- Email: [email protected]
Detection of Echinococcus multilocularis in foxes in The Netherlands
Veterinary Parasitology 82 (1999) 49±57
Detection of Echinococcus multilocularis in foxes in The Netherlands J.W.B. van der Giessen*, Y.B. Rombout, J.H. Franchimont, L.P. Limper, W.L. Homan Institute of Public Health and the Environment (RIVM), Microbiological Laboratory for Health Protection, P.O. Box 1, 3720 BA Bilthoven, The Netherlands Received 2 October 1998; accepted 10 December 1998
Abstract Echinococcus multilocularis was demonstrated in 5 out of 272 foxes in The Netherlands close to the border with Germany and Belgium. Besides microscopic examination of mucosal scrapings, two different PCR assays were used based on the detection of E. multilocularis DNA in colon content. Two distinct areas in The Netherlands were positive for E. multilocularis. Two positive foxes were found in the northern province of Groningen and three positive foxes were found in the southern province of Limburg. Both PCR assays detected more positive foxes compared to microscopic examination of the intestinal content. This is the first report of E. multilocularis in foxes occurring in The Netherlands. # 1999 Elsevier Science B.V. All rights reserved. Keywords: Echinococcus multilocularis; Fox; PCR; Epidemiology; Nematoda; The Netherlands
1. Introduction Alveolar echinococcosis, caused by the larval stage of Echinococcus multilocularis, is a serious parasitic zoonosis.The two-host parasitic life cycle of this tapeworm is mainly sylvatic, eggs shed by the canid definite host, mainly the red fox in Europe, develop to the larval or metacestode stage after uptake by arvicolid rodents that serve as intermediate hosts (Ammann and Eckert, 1996). However, in accidental cases human beings may get infected by uptake of eggs and this may lead to a very serious disease in human beings,
* Corresponding author. Tel.: +31-30-2743926; fax: +31-30-2744434; e-mail: [email protected] 0304-4017/99/$ ± see front matter # 1999 Elsevier Science B.V. All rights reserved. PII: S 0 3 0 4 - 4 0 1 7 ( 9 8 ) 0 0 2 6 3 - 5
50
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
alveolar echinococcosis. Although the transmission routes to human beings are not clearly understood and the susceptibility for human beings of this parasite is assumed to be limited (Tackman et al., 1998), measures to prevent human infection are of major importance. The determination of the prevalence of E. multilocularis in definite hosts is an important parameter to estimate the potential infection risk of human beings in endemic areas (Deplazes and Eckert, 1996). In Europe, a relatively small endemic area is located in Germany, Switzerland, Austria and France, where alveolar echinococcosis is known since 1855 (Virchow, 1855). Although it was assumed that E. multilocularis is concentrated in the colder climates of the world (Schantz et al., 1995) including the mountainous areas in middle Europe (Eckert, 1989), a possible spread of the parasite into regions formerly not known to be endemic areas, is recognized (Lucius and Bilger, 1995; Malczewsky et al., 1995). Studies in Belgium showed a prevalence of 51% in the province of Luxembourg (Losson et al., 1997) and in the states in Germany close to the border areas with The Netherlands, an average prevalence of 17.7% in NordrheinWestfalen, 27.8±33.1% in Rheinland and 17.8% in Lower-Saxony were reported (Lucius and Bilger, 1995). In The Netherlands, foxes have been present for centuries in the eastern and southern part of the country and the fox populations here are considered to be continuous with those in Germany and Belgium (Mulder, 1985). Since 1970 foxes have been spreading to the western part of the country and have now definitely settled in the coastal areas (Mulder, 1992). E. multilocularis has been never found in The Netherlands in foxes, although no studies were carried out since 1984 (Borgsteede, 1984). Recently, the first human case has been diagnosed in The Netherlands, although it seems likely that this patient was infected in Switzerland, the country where he was born and lived for 20 years (Raasveld et al., 1997). The classical and still most reliable method for detection of E. multilocularis in definite hosts is the microscopic examination of mucosal smears derived from the small intestines after necropsy (Deplazes and Eckert, 1996). However, this method is laborious and can only be carried out postmortem. More recently, other diagnostic assays have been described including serological assays (Gottstein et al., 1991), a coproantigen ELISA detection method (Deplazes et al., 1992; Deplazes and Eckert, 1996), and PCR based detection of E. multilocularis eggs in fecal samples of foxes (Bretagne et al., 1993; Mathis et al., 1996; Monnier et al., 1996; Dinkel et al., 1998). PCR based methods have the advantage that they can be used on feces of living animals, even after freezing of the fecal material to reduce infection risks (Veit et al., 1995). In this report we describe the presence of E. multilocularis in an area in The Netherlands, adjacent to Germany and Belgium. Besides the use of microscopy to detect E. multilocularis, two different PCR based methods were used on colon content to determine their usefulness in an area where E. multilocularis may be sporadic. One PCR assay was based on primers described by Bretagne et al. (1993). The other was the recently described nested PCR assay (Dinkel et al., 1998). However, this PCR assay was modified in a single tube nested PCR. This has the advantage of the increased sensitivity of a nested PCR but without the contamination risks of a nested PCR assay. For both PCR methods, we developed and used the same sample preparation method.
