Clinical Microbiology 34, 345–51. 6. Girardin, H., Latge`, J.-P., Srikantha, T., Morrow, B. & Soll, D. R. (1993). Development of DNA probes for fingerprinting Aspergillus fumigatus. Journal of Clinical Microbiology 31, 1547–54. 7. Leenders, A. C. A. P., Van Belkum, A., Behrendt, M., Luijendijk, A. & Verbrugh, H. A. (1999). Density and molecular epidemiology of Aspergillus in air and relationship to outbreaks of Aspergillus infection. Journal of Clinical Microbiology 37, 1752–7. 8. Sawyer, M. H., Chamberlin, C. J., Wu, Y. N., Aintablian, N. & Wallace, M. R. (1994). Detection of varicella-zoster virus DNA in air samples from hospital rooms. Journal of Infectious Diseases 169, 91–4. 9. Alvarez, A. J., Buttner, M. P. & Stetzenbach, L. D. (1995). PCR for bioaerosol monitoring: sensitivity and environmental interference. Applied and Environmental Microbiology 61, 3639–44. 10. Alvarez, A. J., Buttner, M. P., Toranzos, G. A., Dvorsky, E. A., Toro, A., Heikes, T. B. et al. (1994). The use of solid-phase polymerase chain reaction for the enhanced detection of airborne microorganisms. Applied and Environmental Microbiology 60, 374–6. 11. Vesper, S., Dearborn, D. G., Yike, I., Allan, T., Sobolewski, J., Hinkley, S. F. et al. (2000). Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation. Journal of Urban Health 77, 68–84. 12. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996). Real time quantitative PCR. Genome Research 6, 986–94. 13. Bassler, H. A., Flood, S. J. A., Livak, K. J., Marmaro, J., Knorr, R. & Batt, C. A. (1995). Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes. Applied and Environmental Microbiology 61, 3724–8. 14. Desjardin, L. E., Chen, Y., Perkins, M. D., Teixeira, L., Cave, M. D. & Eisenach, K. D. (1998). Comparison of the ABI 7700 system (TaqMan) and competitive PCR for quantification of IS6110 DNA in sputum during
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
87
treatment of tuberculosis. Journal of Clinical Microbiology 36, 1964–8. Nogva, H. K. & Lillehaug, D. (1999). Detection and quantification of Salmonella in pure cultures using 5′-nuclease polymerase chain reaction. International Journal of Food Microbiology 51, 191–6. Verweij, P. E., Latge`, J.-P., Rijs, A. J. M. M., Melchers, W. J. G., De Pauw, B. E., Hoogkamp-Korstanje, J. A. A. et al. (1995). Comparison of antigen detection and PCR assay using bronchoalveolar lavage fluid for diagnosing invasive pulmonary aspergillosis in patients receiving treatment for hematological malignancies. Journal of Clinical Microbiology 33, 3150–3. Melchers, W. J. G., Verweij, P. E., Van Den Hurk, P., Van Belkum, A., De Pauw, B. E., Hoogkamp-Korstanje, J. A. A. et al. (1994). General primer-mediated PCR for detection of Aspergillus species. Journal of Clinical Microbiology 32, 1710–7. Kappe, R., Fauser, C., Okeke, C. N. & Maiwald, M. (1996). Universal fungus-specific primer systems and group-specific hybridization oligonucleotides for 18 S rDNA. Mycoses 39, 25–30. Yamakami, Y., Hashimoto, A., Tokimatsu, I. & Nasu, M. (1996). PCR detection of DNA specific for Aspergillus species in serum of patients with invasive aspergillosis. Journal of Clinical Microbiology 34, 2464–8. Yamakami, Y., Hashimoto, A., Yamagata, E., Kamberi, P., Karashima, R., Nagai, H. et al. (1998). Evaluation of PCR for detection of DNA specific for Aspergillus species in sera of patients with various forms of pulmonary aspergillosis. Journal of Clinical Microbiology 36, 3619–23. Reiss, E., Tanaka, K., Bruker, G., Chazalet, V., Coleman, D., Debeaupuis, J. P. et al. (1998). Molecular diagnosis and epidemiology of fungal infections. Medical Mycology 36, 249–57. Walsh, T. J., Francesconi, A., Kasai, M. & Chanock, S. J. (1995). PCR and single-strand conformational polymorphism for recognition of medically important opportunistic fungi. Journal of Clinical Microbiology 33, 3216–20. Bart-Delabesse, E., Humbert, J.-F., Delabesse, E`., & Bretagne, S. (1998). Microsatellite markers for typing Aspergillus fumigatus isolates. Journal of Clinical Microbiology 36, 2413–8. Radford, S. A., Johnson, E. M., Leeming, J. P., Millar, M. R., Cornish, J. M., Foot, A. B. M. et al. (1998). Molecular epidemiological study of Aspergillus fumigatus in a bone marrow transplantation unit by PCR amplification of ribosomal intergenic spacer sequences. Journal of Clinical Microbiology 36, 1294–9. Buttner, M. P., Cruz-Perez, P. & Stetzenbach, L. D. (2001). Enhanced detection of surface-associated bacteria in indoor environments using quantitative PCR. Applied and Environmental Microbiology. In press. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. et al. (1995). Current Protocols in Molecular Biology. Brooklyn: John Wiley & Sons, Inc. Bridge, P. D. & Arora, D. K. (1998). Interpretation of PCR methods for species definition. In Applications of PCR in Mycology (Bridge, P. D., Arora, D. K., Reddy, C. A. & Elander, R. P., eds). Pp. 63–84. New York: CAB International.
