Detection of genetic diversity in linear plasmids 28-3 and 36 in Borrelia burgdorferi sensu stricto isolates by subtractive hybridization

Microbial Pathogenesis 35 (2003) 269–278 www.elsevier.com/locate/micpath

Detection of genetic diversity in linear plasmids 28-3 and 36 in Borrelia burgdorferi sensu stricto isolates by subtractive hybridization Yun Xu, John F. Bruno*, Benjamin J. Luft SUNY at Stony Brook, Department of Medicine, State University of New York at Stony Brook, T-15 Room 060, Stony Brook, NY 11794-8154, USA Received 7 April 2003; received in revised form 15 July 2003; accepted 23 July 2003

Abstract Recent studies based on sequence divergence in the ospC gene have identified limited subpopulations of B. burgdorferi associated with invasive human disease. Spirochetes with certain OspC types never cause human disease, while some others cause local infection at the primary skin site but do not hematogenously disseminate. Only four OspC genotypes (A, B, I and K) are responsible for disseminated disease and are found in the blood and cerebrospinal fluid, and hence are termed invasive strains. Subtractive hybridization was carried out between a prototype of a low passage invasive type, strain B31, and a strain associated only with local infection, group E, to identify genes associated with hematogenous dissemination. Two clones isolated from the subtraction library were unique to the B31 genome and mapped to locus BBH26 located on linear plasmid 28-3 (lp28-3) and to locus BBK48 located on linear plasmid 36 (lp36). Sequence analysis of the BBH26 locus revealed an amino acid repeat motif in the group E DNA that was absent in the B31 genome. This in-frame repeat motif was present yet variable in DNA isolated from several major OspC groups. However, no consistent sequence diversity was noted when other invasive and non-invasive strains were compared. In contrast, analysis of the BBK48 locus revealed a striking distinction between invasive and noninvasive spirochetes. PCR and Southern blot analysis indicated this locus was only present in invasive groups A, B, I, and K. BBK48 is a member of a gene family clustered on lp36. Therefore, these findings indicate that this genetic loci may participate in differentiating pathogens from non-pathogens and that its presence, which is correlated with ospC type, may play a role determining infectivity in humans. q 2003 Elsevier Ltd. All rights reserved. Keywords: Borrelia; Virulence factors; Subtractive hybridization; Invasive strains

1. Introduction Lyme disease, the most common vector-borne disease in the United States and Europe [1], is a progressive multisystem disorder characterized by an initial cutaneous infection that can spread early in infection to secondary sites that include the nervous system, heart and joints [2,3]. The causative agent is Borrelia burgdorferi, a spirochete first isolated from Shelter Island, NY [4]. B. burgdorferi infection induces a strong humoral response against the endoflagellar protein, p41, and a protein constituent of the protoplasmic cylinder, p93 [5], both of which are enveloped within the outer membrane, and some lipoproteins which are the major components of the membrane [6]. Of these outer surface proteins (Osps), OspA and OspC are the most prominent and have been viewed as likely vaccine * Corresponding author. Tel.: þ 1-631-444-2054; fax: þ1-631-444-2493. E-mail address: [email protected] (J.F. Bruno). 0882-4010/$ - see front matter q 2003 Elsevier Ltd. All rights reserved. doi:10.1016/S0882-4010(03)00152-9

candidates. OspA and experimental OspC vaccines, however, have limited utility since they are usually only effective against challenge by homologous genotypes [7 –11]. Thus, understanding the genetic variation in the Lyme disease spirochetes will be important in creating a successful vaccine(s). The limitations of the OspA and OspC based vaccines highlight the need to evaluate additional gene products that could afford protection against Borrelia infection. However, the extensive genetic and antigenic diversity of OspC in all three pathogenic genospecies of B. burgdorferi sensu lato has led us to propose that OspC could play a role in determining the potential for a given isolate to lead to chronic infection and, therefore, be used as a marker to discover new protective antigens [12 – 14]. We have shown that alleles of OspC collected from a single site on Shelter Island, NY could be clustered into 19 major groups or types designated A – S based on DNA sequence homology [14]. Sequence variation within a major group is , 2% but . 8%