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
51
2. Material and methods 2.1. Animals Red foxes shot by hunters from October 1996 to March 1997 were sent to the National Institute of Public Health and the Environment within 24 h. Carcasses were frozen at ÿ208C followed by deep freezing at ÿ808C for 1 week, prior to necropsy. At necropsy, small intestines and content of colon were removed and frozen again at ÿ808C for at least 1 week prior to parasitological examination. The age of foxes was determined as adult (born in previous year) or juvenile (born in current year) according to Wagenknecht (1979). Strict safety precautions were taken during handling of the animals, necropsy and parasitological examinations to avoid or exclude infection risk (Eckert et al., 1991; Eckert and Deplazes, 1996). 2.2. DNA isolation from fecal colon content 1 g of fecal colon content of foxes was suspended in 1 ml of 50 mM Tris±HCl (pH 8.0), 10 mM EDTA (T50E10), 0.5% SDS and boiled for 10 min. After proteinase K treatment (1 mg/g feces) the suspension was extracted by phenol, phenol chloroform and chloroform. Afterwards, DNA was precipitated with isopropanol as described previously (Sambrook et al., 1989). The DNA pellet was washed in 70% ethanol and dissolved in 100 ml 10 mM Tris±HCl (pH 8.0), 1 mM EDTA (T10E1). DNA was purified from inhibitors by the guadinine/celite method described by Boom et al. (1990). The suspension with the eluted DNA and celite in 100 ml T10E1 was put onto a 2 ml Sephacryl S 500 spin column equilibrated in T10E1. After spinning the column for 5 min at 800g, 1 ml of the DNA solution was precipitated with isopropanol (Sambrook et al., 1989). The DNA was dissolved in 50 ml T10E1. 5 ml of this solution was used in the PCR. E. multilocularis DNA derived from Microtis arvalis, kindly provided by Dr. Bretagne, France, was used as positive control DNA. To investigate the specificity of the PCR based assays, DNA was isolated from Taenia crassiceps, T. saginata, T. taeniaeformis, and T. pisiformis, which were kindly provided by T. Romig, Germany and DNA of E. granulosus (two isolates, metacestode horse, England, and metacestode cow, The Netherlands) according to the method of Boom et al. (1990). The sensitivity of the PCR assays was estimated using three fecal samples of foxes with E. multilocularis worm burdens ranging from 6 to 50, and four fecal samples of foxes with E. multilocularis with worm burdens ranging from 51 to 1000, kindly provided by Dr. K. Tackman, Germany. One of these fecal samples contained E. multilocularis in the prepatent stage, the other fecal samples contained E. multilocularis in the patent stage. 2.3. Primers and amplification For rRNA which Em-1
the detection of E. multilocularis DNA a fragment of the 12 S mitochondrial gene was amplified by a nested PCR assay according to Dinkel et al. (1998), was modified as a single tube nested PCR assay. Primers were: outer primers and Em-2, 5 0 TAAGATATATGTGGTACAGGATTAGATACCC3 0 and
52
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
50 GGTGACGGGCGGTGTTGTA30 , respectively, and inner primers Em-3 and Em-4, 50 ATATTACAACAATATTCCTATC30 and 50 ATATTTTGTAAGGTTGTTCTA30 , respectively. PCR was optimized for pH, Mg and the concentrations of outer and inner primers. PCR was performed in 50 ml containing 60 mM Tris±HCl pH 9, 15 mM (NH4)2SO4, 0, 4 mM MgCl2, 100 mM of each dNTP, 8 nM of each primer Em-1 and Em-2, 0.5 mM of each primer Em-3 and Em-4 and 0.5 U SuperTaq (Sphearo-Q, Leiden, The Netherlands). The PCR cycle program consisted of an initial incubation at 948C for 5 min followed by 20 cycles of 1 min at 948C, 1 min at 658C and 1 min at 728C to amplify a fragment by the outer primers, directly followed by 35 cycles of 1 min at 948C, 1 min at 558C and 1 min at 728C to amplify the fragment flanked by the inner primers. After the last elongation step of 728C for 10 min, the samples were stored at 48C. A second PCR based on the amplification of U1snRNA was essentially performed as described by Bretagne et al. (1993) with the following modifications: the PCR mixtures (50 ml) contained 60 mM Tris±HCl pH 10, 15 mM (NH4)2SO4, 2 mM MgCl2, 100 mM of each dNTP, 0.5 mM of each primer and 1.0 U Taq polymerase (Perkin-Elmer). Samples were run in duplo and one part of the samples was routinely spiked with 100 fg of E. multilocularis DNA to detect inhibition. For the detection, 10 ml of PCR product was electrophoresed on 1.5% agarose gels in ethidium bromide as described previously (Sambrook et al., 1989). 2.4. Parasitological examination. Parasitological examination of the small intestines was carried out according to the methods recommended by the WHO Collaborating Center for Parasitic Zoonosis in Zurich (Eckert et al., 1991; Deplazes and Eckert, 1996). Small intestines were slit open in full length with scissors and the debris was removed with a forceps. Deep mucosal scrapings were taken using microscopic slides. Mucosal material was transferred to a square plastic petri dish and squashed on the bottom of the dish. About 15±18 smears of the proximal, middle and posterior part of the small intestines were microscopically examined. 3. Results A total of 272 foxes were examined by the microscopic examination of intestinal smears as well as by both PCR assays of colon content. Of these there were 85 adult and 183 juvenile foxes. The age of four foxes could not be determined. Five foxes were positive for E. multilocularis by both PCR assays. Of these five positive foxes, three animals were also positive by microscopy (Table 1). The positivity of the five positive fecal samples as detected by PCR was confirmed by the nested PCR assay followed by southern blot hybridization using an internal probe as described by Dinkel et al. (1998) (data not shown). The specificity of the U1snRNA PCR assay was tested using DNA from two E. granulosus strains. DNA isolated from the bovine strain of E. granulosus produced a PCR product of the same size as DNA from E. multilocularis (Fig. 1), indicating that the
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
53
Table 1 Results of the E. multilocularis positive foxes Fox number
Age
Sex
Location
Microscopy (worm burden)
Nested PCR
U1snRNA PCR
1. 2. 3. 4. 5.
