Detection of debrisoquine hydroxylation phenotypes

1452

be possible in this case to increase the sensitivity by further rounds of amplification. Schwartz et al correctly point out that this procedure allows a large number of mutations for various genetic diseases to be tested with a single Guthrie card but an even greater advantage of this procedure is that it eliminates the need for tedious and timeconsuming methods for extracting DNA from individual blood spots. Hence this procedure greatly reduces the time and complexity of PCR analysis of Guthrie blood spots, thus increasing the number of samples that can conveniently be handled, and thereby increasing the feasibility of large scale screening for genetic

diseases. PAUL V. NELSON WILLIAM F. CAREY C. PHILLIP MORRIS

Department of Chemical Pathology, Adelaide Children’s Hospital, South Australia 5006

1. Kerem B, Rommens JM, Buchanan JA, et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989; 248: 1073-80.

Mitochondrial mutation in fatal infantile

cardiomyopathy SIR,-Patients with myoclonus epilepsy associated with ragged-red fibres have an A-to-G transition in mitochondrial DNA (mtDNA). The mutation alters the structure of the transfer RNA molecule that transmits the instructions for lysine synthesis; as a result, mitochondrial protein synthesis is affected, leading to a bioenergetic dysfunction. We have identified a similar mutation in a patient with fatal infantile cardiomyopathy associated with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS type). A 1-year-old boy

was admitted to hospital because of general weakness. He was an only child of non-consanguineous healthy parents. Chest radiography revealed severe cardiomegaly. A lumbar tap was attempted, but was accompanied by cardiac arrest. After 10 min resuscitation, consciousness returned. The boy had anaemia, metabolic acidosis, and increased transaminase, lactate dehydrogenase, and creatine kinase activities. An electrocardiogram revealed premature ventricular contraction. Bradycardia developed with convulsions and the boy died from cardiac failure on the 7th hospital day. Severe dilatation and hypertrophy of the left ventricle was found at necropsy. The heart weighed 145 g (normal control 42 g) and was not infiltrated with inflammatory cells. Individual myocardial cells were swollen. The brain, liver, and lungs showed changes associated with congestive heart failure. There was individual cell necrosis and basophilic degeneration in the skeletal muscle. The kidneys contained several acidophilic casts, especially in the distal convoluted tubules, consistent with rhabdomyolysis.

Normal

Cardtomyopathy tRNA"’

tRNA"

A-lie C

A-Ile C

A A=U Aminoacyl G--_C C acceptor stem A=U A=U A=U A U=A TljlCloop A=U C-o
C’’ U=A

A A=U C G-C A=U A=U A=U A U=A A=U

u

U=A

AGGAGCUU

"

U

UA

II 11111 U AAA AGA

G

AUA U=A U=A A=U C=G U=A

U=A

GAU

m # III III # 111111

AG UCU

A=U L’=(j U-A GG A

U

"

UCCCCC r;,AA

U G

U=AG U

Anticodon

Anticodon loop

Comparison of normal

GAU

and mutant

tRNAlle.

Bars indicate hydrogen bonds; # indicates non-standard base pairs found in mtRNA. Nucleotides A (normal) and G (mutation) at position 4317 are highlighted.

On the suspicion of mitochondrial cardiomyopathy, mtDNA from the patient’s heart was analysed but no definite deletions were found. When we studied the mtDNA by fluorescent-based automated direct sequencing our findings included an A-to-G transition at position 4317 in the isoleucine (tRNA"" gene. We calculated that this mutation adds a G = C base pair to the stem of the TTC loop and shortens the loop itself (figure). This mutation creates an Afl II restriction site, absent in twenty-eight controls. Analyses of enzyme activities and subunit amounts in the isolated mitochondria from the patient’s heart revealed combined defects of complex I (NADH-ubiquinone oxidoreductase) and complex IV (cytochrome c oxidase) of the respiratory chain. The severe defects in the respiratory chain and the early development of heart failure in this case are in striking contrast to the mild defects in the respiratory chain and the late onset of symptoms associated with the tRNAL’’s mutation. 1,2 The accumulation of mutant mtDNAs seems to be an important contributor to adult-onset cardiomyopathy. Some forms of infantile cardiomyopathy may be caused by point mutations of mtDNA. We thank Dr Satoshi Horai (National Institute of Genetics, Mishima, Japan) and Dr Sangkot Marzuki (Monash University, Clayton, Australia) for providing mtDNAs from disease controls. Supported in part by the grants 62570128 to M. T. and 01617002 to T. 0., from the Ministry of Education, Science, and Culture and by grant 01-02-39 from the Ministry of Health and Welfare to T. 0.