270

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

across the major groups. Variation within a local population is comparable to the variation of similar size samples collected from the entire species. We have also shown that OspC alleles are linked to both infectivity and invasiveness. Of the 19 major groups, only four designated A, B, I and K contain invasive clones and cause infections of skin and extracutaneous sites, while the others are non-human pathogens or infect only the skin [12]. In support of these data, it has recently been shown that systemic disease was also caused by a small number of OspC groups in the two other pathogenic Borrelia species, Borrelia garinii and Borrelia afzelii [15]. Thus, the ospC gene can be used to predict infectivity and pathogenesis in humans. Although these observations provide new insight for predicting the clinical spectrum of Lyme disease associated with strains expressing particular OspC variants, it seems highly unlikely that variations in the amino acid sequence of the OspC protein are the sole determinants of the organisms ability to cause localized or disseminated human disease. Our working hypothesis is that other genetic loci, or virulence genes, differentiate pathogens from non-pathogens and that their presence, which is correlated with OspC type, determines infectivity in humans. The study of bacterial pathogenicity and the subsequent identification of genes responsible for bacterial virulence has greatly benefited by the use of several PCR-based DNA subtraction methods that can be used to detect genetic differences between two closely related genomes [16 – 18]. Utilizing these techniques, the differences in DNA sequence, including genes responsible for differential pathogenicities can be identified. Here we report the results using Suppression Subtractive Hybridization (SSH) to identify potential virulence gene DNA sequences by comparing chromosomal and plasmid genes of B. burgdorferi strain B31 with that of ospC group E [12,16]. We have chosen strain B31 for our study because the genome sequence of this isolate has been determined and annotated by the group at the Institute for Genomic Research ([19], and TIGR website; www.tigr.org), which allowed us to focus on an isolate of known genomic composition. In addition, strain B31 is a member of invasive group A, while group E is a non-invasive group [12]. Utilizing this technique, we have produced a comprehensive and specific library of sequences present only in the B31 strain. Analysis of two clones that map to loci BBH26 and BBK48 of the B31 genome reveals distinct differences within these genes among invasive and non-invasive isolates.

2. Results and discussion SSH was performed between the invasive B. burgdorferi strain B31 and the non-invasive B. burgdorferi strain group E in order to isolate DNA sequences encoding for virulence determinants unique to B31 [16]. Analysis of the resulting subtractive library that contained over 500 individual

colonies showed that over 90% of the clones had derived from the B31 strain. To confirm that the clones were specific to B31 DNA, cloned inserts were labeled and used as probes for a Southern blot of restriction digested genomic DNA isolated from both strains. Fig. 1 shows the result of a hybridization using as probes two clones designated 3A4 and 3E4. As can be seen, both probes strongly hybridized with multiple bands in lanes containing restriction digested B31 DNA (Fig. 1A and B). There is no signal, however, in lanes containing DNA from the group E isolate, demonstrating the clones generated by SSH are indeed unique to B31 genomic DNA. Both clones containing an insert of approximately 150 bp were sequenced and BLAST comparison to the B31 genome revealed they mapped to genes

Fig. 1. Southern blot analysis of restriction digested DNA isolated from strains of B. burgdorferi sensu stricto. Chromosomal DNA was isolated from clones of B. burgdorferi strains B31 and group E and digested with the restriction enzymes indicated. Blot A was probed with clone 3A4 and blot B was probed with clone 3E4 derived from strain B31 by SSH. Note, both probes strongly hybridize with multiple bands in lanes containing restriction digested B31 DNA. There is no signal, however, in lanes containing DNA from strain group E, demonstrating that clones are unique to B31 DNA. Molecular weight markers are indicated in kilobase pairs at the left of the blot.