88
P. Cruz-Perez et al.
28. Edel, V. (1998). Polymerase chain reaction in mycology: an overview. In Applications of PCR in Mycology (Bridge, P. D., Arora, D. K., Reddy, C. A. & Elander, R. P., eds). Pp. 1–20. New York: CAB International. 29. Gaskell, G. J., Carter, D. A., Britton, W. J., Tovey, E. R., Benyon, F. H. L. & Løvborg, U. (1997). Analysis of the internal transcribed spacer regions of ribosomal DNA in common airborne allergenic fungi. Electrophoresis 18, 1567–9. 30. Henry, T., Iwen, P. C. & Hinrichs, S. H. (2000). Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 1510–5. 31. Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A. & Kabani, A. M. (1999). Rapid identification of
fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. Journal of Clinical Microbiology 37, 1846–51. 32. Brandt, M. E., Padhye, A. A., Mayer, L. W., & Holloway, B. P. (1998). Utility of random amplified polymorphic DNA PCR and TaqMan automated detection in molecular identification of Aspergillus fumigatus. Journal of Clinical Microbiology 36, 2057–62. 33. Loeffler, J., Henke, N., Hebart, H., Schmidt, D., Hagmeyer, L., Schumacher, U. et al. (2000). Quantification of fungal DNA by using fluorescence resonance energy transfer and the Light Cycler system. Journal of Clinical Microbiology 38, 586–90. 34. Orlando, C., Pinzani, P. & Pazzagli, M. (1998). Developments in quantitative PCR. Clinical Chemistry and Laboratory Medicine 36, 255–69.
Detection and quantitation of Aspergillus fumigatus in pure culture using polymerase chain reaction P. Cruz-Perez, M. P. Buttner and L. D. Stetzenbach∗ Harry Reid Center for Environmental Studies, University of Nevada, Las Vegas 4505 S. Maryland Parkway, Las Vegas, NV 89154-4009, USA (Received 25 October 2000, Accepted 19 December 2000) Research was conducted with laboratory cultures to establish a protocol for the rapid detection and quantitation of the thermophilic fungus, Aspergillus fumigatus, using genetic amplification. Oligonucleotide primers and a fluorescently labelled probe were designed for use with quantitative polymerase chain reaction (QPCR). Primers and probe were tested for selectivity, specificity and sensitivity of detection of the target organism using a fluorogenic nuclease assay and a sequence detector. The DNA extraction protocol consisted of enzymatic treatment and boiling of fungal spore suspensions followed by DNA concentration and purification. The primer set developed was specific for A. fumigatus and had a sensitivity of <20 template copies. These primers amplified all A. fumigatus isolates tested and did not amplify DNA extracted from other Aspergillus species or 15 other fungal genera. However, one A. fumigatus sample was initially negative after PCR amplification. Incorporation of an internal positive control in the PCR reaction demonstrated the presence of inhibitors in this and other samples. PCR inhibitors were removed by dilution or further purification of the DNA samples. This research resulted in a QPCR method for detection and quantitation of A. fumigatus and demonstrated the presence of PCR inhibitors in several A. fumigatus isolates. 2001 Academic Press KEYWORDS: Aspergillus, PCR inhibitors, QPCR, TaqManTM.
INTRODUCTION Aspergillus fumigatus is a ubiquitous, thermophilic fungus that grows in damp environments. It is an opportunistic pathogen that affects cystic fibrosis patients and the immunocompromised.1,2 In addition, it is allergenic and has been implicated in several respiratory diseases.3 Inhalation of Aspergillus spores by susceptible individuals has been linked to the development of pulmonary disease.4,5 Girardin et al.6 refer to A. fumigatus as the most common airborne fungal pathogen, and Leenders et al.7 state that A. fumigatus is the predominant Aspergillus species involved in invasive infections. However, it is often
under-estimated in traditional culture analyses due to its specific growth temperature requirement and the expertise required in speciating members of the genus Aspergillus. Because numerous fungal spores exist in the air and on surfaces both indoors and outdoors, it is advantageous to accurately and rapidly detect organisms such as A. fumigatus in environmental samples. Due to the detection limitations associated with traditional culture analyses, molecular biology techniques can be utilized for the rapid and sensitive detection of target organisms in indoor environments. The research conducted in this study utilized an analytical method that has been demonstrated to rapidly and accurately detect airborne virus,8 bac-
∗ Author to whom all correspondence should be addressed at: 4505 S. Maryland Parkway, Las Vegas, NV, 89154-4009; USA. Tel: +1 702 895 1419; Fax: +1 702 895 2688; E-mail: [email protected]