Juvenile Adult Juvenile Juvenile Adult
Male Male Male Female Female
Limburg Limburg Groningen Limburg Groningen
± ± (30) (100) (1)
(49) (59) (156) (232) (255)
specificity of this PCR was limited. Therefore, the nested PCR amplifying part of the 12S mitochondrial rDNA as described by Dinkel et al. (1998) was modified to a single tube nested PCR, which after optimizing was capable of detecting 1 fg of purified DNA (data not shown). The size of the specific fragment after amplification of E. multilocularis was 242 bp, sometimes a second less prominent fragment of 310 bp was detected (Fig. 2). The specificity of the modified nested PCR assay was tested by using DNA isolated from a number of Taeniid species. Only E. granulosus DNA gave a product of approximately 380 bp, which could be clearly differentiated from the specific 242 bp amplified product by agarose gel electrophoresis analysis (Fig. 2). The sensitivity of the single tube nested PCR using our fecal preparation method was estimated by testing DNA, which was extracted from fecal samples of foxes with E. multilocularis worm burdens ranging from 6 to 50 and from 51 to 1000. Foxes, even those with low worm burdens, were tested positive for E. multilocularis except one with a prepatent infection (data not shown). The geographical distribution of the foxes examined is shown in Fig. 3. The positive foxes were found in two geographically distinct areas in The Netherlands. One in the northern province of Groningen, and the other in the most southern part of the province of Limburg.
Fig. 1. Specificity of the U1snRNA PCR assay. DNA from several Echinococcus species strains were amplified by the U1snRNA PCR and the amplified products were visualized on an ethidium bromide stained agars gel. Lane 1: E. granulosus bovine strain; lane 2: E. granulosus horse strain; lane 3: E. multilocularis; lane 4: negative control; M: molecular weight marker (Boehringer VI).
54
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
Fig. 2. Hundred pg of DNA from several Taeniid species were amplified by the single tube nested PCR. Amplified products were visualized on an ethidium bromide stained agarose gel. Lane 1: T. crassiceps; lane 2: T. saginata; lane 3: T. taeniaeformis; lane 4: T. pisiformis; lane 5: E. granulosus; lane 6: positive control; lane 7: negative control; M: molecular weight marker (Boehringer VI). In the lower panel lane 1±6: the same samples spiked with 100 fg of E. multilocularis DNA are shown.
4. Discussion By testing the 272 foxes, the sensitivity of both PCR assays was higher compared to microscopic examination. Dinkel et al. (1998) also found more positives by PCR compared to microscopy. They suggested that foxes with low worm burdens may be missed by microscopy but can be detected by PCR. This is even more important in areas where the presence of E. multilocularis is not known and occurs only sporadically. We detected only three foxes positive by microscopy and these foxes had only low numbers of worm burdens. Especially in sporadic areas, the PCR assays may be of value to estimate the presence of the parasite. The nested PCR on the 12S mitochondrial rDNA gene described by Dinkel et al. (1998) was specific for E. multilocularis. We modified the PCR assay in a single tube nested PCR assay, which resulted in a specific assay with a low contamination risk. For both nested and the U1snRNA PCR assays, the same fecal sample preparation method was used, which is based on the simultaneous inactivation and lysis of E. multilocularis eggs by boiling in SDS. Using this sample preparation method, we experienced no inhibition in our PCR assays in fox feces of different consistency, which may make this method suitable for testing fecal samples. Although about 20% of the fox intestines contained other Taeniae species, faecal samples of these animals were negative by PCR assays indicating a high specificity of these tests. The limited specificity of the U1snRNA based PCR using E. granulosus DNA from two different strains might be due to
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
55
Fig. 3. Geographical distribution of negative (*) and positive (~) tested foxes for E. multilocularis in The Netherlands.
polymorphism in the primer recognition site of E. granulosus strains, which was not detected by Bretagne et al. (1993). Clearly, the negative PCR reaction after testing the bovine strain of E. granulosus was not due to the quality of the DNA as the same DNA sample produced an amplified fragment using the single tube nested PCR. The five positive foxes were detected in two distinct areas in The Netherlands. One area was located in the northern province of Groningen. The size of this investigated area
56
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
was about 1100 km2. The estimated prevalence in Groningen is 5.5% (range 0±15.9% with 99% confidence interval (CI)). The other three positive foxes came from one area in the southern province of Limburg. The size of this area is about 768 km2 and the estimated prevalence of E. multilocularis is 13.6% (range 4.8±22.3%, 99% C.I.). This is the first report describing the presence of E. multilocularis in foxes in The Netherlands. These results indicate that E. multilocularis may even spread to more western areas in Europe. Until now there is no evidence of transmission to human beings in The Netherlands, although the lack of human cases could be due to other factors, for example, the long incubation period (5±15 years) if the parasite has been recently introduced in The Netherlands, little contact to the infection sources, or strain variations of E. multilocularis. Based on the results in areas in Germany where E. multilocularis occurs sporadically (Tackman et al., 1998), until now the risk for public health in The Netherlands is considered to be limited. Acknowledgements This study was carried out on behalf of the Veterinary Inspection, Ministry of Public Health, Welfare and Sports. We are grateful to M. Montizaan of the Royal Dutch Shooting Society and hunters participating for collecting the foxes. We thank C. Moolenbeek and B. Arends for their technical assistance and A. van der Veen for the spatial data handling and mapping of the results. Furthermore, we thank K. Tackman and colleagues for their help with the instructions of the microscopic methods and the critical discussions and A. Dinkel and T. Romig for the primer information and the confirmation of the DNA samples. References Ammann, R.W., Eckert, J., Cestodes Echinococcus. Gastroenterology Clinics of North America, vol. 25. pp. 655±689. Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., VandeNoordaa, J., 1990. A rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495±503. Borgsteede, F.H.M., 1984. Helminth parasites of wild foxes (Vulpes vulpes) in The Netherlands. Z. Parasitenkd 70, 281±285. Bretagne, S., Guillou, J.P., Morand, M., Houin, R., 1993. Detection of Echinococcus multilocularis DNA in fox feces using DNA amplification. Parasitology 106, 193±199. Deplazes, P., Gottstein, B., Eckert, J., Jenkins, D.J., Ewald, D., Jiminez-Palacios, S., 1992. Detection of Echinococcus coproantigens by enzyme-linked immunosorbent assay in dogs, dingoes and foxes. Parasitol. Res. 78, 303±308. Deplazes, P., Eckert, J., 1996. Diagnosis of the Echinococcus multilocularis infection in final hosts. Appl. Parasitol. 37, 245±252. Dinkel, A., Von Nickisch-Rosenegk, M., Bilger, B., Merli, M., Lucius, R., Romig, T., 1998. Echinococcus multilocularis in the definite host: coprodiagnosis by PCR is an alternative to necropsy. J. Clin. Microbiol. 36, 1871±1876. Eckert, J., 1989. Prevalence and geographical distribution of Echinococcus multilocularis infection in human beings and animals in Europe. WHO informal Consultation on alveolar echinococcosis, 14±16 August 1989, Hohenheim (WHO/VPH/ECHIN.RES./WP/89.4).