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

encoding hypothetical or putative proteins. Clone 3A4 is located on B. burgdorferi linear plasmid lp 28-3 and maps to locus BBH26 that encodes a hypothetical protein while clone 3E4 is on linear plasmid lp36 and maps to locus BBK48 that encodes a paralog of the 37 kDa protein, P37. As another test of specificity, we PCR amplified the 150 bp regions of BBH26 and BBK48 from several human isolates using primers flanking each SSH clone and high fidelity PCR reagents. These isolates were either group A strains, B31 type, or additional group E strains. In seven isolates containing group A DNA, only one amplicon of the expected size was produced with each primer pair. However, there were no products when DNA from six group E isolates was used as template (data not shown). Given the inability of the SSH primers to amplify BBH26 and BBK48 in the group E strains, we next attempted to PCR amplify the full length regions of BBH26 and BBK48 from B31 and group E genomic DNA using primers that flank the ORF and high fidelity PCR reagents. One amplicon was produced having the mobility expected for the BBH26 product when either B31 or group E DNA was used as template. Similarly, the BBK48 primers amplified one fragment of the correct predicted size using DNA from the B31 strain. However, no amplified product was observed using DNA from the group E strain. A second set of PCR primers was designed that encompassed ORFs BBK47 and BBK49, genes that are 50 and 30 to the BBK48 locus on the lp36 plasmid, respectively. In the group E strain used for SSH and in six additional group E isolates, the results obtained with the primary and secondary PCR reactions were the same, i.e. no amplicons were generated. The apparent discrepancy in the group E samples between the negative results obtained using SSH primers for BBH26 and positive results using primers spanning the full BBH26 ORF was resolved when amplicons were excised from a preparative agarose gel and completely sequenced by primer walking on both strands. In Fig. 2A, an alignment of the nucleotide sequences of B. burgdorferi strains B31 and group E is shown. The sequence obtained for the BBH26 fragment amplified from B31 DNA agreed at every position with the sequence obtained by TIGR. However, when compared to the B31 BBH26 nucleotide sequence at positions 469 –492, the group E amplicon contained an in-frame insertion immediately 50 to this sequence. This region of the group E amplicon is characterized by a G to A mismatch at position 481 which results in an exact 12 nucleotide repeat occurring six times in tandem without any spacer sequence separating the repeats (Fig. 2A). Analysis of the deduced amino acid sequences revealed that the amino acid motif of KNITENIT occurring in the B31 sequence translates to KNITKNIT and the KNIT motif is perfectly and tandemly repeated four additional times in the group E sequence (Fig. 2B). This tandem repeat sequence was also observed in every group E isolate tested while amplicons from all group A isolates were identical to the B31 sequence. Furthermore, as shown