0890–8508/01/020081+08 $35.00
2001 Academic Press
82
P. Cruz-Perez et al.
teria9,10 and, recently, fungi in indoor environments.5,7,11 This technique utilizes the polymerase chain reaction (PCR) to detect specific microorganisms by amplifying DNA sequences unique to the organism of interest. To use the PCR technique, sequence information must be identified for a specific target DNA segment. Once a unique DNA sequence has been identified, oligonucleotide primers are designed, synthesized, and then tested for sensitivity, specificity and selectivity. A fluorogenic nuclease assay in conjunction with a sequence detector (ABI PRISM 7700 Sequence Detection System, Applied Biosystems, Foster City, CA, USA) has recently been developed as a means to amplify and quantitate PCR products, eliminating the need for post-PCR manipulations for visualization of results.12 This assay uses a fluorescently labelled oligonucleotide probe that anneals between the primers of choice as the amplification reaction proceeds, allowing for the determination of starting copy number of target DNA. The TaqManTM assay that is integral to this quantitative technology has been validated previously by other researchers with DNA extracted from Listeria monocytogenes,13 Mycobacterium tuberculosis,14 and Salmonella.15 Due to its potential as a health hazard and the importance of a fast diagnosis, several investigators have published on the rapid detection of A. fumigatus in clinical samples using antigen assays16 and antibody production in response to these antigens.3 However, commercially available kits for the detection of Aspergillus sp. that utilize the latex agglutination principle have the disadvantage of low sensitivity, and enzyme-linked immunosorbent assays can produce false-positive results.16 More recently, researchers have utilized PCR as the detection mechanism for clinical or environmental samples but have targeted the Aspergillus genus rather than the species A. fumigatus.7,16–20 According to Verweij et al,16 the diagnostic value of many of the existing methods for the PCR detection of Aspergillus DNA cannot be established because of the limited number of controls and patients that were tested in those studies. Researchers have used post-PCR techniques such as denaturing gradient gel electrophoresis to differentiate A. fumigatus from Aspergillus niger,21 or single-strand conformational polymorphism for the differentiation of A. fumigatus from Aspergillus flavus and A. niger.22 Girardin et al.6 used DNA hybridization to detect A. fumigatus, and Bart-Delabesse et al.23 utilized microsatellites as PCR markers for differentiating A. fumigatus strains. Advances in the PCR detection of A. fumigatus have recently been reported with identification of the target organism based on analysis of the PCR products by gel electrophoresis.24 Here,
Table 1. Fungal isolates tested for PCR amplification using Aspergillus fumigatus primers and probe Organism
Source
Acremonium strictum Alternaria alternata Aspergillus flavus A. fumigatus A. fumigatus (14 isolates) A. glaucus A. nidulans A. nidulans A. niger A. niger A. parasiticus A. repens A. terreus A. versicolor Beauveria sp. Bipolaris sp. Chaetomium sp. Cladosporium herbarum Fusarium oxysporum Penicillium chrysogenum P. chrysogenum P. digitatum P. expansum P. frequentans Phoma sp. Rhizopus sp. Stachybotrys chartarum Trichoderma sp. Ustilago sp. Verticillium sp.
ATCC 10141 ATCC 6663 HRC/UNLV ATCC 36607 HRC/UNLV HRC/UNLV ATCC 10074 HRC/UNLV ATCC 10535 HRC/UNLV ATCC 15517 HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV ATCC 28987 ATCC 48112 ATCC 9480 Harvard HRC/UNLV ATCC 7861 HRC/UNLV HRC/UNLV HRC/UNLV ATCC 9182 HRC/UNLV HRC/UNLV HRC/UNLV
ATCC, American Type Culture Collection; HRC/UNLV, Harry Reid Center for Environmental Studies, University of Nevada-Las Vegas; Harvard, Harvard School of Public Health, Boston, MA, courtesy of Harriet Burge.
oligonucleotide primers and a probe were developed for the rapid detection and absolute quantitation of A. fumigatus in pure culture using quantitative PCR (QPCR).
MATERIALS AND METHODS Test organisms and culture media The fungus A. fumigatus served as the test organism for this study. Forty-three fungal isolates of interest, representing 15 genera, were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) or from laboratory stocks, and cultured in the laboratory (Table 1). Malt extract agar (MEA (pH 4·7), Difco Laboratories, Detroit, MI, USA) and potato dextrose agar (PDA (pH 5·6), Difco) were used for the culture of all fungal species. Aspergillus fumigatus
QPCR detection of Aspergillus fumigatus
isolates were incubated at 45°C for 2–3 days. All other fungal isolates were incubated at 23°C for 3–7 days.
Spore harvest Spores were harvested from pure cultures of A. fumigatus (ATCC 36607) to prepare standards of known concentration. Dry spore harvests were performed by inoculating at least four Petri dishes with A. fumigatus and incubating as described above. The dishes were inverted onto a sterile glass funnel and gently tapped to dislodge the spores into a sterile glass bottle. The spore harvest was stored dry at 4°C until ready for use.