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
57
Eckert, J., Deplazes, P., Ewald, D., Gottstein, B., 1991. Parasitologische und immunologische Methoden zum È sterreichischen Gesellschaft Nachweis von Echinococcus multilocularis bei FuÈchsen. Mitteillungen der O fur Tropenmedizin und Parasitologie 13, 25±30. Eckert, J., Deplazes, P., 1996. Methods for surveys on Echinococcus multilocularis in final hosts. In: Uchino, J., Sato, N. (Eds.), Alveolar Echinococcosis: strategy for eradication of alveolar echinococcosis of the liver. Fuji Shoin, pp. 151±163. Gottstein, B., Desplazes, P., Eckert, J., MuÈller, B., Schott, E., Helle, O., Boujon, P., Wolff, K., Wandeler, A., Schwiete, U., MoÈgle, H., 1991. Serological (Em2-ELISA) and parasitological examinations of fox populations for Echinococcus multilocularis. J. Vet. Med. B 38, 161±168. Losson, B., Mignon, B., Brochier, B., Baudien, B., Pastoret, P.P., 1997. Echinococcus multilocularis infection in the red fox (Vulpes vulpes) in the province of Luxembourg (Belgium): results of a survey conducted between 1993 and 1995. Ann. Med. Vet. 141, 149±155. Lucius, R., Bilger, B., 1995. Echinococcus multilocularis in Germany: increased awareness or spreading of a parasite?. Parasitol. Today 11, 430±433. Malczewsky, A., Rocki, B., Ramisz, A., Eckert, J., 1995. Echinococcus multilocularis (Cestoda), the causative agent of alveolar echinococcus in human beings: first record in Poland. J. Parasitol. 8, 318±321. Mathis, A., Deplazes, P., Eckert, J., 1996. An improved test system for PCR-based specific detection of Echinoccous multilocularis eggs. J. Helminthol. 70, 219±222. Monnier, Ph., Cliquet, F., Aubert, M., Bretagne, S., 1996. Improvement of a polymerase chain reaction assay for the detection of Echinococcus multilocularis DNA in fecal samples of foxes. Vet. Parasitol. 67, 185±195. Mulder, J., 1985. Spatial organization, movements and dispersal in Dutch red fox (Vulpes vulpes) population: some preliminary results. Rev. Ecol. (Terre Vie) 40, 133±138. Mulder, J., 1992. Vos Vulpes Vulpes. In: Broekhuizen, S., Hoekstra, B., Van Laar, V., Smeenk, C., Thissen, J.B.M. (Eds.), Atlas van de Nederlandse Zoogdieren. Stichting Uitgeverij Koninklijke Nederlandse Natuurhistorische Vereniging, pp. 126±132. Raasveld, M.H.M., Ponsioen, C.Y., Den Boer, S., Schipper, H.G., Kager, P.A., 1997. A patient with alveolar echinococcosis (Echinococcus multilocularis infection). Ned. Tijdschr Geneesk 141, 1007±1010. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press. Schantz, P.M., Chai, J., Craig, P.S., Eckert, J., Jenkins, D.J., Macphersons, C.N.L., Thaker, A., 1995. Epidemiology and control of hydatid disease. In: Thompson, R.C.A., Mymbery, A.J. (Eds.), Echinococcus and Hydatid Disease. CAB International, Wallingford, Oxon, UK, pp. 233±331. Tackman, K., LoÈschner, U., Mix, H., Staubach, C., Thulke, H.H., Conraths, F.J., 1998. Spatial distribution patterns of Echinococcus multilocularis (Leuckart 1863) (Cestoda: Cyclophyllidea: Taeniidae) among red foxes in an endemic focus in Brandenburg, Germany. Epidemiol. Infect. 120, 101±109. Veit, P., Bilger, B., Schad, V., Schafer, J., Frank, W., Lucius, R., 1995. Influence of environmental factors on the infectivity of Echinococcus multilocularis eggs. Parasitology 110, 79±86. Virchow, R., 1855. Die multiloculaÈre ulcierende Echinokokkengewulst der Leber. Verhandlungen der Physiologisch-Medizinischen Gesellschaft WuÈrzburg 6, 428±429. Wagenknecht, E., 1979. Alterbestimmungen des erlegten Wildes, 5th ed. Melsungen, Berlin.