271

in Fig. 2A, the repeat sequence occurs at the 50 end of the fragment that would have been generated using the SSH primers that were based on the B31 sequence thus explaining the negative PCR results with group E DNA. This was the only highly variable region found, the N and C termini of the genes were highly conserved showing only minor differences between groups. We surmised that the possibility existed that the negative PCR results for BBK48 in group E strains were due either to sequence variation in the primer set region or to deletions or recombinations in the amplified region. To test these possibilities, southern hybridization was performed as a more stringent means of determining whether BBK48 homologs were present in the group E strain. Based on information provided in the TIGR database, two Spe I restriction sites lie 50 and 30 to the BBK48 locus on lp36 that upon digestion would generate a 6.4 kb fragment containing genes BBK46 through BBK50. Southern hybridization analyses of Spe I restriction digested genomic DNA isolated from strains B31 and group E were performed using as a probe the complete ORF of BBK48 generated using primers indicated in Table 2. As shown in Fig. 3 center panel, the probe strongly hybridized to a 6.4 kb fragment from DNA isolated from B. burgdorferi strain B31 whereas no hybridization signal was noted in DNA derived from strain group E. The blots were stripped and re-analyzed with probes targeting BBK46 and BBK50, two loci that are 50 and 30 to the BBK48 locus on lp36 relative to the B31 genome. As expected both probes recognized the same 6.4 kb fragment in B31 DNA (Fig. 3, left and right panels). By contrast to results obtained with the BBK48 probe, BBK46 and BBK50 probes recognized a 4.0 kb fragment in DNA derived from strain the group E isolate. To further assess the molecular variation in the two strains, we PCR amplified the region spanning loci BBK46 and BBK50 from B31 and group E genomic DNA using primers 30 BBK46 and 50 BBK50 (Table 2) and high fidelity PCR reagents. As predicted, the primers generated a 5.7 kb amplicon from B31 DNA and from DNA from all seven group A isolates. Using DNA from the group E isolates as templates, however, the primers amplified a 3.4 kb product. These bands were excised from preparative agarose gels and completely sequenced by primer walking on both strands. The sequence we obtained for the 5.7 kb amplicons generated from B31 and all group A isolate DNA agreed at every position with the corresponding region in the TIGR database. By contrast, sequence analysis of the 3.4 kb amplicons generated from group E DNA revealed the fragments contained the complete ORFs for genes BBK46, BBK47, and BBK50 but the region from the 30 end of BBK48 to the 50 end of BBK49, relative to the direction of transcription, was deleted in all sample analyzed. It appears that only limited subpopulations of B. burgdorferi are responsible for invasive human disease, and that the OspC type can be used as a means to distinguish invasive and non-invasive spirochetes. Spirochetes with

272 Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278 Fig. 2. (A) Nucleotide sequence of the BBH26 gene of B. burgdorferi strains B31 and group E. Bold lettering indicates the repeat motif described in the text. An arrow indicates the single mismatch at position 481. The binding sites of PCR primers are underlined. (B) Deduced amino acid sequence of the variable region of BBH26. The amino acid motif KNITENIT of strain B31 and the KNIT repeat motif of strain group E are indicated by boldface.

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

Fig. 3. Southern blot analysis of Spe I digested DNA isolated from B. burgdorferi strains B31 and group E. Chromosomal DNA was isolated from B. burgdorferi strains B31 and group E and digested with the restriction enzyme Spe I. The blot was probed with BBK48 then BBK46 and BBK50. Note the BBK48 probe strongly hybridizes with a 6.4 kb band in the lane containing restriction digested B31 DNA. There is no signal, however, in the lane containing DNA from strain group E. Both the BBK46 and BBK50 probes hybridize to the same 6.4 kb fragment in B31 DNA whereas they hybridize to a 4.0 kb fragment in group E DNA. Molecular weight markers are indicated in kilobase pairs at the left of the blot.

certain OspC types never cause human disease, while some others cause local infection at the primary skin site but do not cause any systematic disease [12]. Only four types (A, B, I and K) are responsible for systematic disease and are found in the secondary sites, and hence are termed invasive clones. Therefore, we next assessed whether strain differences defined by OspC groups showed similar molecular variation in the BBH26 and BBK48 loci. We initiated our analysis using a collection of isolates of B. burgdorferi from patient skin, blood and cerebrospinal fluid. Each was propagated in vitro and used as a source of DNA for analysis. The OspC genotype of each strain was determined by PCR and sequencing [14]. From this pool of patient samples, we isolated representative DNA from eight major OspC groups which with the addition of the B31 and group E isolates discussed above, brought the total for our analysis