83
DNA extraction and purification A boiling protocol developed for DNA extraction of bacterial endospores25 was used for the DNA extraction from A. fumigatus spores. This protocol consisted of treating the spore suspension with sodium dodecylsulfate (0·5% final concentration) and proteinase K (20 g/ml final concentration), followed by incubation at 50°C for 10 min and boiling for 15 min. The samples were chilled on ice for 2 min and bovine serum albumin was added to a final concentration of 0·05%. The samples were incubated for 5 min at 37°C in a rotary shaker at a speed of 225 rev min−1 followed by concentration of A. fumigatus DNA with the Pellet Paint Co-precipitant (Novagen, Madison, WI, USA). Selected samples were further purified with the DNeasy Plant kit (QIAGEN, Inc., Valencia, CA, USA). The concentration and purification protocols were performed following manufacturer’s specifications.
Primer design and PCR amplification Aspergillus fumigatus sequences for the 18 S rRNA gene were obtained from GenBank and compared against all other sequences available on-line with the Basic Local Alignment Search Tool algorithm (BLAST, National Center for Biotechnology Information, National Institutes of Health). Primers and probes were designed using the Primer Express software (Applied Biosystems) and obtained from commercial sources (Operon Technologies, Alameda, CA, USA; Synthetic Genetics, San Diego, CA, USA). The ABI Prism 7700 Sequence Detection System (7700 SDS; Applied Biosystems) was used for PCR analysis. Amplification conditions using the Applied Biosystems reagents were as follows: fungal DNA template (5 l); 1×TaqManTM buffer A; 5 mM MgCl2; 0·1 mM dATP; 0·1 mM dCTP; 0·1 mM dGTP; 0·2 mM dUTP; 2·5 U Ampli Taq Gold; 0·5 U AmpErase Uracyl N-Glycosylase; 0·2 M each primer (Operon Technologies, Alameda, CA, USA); 0·2 M probe (Synthetic Genetics, San Diego, CA, USA), for a total reaction volume of 50 l. An internal positive control (IPC-Vic Probe, Applied Biosystems) was incorporated into the PCR reaction to determine whether if samples contained PCR inhibitors. The IPC kit contained control DNA, oligonucleotide primers and a fluorescent probe containing a dye different from that of the target DNA probe to allow for the differentiation of fluorescent signals generated during amplification. TaqManTM cycling conditions were as follows: 2 min at 50°C; 10 min at 95°C; 40 cycles of 15 s at 95°C followed by 1 min at 60°C. Aspergillus fumigatus (ATCC 36607) DNA was used for testing the A. fumigatus primers.
Specificity testing For PCR primer specificity testing, pure cultures (Table 1) were sampled by gently swabbing the surface of the fungal colony with a cotton swab and resuspending the swab in 3 ml of 0·01 M phosphate buffer with 0·05% (v/v) Tween 20 (Sigma Chemical Company, St. Louis, MO, USA) (PBT (pH 7·0)). After vortexing on maximum speed for 1 min, the swab was removed. Aliquots of 500 l were placed in 2-ml microcentrifuge tubes for subsequent DNA extraction and purification. Samples and aliquots were stored at −70°C. Extraction was performed as described above. The extracted DNA samples were subjected to PCR amplification using the designed primers and probe for A. fumigatus. An ethidium bromide dot quantitation method26 was utilized for the determination of the presence of DNA in samples prepared for specificity testing. DNA controls were prepared by serial dilutions of a 100bp DNA ladder (Promega, Madison, WI, USA) in TrisEDTA buffer (TE (pH 8·0)) to obtain concentrations of 1·3, 13·0 and 130·0 g/ml. Four microlitres of control or sample DNA was combined with an equal volume of ethidium bromide (1 g/ml, final concentration) and mixed by vortexing. Negative controls were prepared by substituting TE buffer for DNA. Mixed samples were applied as droplets onto a piece of plastic wrap stretched over the surface of an U.V. transilluminator. A permanent record of the results was obtained by photography with a Polaroid MP 4+ Instant Camera System (Fotodyne Inc., Hartland, WI, USA).
84
P. Cruz-Perez et al.
PCR quantitation standards and analysis Quantitation using the 7700 SDS was accomplished by the use of standards of known concentration. Total concentrations of A. fumigatus (ATCC 36607) spore suspensions were determined using a Coulter Multisizer II electronic particle counter (Beckman Coulter, Inc., Miami, FL, USA). Several loopfuls of the dry A. fumigatus spores were resuspended in 3 ml of PBT and vortexed at maximum speed for 1 min. An aliquot of this spore suspension was diluted in filtered Isoton II solution (Beckman Coulter, Inc.) and enumerated using the Coulter Multisizer II. The data were automatically adjusted for coincidence correction by the instrument and the particles corresponding to the spore peak (1·9 to 3·5 m) were counted. The data from five 50 l aliquots of the sample were averaged and the concentration of total spores per ml in the spore suspension was determined. Aliquots of the A. fumigatus spore suspension of known concentration (100 to 105 spores/PCR reaction) were serially diluted in PBT and stored at −70°C for DNA extraction. Standards were treated using the same extraction and purification methods used to process samples to more accurately quantify fungal DNA in test samples. Standards (100 to 105 templates/reaction) were amplified in duplicate with replicate unknown samples. After amplification, the data were analysed using the software provided with the 7700 SDS. The concentration of the standards was designated and the software constructed a standard curve of Ct value vs concentration. Ct refers to the PCR cycle number where detectable amplification product is measured; the Ct value is inversely proportional to initial DNA template concentration. Concentration values for the unknown samples were extrapolated from the standard curve by the software and reported as the mean of two replicates. ATCC and laboratory A. fumigatus isolates were enumerated with the Coulter Multisizer II and quantified with the 7700 SDS to test the efficiency of the quantitation standards prepared.