Detection of Echinococcus multilocularis in foxes in The Netherlands J.W.B. van der Giessen*, Y.B. Rombout, J.H. Franchimont, L.P. Limper, W.L. Homan Institute of Public Health and the Environment (RIVM), Microbiological Laboratory for Health Protection, P.O. Box 1, 3720 BA Bilthoven, The Netherlands Received 2 October 1998; accepted 10 December 1998
Abstract Echinococcus multilocularis was demonstrated in 5 out of 272 foxes in The Netherlands close to the border with Germany and Belgium. Besides microscopic examination of mucosal scrapings, two different PCR assays were used based on the detection of E. multilocularis DNA in colon content. Two distinct areas in The Netherlands were positive for E. multilocularis. Two positive foxes were found in the northern province of Groningen and three positive foxes were found in the southern province of Limburg. Both PCR assays detected more positive foxes compared to microscopic examination of the intestinal content. This is the first report of E. multilocularis in foxes occurring in The Netherlands. # 1999 Elsevier Science B.V. All rights reserved. Keywords: Echinococcus multilocularis; Fox; PCR; Epidemiology; Nematoda; The Netherlands
1. Introduction Alveolar echinococcosis, caused by the larval stage of Echinococcus multilocularis, is a serious parasitic zoonosis.The two-host parasitic life cycle of this tapeworm is mainly sylvatic, eggs shed by the canid definite host, mainly the red fox in Europe, develop to the larval or metacestode stage after uptake by arvicolid rodents that serve as intermediate hosts (Ammann and Eckert, 1996). However, in accidental cases human beings may get infected by uptake of eggs and this may lead to a very serious disease in human beings,
* Corresponding author. Tel.: +31-30-2743926; fax: +31-30-2744434; e-mail: [email protected] 0304-4017/99/$ ± see front matter # 1999 Elsevier Science B.V. All rights reserved. PII: S 0 3 0 4 - 4 0 1 7 ( 9 8 ) 0 0 2 6 3 - 5
50
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
alveolar echinococcosis. Although the transmission routes to human beings are not clearly understood and the susceptibility for human beings of this parasite is assumed to be limited (Tackman et al., 1998), measures to prevent human infection are of major importance. The determination of the prevalence of E. multilocularis in definite hosts is an important parameter to estimate the potential infection risk of human beings in endemic areas (Deplazes and Eckert, 1996). In Europe, a relatively small endemic area is located in Germany, Switzerland, Austria and France, where alveolar echinococcosis is known since 1855 (Virchow, 1855). Although it was assumed that E. multilocularis is concentrated in the colder climates of the world (Schantz et al., 1995) including the mountainous areas in middle Europe (Eckert, 1989), a possible spread of the parasite into regions formerly not known to be endemic areas, is recognized (Lucius and Bilger, 1995; Malczewsky et al., 1995). Studies in Belgium showed a prevalence of 51% in the province of Luxembourg (Losson et al., 1997) and in the states in Germany close to the border areas with The Netherlands, an average prevalence of 17.7% in NordrheinWestfalen, 27.8±33.1% in Rheinland and 17.8% in Lower-Saxony were reported (Lucius and Bilger, 1995). In The Netherlands, foxes have been present for centuries in the eastern and southern part of the country and the fox populations here are considered to be continuous with those in Germany and Belgium (Mulder, 1985). Since 1970 foxes have been spreading to the western part of the country and have now definitely settled in the coastal areas (Mulder, 1992). E. multilocularis has been never found in The Netherlands in foxes, although no studies were carried out since 1984 (Borgsteede, 1984). Recently, the first human case has been diagnosed in The Netherlands, although it seems likely that this patient was infected in Switzerland, the country where he was born and lived for 20 years (Raasveld et al., 1997). The classical and still most reliable method for detection of E. multilocularis in definite hosts is the microscopic examination of mucosal smears derived from the small intestines after necropsy (Deplazes and Eckert, 1996). However, this method is laborious and can only be carried out postmortem. More recently, other diagnostic assays have been described including serological assays (Gottstein et al., 1991), a coproantigen ELISA detection method (Deplazes et al., 1992; Deplazes and Eckert, 1996), and PCR based detection of E. multilocularis eggs in fecal samples of foxes (Bretagne et al., 1993; Mathis et al., 1996; Monnier et al., 1996; Dinkel et al., 1998). PCR based methods have the advantage that they can be used on feces of living animals, even after freezing of the fecal material to reduce infection risks (Veit et al., 1995). In this report we describe the presence of E. multilocularis in an area in The Netherlands, adjacent to Germany and Belgium. Besides the use of microscopy to detect E. multilocularis, two different PCR based methods were used on colon content to determine their usefulness in an area where E. multilocularis may be sporadic. One PCR assay was based on primers described by Bretagne et al. (1993). The other was the recently described nested PCR assay (Dinkel et al., 1998). However, this PCR assay was modified in a single tube nested PCR. This has the advantage of the increased sensitivity of a nested PCR but without the contamination risks of a nested PCR assay. For both PCR methods, we developed and used the same sample preparation method.