273

to 10 major OspC groups, four invasive and six noninvasive [12]. Using the PCR primers derived from the B31 sequence, we again attempted to amplify the complete ORF of the BBH26 and BBK48 genes from these samples. Again, one amplicon was generated in all samples using the BBH26 specific primers. However, a BBK48 amplicon was only produced in some of the samples. All PCR fragments were purified and directly sequenced. Alignment of the nucleotide sequence of all BBH26 fragments revealed the same divergent area between alignment positions 469 –492 relative to the B31 BBH26 sequence. Sequence data covering nucleotide residues 475– 507 for representatives of the major OspC groups that were analyzed are shown in Fig. 4A. In isolates containing DNA from the invasive OspC group B, the BBH26 gene agreed at every position with the sequence of the B31 strain. Of the eight additional alleles sequenced, four of eight contained the G to A mismatch at position 481 with six of eight showing multiple tandem repeats (Fig. 4A). These nucleotide changes and in-frame inserts resulted in numerous differences in the predicted amino acid sequences (Fig. 4B), however, all contained only variation of the amino acid motifs KNIT and ENIT. Although this hypervariable domain of BBH26 was characterized by the presence of a series of in-frame repeat elements in most OspC types analyzed, there appeared to be no obvious nucleotide or amino acid sequence that would distinguish invasive from non-invasive clones. Although no apparent correlation was evident for the genetic diversity in the BBH26 locus among the OspC groups, we noted a striking distinction between invasive and non-invasive spirochetes when we attempted to PCR amplify the BBK48 gene from the samples using primers flanking the ORF. One amplicon of the expected size was produced using DNA isolated from the four invasive OspC groups A, B, I, and K. However, using DNA isolated from the six non-invasive strains, the PCR results obtained with either the primary primer pair flanking the BBK48 ORF or the secondary primer pair comprised of gene sequence 50 and 30 to the BBK48 locus were the same, i.e. no amplicons were generated. Using primers 30 BBK46 and 50 BBK50 as described above and high fidelity PCR reagents, we were able to generate a 5.7 kb amplicon from DNA isolated from the four invasive OspC groups A, B, I, and K. In DNA isolated from the six non-invasive strains, however, the primers amplified a 3.4 kb product. When these bands were purified and sequenced, the sequence obtained for the band from group A isolates, as expected, agreed at every position with the B31 sequence reported in the TIGR database. Minor sequence variation, however, was noted in the three remaining invasive groups. The sequence of the 3.4 kb amplicons from the non-invasive groups were similar to the group E sequences described above, the region from the 30 end of BBK48 to the 50 end of BBK49, relative to the direction of transcription, was deleted in all sample

274 Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278 Fig. 4. (A) Alignment of the nucleotide sequences of the BBH26 variable region. The isolates analyzed are indicated at the left. For comparative purposes, the sequence of the BBH26 gene from the TIGR database is included and labeled B31. The repeat regions are indicated by boldface. (B) Alignment of the deduced amino acid sequences. The amino acid sequence of the variable region is shown in boldface. The isolates from which the sequences were obtained are shown on the left.

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

analyzed. Minor sequence differences were noted between groups. The nucleotide sequence of each 5.7 and 3.4 kb fragment was submitted to GenBank. Invasive groups B, I and K were assigned GenBank accession numbers AY341863, AY341868, and AY341867, respectively. The non-invasive groups E, G, and H have GenBank accession numbers of AY341864, AY341869, and AY341865, respectively. The 3.4 kb fragment of non-invasive groups D, J, and U were identical and have a GenBank accession number of AY341866. The locus BBK48 is a member of a B. burgdorferi paralogous gene family containing five genes (family 75; see TIGR website). This family includes the BBK50 locus previously characterized as the p37 immunogenic protein, an antigen that is expressed early during B. burgdorferi infection of mice and is recognized by serum from human Lyme disease patients [25]. Interestingly, these five genes are located within a 10 kb cluster on lp36. Given our intriguing results that BBK48 is present only in invasive strains A, B, I, and K, it is tempting to speculate that this gene may play a role in the pathogenesis of invasive strains. The clones identified in this work will aid in the further understanding of the relevance of genetic regions specific to invasive Borrelia strains through mutational studies involving these important loci. Work is now in progress to clone and express the BBK48 ORF to obtain antibodies to detect the location of the K48 polypeptide in Borrelia cells and to determine if it is immunogenic in humans infected with invasive spirochetes.