RESULTS Primer selection and specificity BLAST search results on the internal transcribed spacer regions (ITS1 and ITS2) of the 18 S rRNA gene of A. fumigatus (GenBank accession # AF138288) revealed a high degree of sequence homology with several species of the genus Penicillium. Two regions unique to A. fumigatus were found at the beginning and the end of the ITS2 region. Primers and probes
were designed for the ITS2 region using the Primer Express software (Applied Biosystems). One primer and probe set was selected. The forward primer (5′CGCGTCCGGTCCTCG3′) was completely homologous with A. fumigatus and several Penicillium sp., and had one base difference with A. niger. The reverse primer (5′TTAGAAAAATAAAGTTGGGTGTCGG3′) was unique for A. fumigatus. The fluorescent probe selected (6-FAM-5′TGTCACCTGCTCTGTAGGCCCG3′-TAMRA) had one base difference with Penicillium chrysogenum and five-bases difference with the A. niger sequence. This primer set produced an 87-bp amplicon. The A. fumigatus primers amplified one ATCC and 14 A. fumigatus laboratory isolates (Table 2). The primers did not amplify fungal DNA extracted from 28 other fungal species (comprising 15 other fungal genera), including eight non-fumigatus Aspergillus species and four Penicillium species. One of 14 A. fumigatus isolates from the Las Vegas area initially showed negative amplification with the A. fumigatus primer set. A 10-fold dilution of this DNA sample produced positive PCR results which indicated the presence of PCR inhibitors. Further purification of this sample through the DNeasy Plant Kit did not remove the PCR inhibitors present. All fungal extracts tested for presence of DNA with the dot quantitation method produced positive results with one exception (data not shown). The A. niger DNA sample, which contained a black pigment, did not emit fluorescence under U.V. transillumination; however, a 10-fold dilution of this sample produced positive results. PCR quantitation standards Aspergillus fumigatus (ATCC 36607) PCR quantitation standards (100 to 105 spores/PCR reaction) were prepared from spore suspensions enumerated with the Coulter Multisizer II. The DNA from spore suspensions of known concentration was extracted by the boiling/Pellet Paint protocol developed. The A. fumigatus quantitation standards produced a linear standard curve with a correlation coefficient (r2) of 0·982. QPCR sensitivity using these standards was <20 templates per PCR reaction. ATCC and laboratory A. fumigatus isolates enumerated with the Coulter Multisizer II and quantitated with the 7700 SDS showed comparable enumeration by the two methods (Table 3). PCR inhibition An internal positive control (IPC) produced a Ct of 26-27 (Table 4) when amplified alone but a higher
QPCR detection of Aspergillus fumigatus Table 2. PCR results obtained for the specificity testing of Aspergillus fumigatus primers Organism Aspergillus fumigatus (ATCC 36607) A. fumigatus (HRC/UNLV 1) A. fumigatus (HRC/UNLV 2) A. fumigatus (HRC/UNLV 3) A. fumigatus (HRC/UNLV 4) A. fumigatus (HRC/UNLV 5) A. fumigatus (HRC/UNLV 6) A. fumigatus (HRC/UNLV 7) A. fumigatus (HRC/UNLV 8) A. fumigatus (HRC/UNLV 9) A. fumigatus (HRC/UNLV 10) A. fumigatus (HRC/UNLV 11) A. fumigatus (HRC/UNLV 12) A. fumigatus (HRC/UNLV 13) A. fumigatus (HRC/UNLV 14) A. flavus A. glaucus A. nidulans (ATCC 10074) A. nidulans A. niger (ATCC 10535) A. niger A. parasiticus (ATCC 15517) A. repens A. terreus A. versicolor Acremonium strictum (ATCC 10141) Alternaria alternata (ATCC 6663) Beauveria sp. Bipolaris sp. Chaetomium sp. Cladosporium herbarum (ATCC 28987) Fusarium oxysporum (ATCC 48112) Penicillium chrysogenum (ATCC 9480) P. chrysogenum P. digitatum P. expansum (ATCC 7861) P. frequentans Phoma sp. Rhizopus sp. Stachybotrys chartarum (ATCC 9182) Trichoderma sp. Ustilago sp. Verticillium sp.