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
51
2. Material and methods 2.1. Animals Red foxes shot by hunters from October 1996 to March 1997 were sent to the National Institute of Public Health and the Environment within 24 h. Carcasses were frozen at ÿ208C followed by deep freezing at ÿ808C for 1 week, prior to necropsy. At necropsy, small intestines and content of colon were removed and frozen again at ÿ808C for at least 1 week prior to parasitological examination. The age of foxes was determined as adult (born in previous year) or juvenile (born in current year) according to Wagenknecht (1979). Strict safety precautions were taken during handling of the animals, necropsy and parasitological examinations to avoid or exclude infection risk (Eckert et al., 1991; Eckert and Deplazes, 1996). 2.2. DNA isolation from fecal colon content 1 g of fecal colon content of foxes was suspended in 1 ml of 50 mM Tris±HCl (pH 8.0), 10 mM EDTA (T50E10), 0.5% SDS and boiled for 10 min. After proteinase K treatment (1 mg/g feces) the suspension was extracted by phenol, phenol chloroform and chloroform. Afterwards, DNA was precipitated with isopropanol as described previously (Sambrook et al., 1989). The DNA pellet was washed in 70% ethanol and dissolved in 100 ml 10 mM Tris±HCl (pH 8.0), 1 mM EDTA (T10E1). DNA was purified from inhibitors by the guadinine/celite method described by Boom et al. (1990). The suspension with the eluted DNA and celite in 100 ml T10E1 was put onto a 2 ml Sephacryl S 500 spin column equilibrated in T10E1. After spinning the column for 5 min at 800g, 1 ml of the DNA solution was precipitated with isopropanol (Sambrook et al., 1989). The DNA was dissolved in 50 ml T10E1. 5 ml of this solution was used in the PCR. E. multilocularis DNA derived from Microtis arvalis, kindly provided by Dr. Bretagne, France, was used as positive control DNA. To investigate the specificity of the PCR based assays, DNA was isolated from Taenia crassiceps, T. saginata, T. taeniaeformis, and T. pisiformis, which were kindly provided by T. Romig, Germany and DNA of E. granulosus (two isolates, metacestode horse, England, and metacestode cow, The Netherlands) according to the method of Boom et al. (1990). The sensitivity of the PCR assays was estimated using three fecal samples of foxes with E. multilocularis worm burdens ranging from 6 to 50, and four fecal samples of foxes with E. multilocularis with worm burdens ranging from 51 to 1000, kindly provided by Dr. K. Tackman, Germany. One of these fecal samples contained E. multilocularis in the prepatent stage, the other fecal samples contained E. multilocularis in the patent stage. 2.3. Primers and amplification For rRNA which Em-1
the detection of E. multilocularis DNA a fragment of the 12 S mitochondrial gene was amplified by a nested PCR assay according to Dinkel et al. (1998), was modified as a single tube nested PCR assay. Primers were: outer primers and Em-2, 5 0 TAAGATATATGTGGTACAGGATTAGATACCC3 0 and
52
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
50 GGTGACGGGCGGTGTTGTA30 , respectively, and inner primers Em-3 and Em-4, 50 ATATTACAACAATATTCCTATC30 and 50 ATATTTTGTAAGGTTGTTCTA30 , respectively. PCR was optimized for pH, Mg and the concentrations of outer and inner primers. PCR was performed in 50 ml containing 60 mM Tris±HCl pH 9, 15 mM (NH4)2SO4, 0, 4 mM MgCl2, 100 mM of each dNTP, 8 nM of each primer Em-1 and Em-2, 0.5 mM of each primer Em-3 and Em-4 and 0.5 U SuperTaq (Sphearo-Q, Leiden, The Netherlands). The PCR cycle program consisted of an initial incubation at 948C for 5 min followed by 20 cycles of 1 min at 948C, 1 min at 658C and 1 min at 728C to amplify a fragment by the outer primers, directly followed by 35 cycles of 1 min at 948C, 1 min at 558C and 1 min at 728C to amplify the fragment flanked by the inner primers. After the last elongation step of 728C for 10 min, the samples were stored at 48C. A second PCR based on the amplification of U1snRNA was essentially performed as described by Bretagne et al. (1993) with the following modifications: the PCR mixtures (50 ml) contained 60 mM Tris±HCl pH 10, 15 mM (NH4)2SO4, 2 mM MgCl2, 100 mM of each dNTP, 0.5 mM of each primer and 1.0 U Taq polymerase (Perkin-Elmer). Samples were run in duplo and one part of the samples was routinely spiked with 100 fg of E. multilocularis DNA to detect inhibition. For the detection, 10 ml of PCR product was electrophoresed on 1.5% agarose gels in ethidium bromide as described previously (Sambrook et al., 1989). 2.4. Parasitological examination. Parasitological examination of the small intestines was carried out according to the methods recommended by the WHO Collaborating Center for Parasitic Zoonosis in Zurich (Eckert et al., 1991; Deplazes and Eckert, 1996). Small intestines were slit open in full length with scissors and the debris was removed with a forceps. Deep mucosal scrapings were taken using microscopic slides. Mucosal material was transferred to a square plastic petri dish and squashed on the bottom of the dish. About 15±18 smears of the proximal, middle and posterior part of the small intestines were microscopically examined. 3. Results A total of 272 foxes were examined by the microscopic examination of intestinal smears as well as by both PCR assays of colon content. Of these there were 85 adult and 183 juvenile foxes. The age of four foxes could not be determined. Five foxes were positive for E. multilocularis by both PCR assays. Of these five positive foxes, three animals were also positive by microscopy (Table 1). The positivity of the five positive fecal samples as detected by PCR was confirmed by the nested PCR assay followed by southern blot hybridization using an internal probe as described by Dinkel et al. (1998) (data not shown). The specificity of the U1snRNA PCR assay was tested using DNA from two E. granulosus strains. DNA isolated from the bovine strain of E. granulosus produced a PCR product of the same size as DNA from E. multilocularis (Fig. 1), indicating that the
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
53
Table 1 Results of the E. multilocularis positive foxes Fox number
Age
Sex
Location
Microscopy (worm burden)
Nested PCR
U1snRNA PCR
1. 2. 3. 4. 5.