3. Conclusion Our major objective was the identification of regions of DNA in pathogenic strains of B. burgdorferi, which do not have a counterpart in non-pathogenic strains and may therefore determine factors responsible for the pathogenesis of this spirochetes. Using the technique of SSH, we created a library of sequences present only in the B. burgdorferi strain B31, a member of the invasive Ospc group A. We focused our study on two clones that mapped to loci BBH26 and BBK48. Although it is presently not known whether these genes are necessarily related to pathogenesis, the clones isolated here will aid in understanding whether candidate virulent gene expression is required for the high infectivity phenotype through gene disruption and complementation studies [26]. In all probability, complex mechanisms such as gene mutation and rearrangement or changes in the expression pattern of specific genes most likely will differentiate pathogenic from non-pathogenic strains of B. burgdorferi. An understanding of the genetic loci which may confer pathogenic properties or enhance the ability of the organism to cause disease by subverting or evading host immunity is fundamental toward developing a safe, effective, rationally designed recombinant vaccines to

275

prevent Lyme borreliosis as well as provide important recombinant proteins for the diagnosis of the disease.

4. Materials and methods 4.1. Borrelia strains B. burgdorferi strains used in this study are described in Table 1. B. burgdorferi sensu stricto strain B31 has been described [8,20]. Strains from the skin of primary erythema migrans lesions or blood of patients with Lyme disease were isolated as previously described [21 – 23] and were obtained from the Centers for Disease Control. For in vitro propagation, spirochetes were cultivated at 34 8C in complete BSK-H medium (Sigma, St Louis, MO). 4.2. DNA isolation For isolation of genomic DNA, 10 ml low passage logphase bacteria were harvested by centrifugation at 10,000 rpm for 30 min at 4 8C. The bacterial pellet was washed twice with Tris – saline buffer (10 mM Tris (pH 7.5), 100 mM NaCl), and resuspended in 430 ml TES (10 mM Table 1 B.burgdorferi strains used in this study Strain designation

Biological origin

OspC type

1. Reference strains for subtractive hybridisation B31 Tick (I. scapular) A Group E Tick (I. scapular) E Sample ID 2. Human isolates 132a 77a 132b 173 180 182 B31c1 159a 97b 162a 121a 156a 88a 167 N4c1 N4c2 N4c3 N4c4 72a 118a 94a a b c

Source

Shelter Island, NYa Westchester county, NYb

Biological origin

OspC type

Source

Skin Skin Blood Skin Skin Skin Skin Skin Blood Skin Skin Skin Skin Skin Skin Skin Skin Skin Skin Skin Skin

A A A A A A A B I K D H E E E E E E G J U

CDCc CDC CDC NY NY NY NY CDC CDC CDC CDC CDC CDC NY NY NY NY NY CDC CDC CDC

Ref. [20]. Ref. [12]. Centers for Disease Control.

276

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

Tris (pH 7.5), 100 mM NaCl, 10 mM EDTA). Ten microliters freshly prepared lysozyme (50 mg/ml), 50 ml Sarkosyl (10%), and 10 ml proteinase K (10 mg/ml) were then added. The mixture was incubated at 50 8C overnight prior to RNase treatment. DNA was extracted with phenol/chloroform once and chloroform once, precipitated with ethanol, and resuspended in TE buffer. 4.3. Suppression subtractive hybridisation SSH using B. burgdorferi strain B31 as tester DNA and group E as driver DNA was carried out as previously described [16] using modified oligonucleotide primers as shown in Table 2. Primer pairs SH-Adp-1 and SH-Adp-2 are two different PCR adaptors that are joined to the 50 ends of different aliquots of tester DNA. Primer SH-P1 was used in PCR and matches the long strands of primers SH-Adp 1 and 2 at their 50 ends. Primers SH-NP1 and SH-NP2 are nesting PCR primers that match the internal portion of the long strands of SH-Adp-1 and SH-Adp-2, respectively. To perform subtractive hybridization, DNA from tester and driver strains were digested with the restriction enzyme Sau3A1 generating a population of DNA fragments with median size of about 0.5 kb. The two oligonucleotide