85
Table 3. QPCR results obtained for Aspergillus fumigatus samples enumerated with the Coulter Multisizer II and quantitated with the 7700 Sequence Detection System
PCR results + + + +a + + + + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − − − − −
+, amplification; −, no amplification. a results following sample dilution; ATCC, American Type Culture Collection; HRC/UNLV, Harry Reid Center for Environmental Studies, University of Nevada-Las Vegas.
Ct when PCR inhibitors were present. A previously amplified A. fumigatus sample (UNLV/HRC 3) produced negative PCR results when undiluted and positive results when diluted. Amplification of this undiluted DNA using the IPC produced negative results of both the sample and the internal positive control, indicating total inhibition. Amplification of 11 of the A. fumigatus isolates using the IPC produced positive results of the undiluted samples but Cts
Strain
ATCC HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV HRC/UNLV
1 2 3 5 6 9 10 13
7700 Quantitation (template/ml)
Coulter enumeration (spores/ml)
5·78×107 1·75×107 1·23×107 2·51×107 5·42×107 3·19×107 1·19×107 1·20×107 7·61×107
3·00×107 9·39×107 4·60×107 1·55×107 4·33×107 3·50×107 3·24×107 3·12×107 3·62×107
ATCC and laboratory A. fumigatus isolates were sampled and the DNA was extracted and purified with the developed protocol to test the comparability of the quantitation methods. HRC, Harry Reid Center for Environmental Studies; ATCC strain, American Type Culture Collection strain 36607.
greater than 26 for the internal positive control, indicating partial inhibition. Inhibitors were removed in one of these samples (UNLV/HRC 4) that was further purified with the DNeasy Plant Kit (Table 4).
DISCUSSION Few unique DNA sequences for fungi of environmental significance and no species-specific primers for A. fumigatus that are compatible with the TaqManTM technology are currently available in the scientific literature. For the development of specific PCR primers, emphasis was placed on searching sequences for the 18 S rRNA gene, which contain both highly variable and highly conserved regions that have been used for the development of speciesspecific and genus-specific markers, respectively.27,28 BLAST search results on the internal transcribed spacer regions (ITS1 and ITS2) of the 18 S rRNA gene of A. fumigatus revealed a high degree of sequence homology with several species of the genus Penicillium. Two regions unique to A. fumigatus were found at the beginning and the end of the ITS2 region. Gaskell et al.29 state that the ITS2 region of the 18 S rRNA gene is very similar among members of the genera Aspergillus and Penicillium, and that sequence data for the ITS1 region is necessary to distinguish between Aspergillus and Penicillium species. Henry et al.30 conclude that both ITS regions are necessary for accurate identification of Aspergillus species. Other researchers31 have been able to detect A. fumigatus by PCR of the ITS2 region followed by fluorescent capillary electrophoresis. The results of this study
86
P. Cruz-Perez et al. Table 4. PCR results of Aspergillus fumigatus samples amplified with an internal positive control (IPC) PCR Results (Ct values) Sample Aspergillus fumigatus HRC/UNLV 3 A. fumigatus HRC/UNLV 4 A. fumigatus HRC/UNLV 5 A. fumigatus HRC/UNLV 6 A. fumigatus HRC/UNLV 7 A. fumigatus HRC/UNLV 8 A. fumigatus HRC/UNLV 9 A. fumigatus HRC/UNLV 10 A. fumigatus HRC/UNLV 11 A. fumigatus HRC/UNLV 12 A. fumigatus HRC/UNLV 13 A. fumigatus HRC/UNLV 14 Positive control Negative control No amplification control
Sample 40·00 21·55 19·76 20·26 20·34 20·27 21·74 21·82 20·57 20·20 18·85 19·31 22·20 40·00 40·00
40·00 21·22 19·89 20·27 20·38 19·96 21·92 21·89 20·51 20·16 18·89 19·42 22·06 40·00 40·00
IPC 40·00 26·61 32·46 29·39 30·69 29·71 27·37 27·18 28·93 29·74 32·14 30·96 26·69 26·11 40·00
40·00 26·72 32·13 29·10 30·96 30·41 27·02 26·96 29·31 29·14 33·36 30·46 26·44 26·04 40·00
Ct values represent replicates of the same sample. The positive control contained Aspergillus fumigatus (ATCC 36607) control DNA, and the negative control contained sterile water instead of DNA. The no amplification control contained no target DNA, IPC DNA and a blocking reagent to prevent amplification of IPC DNA (Ct of 40=negative result).