Juvenile Adult Juvenile Juvenile Adult
Male Male Male Female Female
Limburg Limburg Groningen Limburg Groningen
± ± (30) (100) (1)
(49) (59) (156) (232) (255)
specificity of this PCR was limited. Therefore, the nested PCR amplifying part of the 12S mitochondrial rDNA as described by Dinkel et al. (1998) was modified to a single tube nested PCR, which after optimizing was capable of detecting 1 fg of purified DNA (data not shown). The size of the specific fragment after amplification of E. multilocularis was 242 bp, sometimes a second less prominent fragment of 310 bp was detected (Fig. 2). The specificity of the modified nested PCR assay was tested by using DNA isolated from a number of Taeniid species. Only E. granulosus DNA gave a product of approximately 380 bp, which could be clearly differentiated from the specific 242 bp amplified product by agarose gel electrophoresis analysis (Fig. 2). The sensitivity of the single tube nested PCR using our fecal preparation method was estimated by testing DNA, which was extracted from fecal samples of foxes with E. multilocularis worm burdens ranging from 6 to 50 and from 51 to 1000. Foxes, even those with low worm burdens, were tested positive for E. multilocularis except one with a prepatent infection (data not shown). The geographical distribution of the foxes examined is shown in Fig. 3. The positive foxes were found in two geographically distinct areas in The Netherlands. One in the northern province of Groningen, and the other in the most southern part of the province of Limburg.
Fig. 1. Specificity of the U1snRNA PCR assay. DNA from several Echinococcus species strains were amplified by the U1snRNA PCR and the amplified products were visualized on an ethidium bromide stained agars gel. Lane 1: E. granulosus bovine strain; lane 2: E. granulosus horse strain; lane 3: E. multilocularis; lane 4: negative control; M: molecular weight marker (Boehringer VI).
54
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
Fig. 2. Hundred pg of DNA from several Taeniid species were amplified by the single tube nested PCR. Amplified products were visualized on an ethidium bromide stained agarose gel. Lane 1: T. crassiceps; lane 2: T. saginata; lane 3: T. taeniaeformis; lane 4: T. pisiformis; lane 5: E. granulosus; lane 6: positive control; lane 7: negative control; M: molecular weight marker (Boehringer VI). In the lower panel lane 1±6: the same samples spiked with 100 fg of E. multilocularis DNA are shown.
4. Discussion By testing the 272 foxes, the sensitivity of both PCR assays was higher compared to microscopic examination. Dinkel et al. (1998) also found more positives by PCR compared to microscopy. They suggested that foxes with low worm burdens may be missed by microscopy but can be detected by PCR. This is even more important in areas where the presence of E. multilocularis is not known and occurs only sporadically. We detected only three foxes positive by microscopy and these foxes had only low numbers of worm burdens. Especially in sporadic areas, the PCR assays may be of value to estimate the presence of the parasite. The nested PCR on the 12S mitochondrial rDNA gene described by Dinkel et al. (1998) was specific for E. multilocularis. We modified the PCR assay in a single tube nested PCR assay, which resulted in a specific assay with a low contamination risk. For both nested and the U1snRNA PCR assays, the same fecal sample preparation method was used, which is based on the simultaneous inactivation and lysis of E. multilocularis eggs by boiling in SDS. Using this sample preparation method, we experienced no inhibition in our PCR assays in fox feces of different consistency, which may make this method suitable for testing fecal samples. Although about 20% of the fox intestines contained other Taeniae species, faecal samples of these animals were negative by PCR assays indicating a high specificity of these tests. The limited specificity of the U1snRNA based PCR using E. granulosus DNA from two different strains might be due to
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
55
Fig. 3. Geographical distribution of negative (*) and positive (~) tested foxes for E. multilocularis in The Netherlands.
polymorphism in the primer recognition site of E. granulosus strains, which was not detected by Bretagne et al. (1993). Clearly, the negative PCR reaction after testing the bovine strain of E. granulosus was not due to the quality of the DNA as the same DNA sample produced an amplified fragment using the single tube nested PCR. The five positive foxes were detected in two distinct areas in The Netherlands. One area was located in the northern province of Groningen. The size of this investigated area
56
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
was about 1100 km2. The estimated prevalence in Groningen is 5.5% (range 0±15.9% with 99% confidence interval (CI)). The other three positive foxes came from one area in the southern province of Limburg. The size of this area is about 768 km2 and the estimated prevalence of E. multilocularis is 13.6% (range 4.8±22.3%, 99% C.I.). This is the first report describing the presence of E. multilocularis in foxes in The Netherlands. These results indicate that E. multilocularis may even spread to more western areas in Europe. Until now there is no evidence of transmission to human beings in The Netherlands, although the lack of human cases could be due to other factors, for example, the long incubation period (5±15 years) if the parasite has been recently introduced in The Netherlands, little contact to the infection sources, or strain variations of E. multilocularis. Based on the results in areas in Germany where E. multilocularis occurs sporadically (Tackman et al., 1998), until now the risk for public health in The Netherlands is considered to be limited. Acknowledgements This study was carried out on behalf of the Veterinary Inspection, Ministry of Public Health, Welfare and Sports. We are grateful to M. Montizaan of the Royal Dutch Shooting Society and hunters participating for collecting the foxes. We thank C. Moolenbeek and B. Arends for their technical assistance and A. van der Veen for the spatial data handling and mapping of the results. Furthermore, we thank K. Tackman and colleagues for their help with the instructions of the microscopic methods and the critical discussions and A. Dinkel and T. Romig for the primer information and the confirmation of the DNA samples. References Ammann, R.W., Eckert, J., Cestodes Echinococcus. Gastroenterology Clinics of North America, vol. 25. pp. 655±689. Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., VandeNoordaa, J., 1990. A rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495±503. Borgsteede, F.H.M., 1984. Helminth parasites of wild foxes (Vulpes vulpes) in The Netherlands. Z. Parasitenkd 70, 281±285. Bretagne, S., Guillou, J.P., Morand, M., Houin, R., 1993. Detection of Echinococcus multilocularis DNA in fox feces using DNA amplification. Parasitology 106, 193±199. Deplazes, P., Gottstein, B., Eckert, J., Jenkins, D.J., Ewald, D., Jiminez-Palacios, S., 1992. Detection of Echinococcus coproantigens by enzyme-linked immunosorbent assay in dogs, dingoes and foxes. Parasitol. Res. 78, 303±308. Deplazes, P., Eckert, J., 1996. Diagnosis of the Echinococcus multilocularis infection in final hosts. Appl. Parasitol. 37, 245±252. Dinkel, A., Von Nickisch-Rosenegk, M., Bilger, B., Merli, M., Lucius, R., Romig, T., 1998. Echinococcus multilocularis in the definite host: coprodiagnosis by PCR is an alternative to necropsy. J. Clin. Microbiol. 36, 1871±1876. Eckert, J., 1989. Prevalence and geographical distribution of Echinococcus multilocularis infection in human beings and animals in Europe. WHO informal Consultation on alveolar echinococcosis, 14±16 August 1989, Hohenheim (WHO/VPH/ECHIN.RES./WP/89.4).