adaptors SH-Adp-1 and SH-Adp-2 were ligated to two separate aliquots of tester DNA. The tester DNA aliquots were denatured, mixed with a molar excess of driver DNA that did not contain the adaptors, and allowed to anneal. The two DNA pools were then mixed and more driver DNA was added to further bind tester sequences that are common to both genomes. The complimentary single strands that were unique to tester DNA were allowed to anneal and the 50 adaptor sequence was filled-in at their 30 ends. PCR was then used to obtain exponential amplification of tester DNA with unique adaptors at each end. DNA fragments highly enriched for tester-specific sequences that were obtained by PCR were cloned into pBluescript II KS(þ ) then transformed into Escherichia coli DH5a. 4.4. DNA hybridization Dot blotting and Southern blot hybridizations were carried out using standard protocols as described [24]. For Dot blots, inserts from the SSH library were PCR amplified using T3 and T7 primers and spotted on hybridization filters. Filters were then probed with either genomic DNA from B31 and group E or inserts from individual SSH clones labeled as described below. For Southerns, probes for

Table 2 Primers and probes used in this study Primer name

Sequence

1. Suppression subtraction hybridisation SH-Adp-1 50 CTAATACGACTCACTATAGGGCTC GAGCGGGCGGCCGCGCAGGT 30 SH-Adp-1A 50 GATCACCTGCGCGG 30 SH-Adp-2 50 CTAATACGACTCACTATAGGGCA GCGTGGTGCCGGCCGAGGT 30 SH-Adp-2A 50 GATCACCTCGGCCG 30 SH-P1 50 CTAATACGACCACTATAGGGC 30 SH-NP1 50 TCGAGCGGGCGGCCGCGCAGGT 30 SH-NP2 50 AGCGTGGTGCCGGCCGAGGT 30 Primer name Sequence 2. Amplifying specific gene products 30 BBK48 50 ATTTTACTGGATCCTATCTAGAGTCCATAT 30 0 5 BBK48 50 AAGTAATCATATGAATTTAATTAATAAATTATTTATTC 30 30 BBK47 50 GTAATTTAGGCATAATAGTC 30 0 5 BBK49 50 AAAGTCTGTCAAAGCCACAC 30 50 AACTCTTTAATATCTTTTGT 30 30 BBH26 0 5 BBH26 50 CACTGAAAATATCACTGTAT 30 50 BBH26Full length 50 GGAGATTACATATGAAACCAGCC 30 50 CAAGGATCCTACTCAAATTTTAATCC 30 30 BBH26Full length 30 BBK46 50 TAATAAGCAGCTTCATATGC 30 0 5 BBK46 50 CAGATTCTAAGAAGAGGTAC 30 30 BBK50 50 AGCAATTGCATCAGTATAGC 30 0 50 TATTCTATTTTAGATAGAGG 30 5 BBK50

Coordinates

Plasmid

30,722–30,738 bp 31,585–31,558 bp 29,770–29,789 bp 32,151–32,132 bp 17,198–17,179 bp 16,995–17,014 bp 16,159–16,170 bp 17,412–17,395 bp 28,392–28,411 bp 29,240–29,221 bp 33,360–33,379 bp 34,106–34,087 bp

lp36 lp36 lp36 lp36 lp28-3 lp28-3 lp28-3 lp28-3 lp36 lp36 lp36 lp36

Probe name 3. Southern hybridisation BBK46 probe BBK48 probe BBK50probe

Sequence

Coordinates

Plasmid

Full length gene product Full length gene product Full length gene product

BBK46(28,392 –29240) BBK48(30,848 –31,585) BBK50(33,360 –34106)