show that it is possible to specifically detect and quantitate A. fumigatus by using primers designed for the ITS2 region of the 18S rRNA gene. The protocol developed has a sensitivity of <20 template copies per PCR reaction and allows the detection and quantitation of A. fumigatus from pure culture in less than a day compared with culture analysis that may take several days. Here, several A. fumigatus isolates were found to contain potent PCR inhibitors co-extracting with the DNA and remaining in the sample after purification. Ten and 100-fold dilutions of the most inhibited of these samples produced positive PCR results upon re-amplification, indicating that the sample was A. fumigatus and that dilution of the inhibitors was accomplished by diluting the DNA. These results were also corroborated by the use of an internal positive control in the PCR reaction. To our knowledge, the presence of PCR inhibitors associated with A. fumigatus has not been reported in the literature. The use of absolute standards allows for a more accurate quantitation of the target organism, eliminating the need for post-PCR manipulations necessary with conventional and non-fluorogenic PCR. Determination of the concentration of quantitation standards was based on the enumeration of spores with an electronic particle sizer, a methodology faster and more accurate than microscopic enumeration methods. The quantitation standards prepared offered an accurate representation of the template copies
present in the spore suspensions of several A. fumigatus isolates enumerated with the electronic particle sizer. Fluorescently labelled probes have recently been utilized for the detection of A. fumigatus; however, these methodologies were not quantitative32 or their quantitation was relative to dilutions of fungal cells adjusted to 106 CFU/ml.33 A QPCR-based method was devised in this study for the rapid detection and enumeration of A. fumigatus in pure culture. QPCR analysis using the 7700 SDS can provide accurate quantitation of target nucleic acid sequences present in a sample, with decreased analysis time and increased sensitivity over conventional PCR.12,34 The results of this research demonstrate the capabilities of QPCR to enhance detection and enumeration of fungi of significance in indoor environments. Additional studies designed for the detection of A. fumigatus in environmental samples and the removal of PCR inhibitors would increase the field applicability for the detection of fungi in indoor environments.
ACKNOWLEDGEMENTS This research was funded in part by the Department of Energy under grant # DE-FG03-98ER62574 to the Harry Reid Center for Environmental Studies, University of Nevada, Las Vegas, and a National Science Foundation grant
QPCR detection of Aspergillus fumigatus (# 1330-153-52ED) to the Department of Environmental and Resource Sciences, University of Nevada, Reno. 15.
REFERENCES 16. 1. Kwon-Chung, K. J. & Bennett, J. E. (1992). Medical Mycology. Philadelphia: Lea & Febiger. 2. Yang, C. S. & Johanning, E. (1997). Airborne fungi and mycotoxins. In Manual of Environmental Microbiology (Hurst, C. J., Knudsen, G. R., McInerney, M. J., Stetzenbach, L. D. & Walter, M. V., eds). Pp. 651–60. Washington, DC.: ASM Press. 3. Kurup, V. P. & Kumar, A. (1991). Immunodiagnosis of aspergillosis. Clinical Microbiology Reviews 4, 439– 56. 4. Aufauvre-Brown, A., Cohen, J. & Holden, D. W. (1992). Use of randomly amplified polymorphic DNA markers to distinguish isolates of Aspergillus fumigatus. Journal of Clinical Microbiology 30, 2991–3. 5. Leenders, A., Van Belkum, A., Janssen, S., De Marie, S., Kluytmans, J., Wielenga, J. et al. (1996). Molecular epidemiology of apparent outbreak of invasive aspergillosis in a hematology ward. Journal of Clinical Microbiology 34, 345–51. 6. Girardin, H., Latge`, J.-P., Srikantha, T., Morrow, B. & Soll, D. R. (1993). Development of DNA probes for fingerprinting Aspergillus fumigatus. Journal of Clinical Microbiology 31, 1547–54. 7. Leenders, A. C. A. P., Van Belkum, A., Behrendt, M., Luijendijk, A. & Verbrugh, H. A. (1999). Density and molecular epidemiology of Aspergillus in air and relationship to outbreaks of Aspergillus infection. Journal of Clinical Microbiology 37, 1752–7. 8. Sawyer, M. H., Chamberlin, C. J., Wu, Y. N., Aintablian, N. & Wallace, M. R. (1994). Detection of varicella-zoster virus DNA in air samples from hospital rooms. Journal of Infectious Diseases 169, 91–4. 9. Alvarez, A. J., Buttner, M. P. & Stetzenbach, L. D. (1995). PCR for bioaerosol monitoring: sensitivity and environmental interference. Applied and Environmental Microbiology 61, 3639–44. 10. Alvarez, A. J., Buttner, M. P., Toranzos, G. A., Dvorsky, E. A., Toro, A., Heikes, T. B. et al. (1994). The use of solid-phase polymerase chain reaction for the enhanced detection of airborne microorganisms. Applied and Environmental Microbiology 60, 374–6. 11. Vesper, S., Dearborn, D. G., Yike, I., Allan, T., Sobolewski, J., Hinkley, S. F. et al. (2000). Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: quantitative assessment before, during, and after remediation. Journal of Urban Health 77, 68–84. 12. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996). Real time quantitative PCR. Genome Research 6, 986–94. 13. Bassler, H. A., Flood, S. J. A., Livak, K. J., Marmaro, J., Knorr, R. & Batt, C. A. (1995). Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes. Applied and Environmental Microbiology 61, 3724–8. 14. Desjardin, L. E., Chen, Y., Perkins, M. D., Teixeira, L., Cave, M. D. & Eisenach, K. D. (1998). Comparison of the ABI 7700 system (TaqMan) and competitive PCR for quantification of IS6110 DNA in sputum during