Department of Biomedical Chemistry, Faculty of Medicine, University of Nagoya, Nagoya 466, Japan

MASASHI TANAKA HIDEKAZU INO KINJI OHNO KAZUKI HATTORI WATARU SATO TAKAYUKI OZAWA

Department of Paediatrics, Saitama Medical Centre

TAIHEI TANAKA

Department of Pathology,

SHINJI ITOYAMA

Saitama Medical Centre

1. Shoffner JM, Lott MT, Lezza AMS, et al. Myotonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNALys mutation. Cell

1990; 61: 931-37. M, Tanno Y, Horai S, et al. A common mitochondrial DNA mutation in the t-RNALys of patients with myoclonus epilepsy associated with ragged-red fibers. Biochem Int 1990; 27: 789-96. 3. Ozawa T, Tanaka M, Sugiyama S, et al. Multiple mitochondrial DNA deletions exist in cardiomyocytes of patients with hypertrophic or dilated cardiomyopathy. Biochem Biophys Res Commun 1990; 170: 830-36.

2. Yoneda

Detection of debrisoquine

hydroxylation

phenotypes SIR,-Dr Heim and Professor Meyer (Sept 1, p 529) and Dr Daly and her colleagues (Oct 6, p 889) describe the development of a DNA based assay to identify 95% of individuals with a genetic defect at the cytochrome P450 debrisoquine hydroxylase locus. The potential of this assay lies in its ability to identify individuals at risk of side-effects from many important therapeutic agents. The description of this assay has been complicated by attempts to associate mutations in the debrisoquine hydroxylase (CYP2D6) gene with restriction fragment length polymorphisms (RFLPs), some of which had been shown to be in linkage disequilibrium with the poor metaboliser (PM) phenotype. We have described a strategy which substantially simplifies this test and does not require the use of RFLPs.1 Heim and Meyer’s and our work’ has associated three mutant alleles with this polymorphism: a gene deletion (allele frequency in PMs about 10%), a G to A transition at the junction of intron 3/exon 4 (allele frequency in PMs about 85%), and a base-pair (bp) deletion in exon 5 (allele frequency about 5%). Two polymerase chain amplification reactions (PCR) followed by restriction enzyme digestion allow the identification of almost all PM individuals carrying these mutant alleles. The assay is quick and easy to use and 100 blood samples can be processed by an individual in one day. In the first PCR’ individuals homozygous for the G to A transition or heterozygotes for this mutation and the gene deletion

1453

identified. In the second PCR a mismatched oligonucleotide primer GATGAGCTGCTAACTGAGCCC (which hybridises are

at

positions

2616-2636 in the CYP2D6

gene2

is used

to

introduce an Msp I site in the PCR product derived from individuals containing the mutation in exon 5 (Heim and Meyer). The second primer for the PCR is derived from intron 5:

(CCGAGAGCATACTCGGGAC, bp 2885-2867). Msp

I

digestion gives fragments of 21 plus 166 plus 82, and 188 plus 82 bp for the mutant and normal alleles, respectively. The only known mutations in PMs not identified by these two PCRs are in those who are homozygous for the gene deletionabout 1-2% of the PMs. These individuals can be identified if necessary.1 Whether there are further rare mutant alleles associated with the PM phenotype still remains to be established. ICRF Molecular Pharmacology Group, Hugh Robson Building, Edinburgh EH8 9XD, UK

C. R. WOLF J. E. Moss

Department of Biochemistry, University of Glasgow, Glasgow

J.

ICRF Human Genetic Resources Laboratory, Clare Hall Laboratories, South Mimms

A. C. GOUGH N. K. SPURR

in the proteinuria group than in an age-matched healthy population (0-88 [0’15] mg/dl) (p < 0.050). The calculated creatinine clearance5 of the 3 patients with the most frequent proteinuria episodes all lay between the 10th and the 90th percentile.6 Serum creatine kinase activity was increased concomitantly with the proteinuria in 3 patients, but the increase was less than twice the

mg/dl)

upper reference limit. Transaminase levels were increased at the time of the proteinuria in only 2 patients, and again the increase was less than twice the upper limit of normal. The increase in enzyme

activity was independent of the degree of proteinuria. Our findings strongly suggest a relation between simvastatin intake and the development of a selective glomerular-type proteinuria. Physicians should bear in mind the nephrotoxic potential of this widely used drug. Departments of Endocrinology and Clinical Chemistry, State University Hospital, 9000 Gent, Belgium

J. P. DESLYPERE J. DELANGHE A. VERMEULEN

S. MILES

1. Cough AC, Miles JS, Spurr NK, et al. Identification of the primary gene defect at the cytochrome P450 CYP2D locus. Nature 1990; 347: 773. 2. Kimura S, Uemo M, Skoda RC, Meyer UA, Gonzalez FJ. The human debrisoquine 4-hydroxylase (CYP2D) locus; sequence and identification of the polymorphic CYP2D6 gene a related gene and a pseudogene. Am J Hum Genet 1989; 45: 889-904.