J.W.B. van der Giessen et al. / Veterinary Parasitology 82 (1999) 49±57
57
Eckert, J., Deplazes, P., Ewald, D., Gottstein, B., 1991. Parasitologische und immunologische Methoden zum È sterreichischen Gesellschaft Nachweis von Echinococcus multilocularis bei FuÈchsen. Mitteillungen der O fur Tropenmedizin und Parasitologie 13, 25±30. Eckert, J., Deplazes, P., 1996. Methods for surveys on Echinococcus multilocularis in final hosts. In: Uchino, J., Sato, N. (Eds.), Alveolar Echinococcosis: strategy for eradication of alveolar echinococcosis of the liver. Fuji Shoin, pp. 151±163. Gottstein, B., Desplazes, P., Eckert, J., MuÈller, B., Schott, E., Helle, O., Boujon, P., Wolff, K., Wandeler, A., Schwiete, U., MoÈgle, H., 1991. Serological (Em2-ELISA) and parasitological examinations of fox populations for Echinococcus multilocularis. J. Vet. Med. B 38, 161±168. Losson, B., Mignon, B., Brochier, B., Baudien, B., Pastoret, P.P., 1997. Echinococcus multilocularis infection in the red fox (Vulpes vulpes) in the province of Luxembourg (Belgium): results of a survey conducted between 1993 and 1995. Ann. Med. Vet. 141, 149±155. Lucius, R., Bilger, B., 1995. Echinococcus multilocularis in Germany: increased awareness or spreading of a parasite?. Parasitol. Today 11, 430±433. Malczewsky, A., Rocki, B., Ramisz, A., Eckert, J., 1995. Echinococcus multilocularis (Cestoda), the causative agent of alveolar echinococcus in human beings: first record in Poland. J. Parasitol. 8, 318±321. Mathis, A., Deplazes, P., Eckert, J., 1996. An improved test system for PCR-based specific detection of Echinoccous multilocularis eggs. J. Helminthol. 70, 219±222. Monnier, Ph., Cliquet, F., Aubert, M., Bretagne, S., 1996. Improvement of a polymerase chain reaction assay for the detection of Echinococcus multilocularis DNA in fecal samples of foxes. Vet. Parasitol. 67, 185±195. Mulder, J., 1985. Spatial organization, movements and dispersal in Dutch red fox (Vulpes vulpes) population: some preliminary results. Rev. Ecol. (Terre Vie) 40, 133±138. Mulder, J., 1992. Vos Vulpes Vulpes. In: Broekhuizen, S., Hoekstra, B., Van Laar, V., Smeenk, C., Thissen, J.B.M. (Eds.), Atlas van de Nederlandse Zoogdieren. Stichting Uitgeverij Koninklijke Nederlandse Natuurhistorische Vereniging, pp. 126±132. Raasveld, M.H.M., Ponsioen, C.Y., Den Boer, S., Schipper, H.G., Kager, P.A., 1997. A patient with alveolar echinococcosis (Echinococcus multilocularis infection). Ned. Tijdschr Geneesk 141, 1007±1010. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press. Schantz, P.M., Chai, J., Craig, P.S., Eckert, J., Jenkins, D.J., Macphersons, C.N.L., Thaker, A., 1995. Epidemiology and control of hydatid disease. In: Thompson, R.C.A., Mymbery, A.J. (Eds.), Echinococcus and Hydatid Disease. CAB International, Wallingford, Oxon, UK, pp. 233±331. Tackman, K., LoÈschner, U., Mix, H., Staubach, C., Thulke, H.H., Conraths, F.J., 1998. Spatial distribution patterns of Echinococcus multilocularis (Leuckart 1863) (Cestoda: Cyclophyllidea: Taeniidae) among red foxes in an endemic focus in Brandenburg, Germany. Epidemiol. Infect. 120, 101±109. Veit, P., Bilger, B., Schad, V., Schafer, J., Frank, W., Lucius, R., 1995. Influence of environmental factors on the infectivity of Echinococcus multilocularis eggs. Parasitology 110, 79±86. Virchow, R., 1855. Die multiloculaÈre ulcierende Echinokokkengewulst der Leber. Verhandlungen der Physiologisch-Medizinischen Gesellschaft WuÈrzburg 6, 428±429. Wagenknecht, E., 1979. Alterbestimmungen des erlegten Wildes, 5th ed. Melsungen, Berlin.