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
87
treatment of tuberculosis. Journal of Clinical Microbiology 36, 1964–8. Nogva, H. K. & Lillehaug, D. (1999). Detection and quantification of Salmonella in pure cultures using 5′-nuclease polymerase chain reaction. International Journal of Food Microbiology 51, 191–6. Verweij, P. E., Latge`, J.-P., Rijs, A. J. M. M., Melchers, W. J. G., De Pauw, B. E., Hoogkamp-Korstanje, J. A. A. et al. (1995). Comparison of antigen detection and PCR assay using bronchoalveolar lavage fluid for diagnosing invasive pulmonary aspergillosis in patients receiving treatment for hematological malignancies. Journal of Clinical Microbiology 33, 3150–3. Melchers, W. J. G., Verweij, P. E., Van Den Hurk, P., Van Belkum, A., De Pauw, B. E., Hoogkamp-Korstanje, J. A. A. et al. (1994). General primer-mediated PCR for detection of Aspergillus species. Journal of Clinical Microbiology 32, 1710–7. Kappe, R., Fauser, C., Okeke, C. N. & Maiwald, M. (1996). Universal fungus-specific primer systems and group-specific hybridization oligonucleotides for 18 S rDNA. Mycoses 39, 25–30. Yamakami, Y., Hashimoto, A., Tokimatsu, I. & Nasu, M. (1996). PCR detection of DNA specific for Aspergillus species in serum of patients with invasive aspergillosis. Journal of Clinical Microbiology 34, 2464–8. Yamakami, Y., Hashimoto, A., Yamagata, E., Kamberi, P., Karashima, R., Nagai, H. et al. (1998). Evaluation of PCR for detection of DNA specific for Aspergillus species in sera of patients with various forms of pulmonary aspergillosis. Journal of Clinical Microbiology 36, 3619–23. Reiss, E., Tanaka, K., Bruker, G., Chazalet, V., Coleman, D., Debeaupuis, J. P. et al. (1998). Molecular diagnosis and epidemiology of fungal infections. Medical Mycology 36, 249–57. Walsh, T. J., Francesconi, A., Kasai, M. & Chanock, S. J. (1995). PCR and single-strand conformational polymorphism for recognition of medically important opportunistic fungi. Journal of Clinical Microbiology 33, 3216–20. Bart-Delabesse, E., Humbert, J.-F., Delabesse, E`., & Bretagne, S. (1998). Microsatellite markers for typing Aspergillus fumigatus isolates. Journal of Clinical Microbiology 36, 2413–8. Radford, S. A., Johnson, E. M., Leeming, J. P., Millar, M. R., Cornish, J. M., Foot, A. B. M. et al. (1998). Molecular epidemiological study of Aspergillus fumigatus in a bone marrow transplantation unit by PCR amplification of ribosomal intergenic spacer sequences. Journal of Clinical Microbiology 36, 1294–9. Buttner, M. P., Cruz-Perez, P. & Stetzenbach, L. D. (2001). Enhanced detection of surface-associated bacteria in indoor environments using quantitative PCR. Applied and Environmental Microbiology. In press. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. et al. (1995). Current Protocols in Molecular Biology. Brooklyn: John Wiley & Sons, Inc. Bridge, P. D. & Arora, D. K. (1998). Interpretation of PCR methods for species definition. In Applications of PCR in Mycology (Bridge, P. D., Arora, D. K., Reddy, C. A. & Elander, R. P., eds). Pp. 63–84. New York: CAB International.
88
P. Cruz-Perez et al.
28. Edel, V. (1998). Polymerase chain reaction in mycology: an overview. In Applications of PCR in Mycology (Bridge, P. D., Arora, D. K., Reddy, C. A. & Elander, R. P., eds). Pp. 1–20. New York: CAB International. 29. Gaskell, G. J., Carter, D. A., Britton, W. J., Tovey, E. R., Benyon, F. H. L. & Løvborg, U. (1997). Analysis of the internal transcribed spacer regions of ribosomal DNA in common airborne allergenic fungi. Electrophoresis 18, 1567–9. 30. Henry, T., Iwen, P. C. & Hinrichs, S. H. (2000). Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. Journal of Clinical Microbiology 38, 1510–5. 31. Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A. & Kabani, A. M. (1999). Rapid identification of
fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. Journal of Clinical Microbiology 37, 1846–51. 32. Brandt, M. E., Padhye, A. A., Mayer, L. W., & Holloway, B. P. (1998). Utility of random amplified polymorphic DNA PCR and TaqMan automated detection in molecular identification of Aspergillus fumigatus. Journal of Clinical Microbiology 36, 2057–62. 33. Loeffler, J., Henke, N., Hebart, H., Schmidt, D., Hagmeyer, L., Schumacher, U. et al. (2000). Quantification of fungal DNA by using fluorescence resonance energy transfer and the Light Cycler system. Journal of Clinical Microbiology 38, 586–90. 34. Orlando, C., Pinzani, P. & Pazzagli, M. (1998). Developments in quantitative PCR. Clinical Chemistry and Laboratory Medicine 36, 255–69.