Proteinuria as complication of simvastatin treatment SIR,-During the past three years we have used simvastatin (20-40 by mouth in the evening) to treat 70 men and 50 women with basal serum total cholesterol concentrations above 8 mmol/1 (320 mg/dl). In 7 women and 3 men we observed proteinuria on one or more occasions. These patients were on the 40 mg dose. They were no older (47 [SD 15] vs 49 [16] years) than the group as a whole and body mass index was similar (24-2 [4’1] vs 24-0 [5’3] kg/m2). The serum total cholesterol level before treatment was 9-9 [1.4] mmol/l. 5 patients were taking additional medications-namely, atenolol (2), dipyridamole (2), aspirin (2), and combined oral contraceptive, oestriol, nitrates, and nifedipine (1each). 2 men and 1 woman had a history of coronary heart disease. The patients were seen every 3 months for lipid and routine chemical analyses. All 10 patients had had normal hepatic, renal, and thyroid mg

function tests at the start of the simvastatin treatment. None had a history of diabetes or was engaged in heavy exercise. The mean proteinuria was 0 49 [0’31] g/1 by the biuret method, preceded by precipitation with trichloroacetin acid, on a morning urine specimen. The biuret method is sensitive and accurate1 and is not influenced by the drugs used by our patients. 4 patients had persisting proteinuria and the other 6 had twelve episodes of proteinuria (0-33 [0’13] g/1) in fourty-four subsequent follow-up visits during treatment spread over 6-21 months. Electrophoresis revealed mainly albumin and transferrin loss, a pattern typical for increased glomerular permeability. Quantitative immunonephelometry2 in the urine of 3 patients with persistent proteinuria confirmed the presence of albumin. The three highest albumin excretions were 0385, 0-254, and 0-124 g/l. Urinary concentration of transferrin (respectively 20, 15, and 11 mg/1) and (IgG 54, 3-6, and 1 mg/1) were also increased. Urinary concentrations of retinol-binding protein, which is normally reabsorbed by the tubulus, were below the detection limit of 1 mg/1. The mean selectivity index3 in the 10 patients with proteinuria was 0-064 (0-027), and index lower than 0-100 being characteristic of highly selective glomerular-type proteinuria.3 In 2 patients a challenge test was done. 1 patient stopped taking simvastatin for 2 and another for 6 months, both for non-drug related causes. In both the proteinuria disappeared, and it reappeared when simvastatin 40 mg daily was reintroduced. Creatinine levels in serum4 did not vary during the treatment, but the serum creatinine levels were significantly higher (1-15 [044]

1. Tietz NW. Fundamentals of clinical chemistry, 3rd ed. Philadelphia: WB Saunders, 1987. 2. Fink PC, Romer M, Haeckel R, et al. Measurements of proteins with the Behring a multicentre evaluation. J Clin Chem Clin Biochem 1989; 27: 261-76. 3. Cameron JS, Blanford G. The simple assessment of selectivity in high proteinuria. Lancet 1966; ii: 242-47. 4. Bartels H, Boechmer M, Heierli C. Serum Creatinine Bestimmung ohne Enteiweissen. Clin Chim Acta 1972; 37: 193-97. 5. Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine.

nephelometer:

Nerphron 1976; 16: 31-44. 6. Elseviers M, Verpooten G, De Broe M, De Backer G. clearance. Lancet 1987; ii: 457.

Medical rubber

Interpretation of creatinine

anaphylaxis

SIR,-Systemic reactions from contact with rubber products have been linked to IgE-mediated allergy to raw latex preparations. In the past (eg, for latex surgical gloves) the main allergen resulting in rubber contact dermatitis, sometimes with systemic effects, was the vulcanisation accelerator 2-mercaptoenzothiazole (MBT).2,3 Twice, in my diagnostic radiology practice, clusters of reactions, including anaphylaxis, have been linked to contamination of urographic contrast agents by MET leached from rubber seals of disposable syringes and pharmaceutical vials.3 2-carboxymethylthiobenzothiazole (CMB) is a direct byproduct of MET, when pharmaceutical rubber is subjected to intense sterilisation with ethylene oxide. CMB, leached primarily from disposable syringes and infusion sets, reached potentially toxic concentrations in the blood of 91 infants on a London paediatric ward.4 Less intense ethylene oxide sterilisation would result in some, or much, of the MET being unaltered, so toxic, allergenic MET could have reached similar concentrations. In 1982, MET was implicated in cell death in culture when it leached from the rubber plungers of Japanese disposable plastic syringes. The manufacturer promptly converted to MBT-free plunger material.5 This elimination of the MBT risk may explain the apparently significant drop in mortality from anaphylactoid reactions to intravenous urographic ionic contrast agents in a large Japanese study that began on Sept 1, 1986.6,7 In this same period, might Japan have experienced a related reduction in fatal reactions to other injected pharmaceuticals once MET was eliminated from syringes? Will North America see a significant reduction in "anaphylactoid" parenteral drug reactions as supplies of syringes (including, in particular, pre-loaded unit dose types3) are used up? In North America severe allergic reactions have been encountered when disposable inflatable latex retention cuffs were used for barium enemas, and before any barium had been injected. This caused one manufacturer (E-Z-M), in conjunction with the US Food and Drug Administration, to issue an urgent recall of their inflatable retention cuffs. Raw latex often uses a sulphite as a preservative,l and sulphites predispose to systemic allergic reactions, some fatal.8 Rubber is manufactured by a crude batch processing technique that often leaves inclusions of incompletely mixed leachable raw materials,3,9 a worrying property for pharmaceutical rubber meant to come in contact with parenteral agents.3 The rectal mucosa is an excellent