lp36 lp36 lp36

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

BBK48, BBK46 and BBK50 for use in DNA hybridization experiments were generated by PCR using high fidelity Taq polymerase and primer pairs listed in Table 2. The resulting products were gel purified and the PCR fragments generated for BBK46 and BBK50 were directly cloned into the plasmid vector, pSTBlue-1 (Novagen). The PCR product of BBK48 was first digested with restriction endonucleases Nde I and Bam HI then cloned into the plasmid vector pET9C (Novagen). The plasmids were sequenced and the inserts were released by Eco RI digestion for BBK46 and BBK50 or by Nde I and Sca I double digestion for BBK48, and purified using GFX columns. The resulting products were labeled with [a-32P]dCTP using an Amersham Random primer DNA labeling kit. B. burgdoferi B31 and group E genomic DNA was isolated as described above and digested to completion with either HindIII, Eco RI, or Spe I. The DNA was resolved on a 0.7% agarose gel, transferred onto Hybond N membranes (Amersham) by vacuum blotting and then cross-linked to the membrane by UV irradiation using the Stratagene UV Stratalinker 1800 (Stratagene). Nylon membranes were hybridized overnight at 42 8C in 5 £ Denhardt’s solution – 50% formamide – 5 £ SSPE (1 £ SSPE is 0.15 M NaCl, 10 mM Na phosphate, pH 7.4, 1 mM EDTA)– 0.5%SDS – 100 mg/ml sonicated salmon sperm DNA. After hybridization, the nylon filter was washed twice for 15 min each time at room temperature in 2 £ SSPE containing 0.1% SDS then a final wash was performed at 55 8C for 30 min in 0.1 £ SSPE – 0.1% SDS. 4.5. Identification of major OspC groups by PCR The OspC genes from all isolates were amplified by PCR as previously described [14]. PCR was performed under stringent conditions using Platinum Taq DNA Polymerase High Fidelity (Gibco-BRL). A 600 bp fragment of OspC was amplified by using the forward primer: 50 -AAA GAA TAC ATT AAG TGC GAT ATT-30 (þ ) beginning at base 6 and the reverse primer: 50 -GGG CTT GTA AGC TCT TTA ACT G-30 (2 ) ending at base 602. All PCR products were purified by GFX chromatography (Amersham Pharmacia Biotech, Inc) and sequenced using fluorescent dideoxy terminator chemistry as outlined below. Major OspC groups were determined using the computer programs BLASTN and BLASTX through GenBank at the National Center for Biotechnology Information (NCBI). 4.6. DNA sequencing Automated DNA sequencing was performed by the SUNY at Stony Brook Core DNA Sequencing Facility of both strands of each fragment by the dye-terminator method using the same oligonucleotide primers used for PCR amplification or, where required, appropriate internal primers. Sequences were inspected and assembled with the aid of the Sequencher program (Life Codes, Inc.). DNA

277

sequences were analyzed using the BLASTN program through GenBank at NCBI. Nucleotide and protein sequence alignments were performed with MacVector version 6.5 (Oxford Molecular Group).

Acknowledgements Financial support: NIH AI37256-05.

References [1] Barbour AG, Fish D. The biological and social phenomenon of Lyme disease. Science 1993;260:1610–6. [2] Hansen K, Lebech AM. The clinical and epidemiological profile of Lyme neuroborreliosis in Denmark, 1985–1990: a prospective study of 187 patients with Borrelia burgdorferi specific intrathecal antibody production. Brain 1992;115:399 –423. [3] van der Linde MR, Crijns HJ, de Koning J, Korstanje JAH, de Graaf JJ, Piers DA, van der Galien A, Lie KI. Range of atriventricular conduction disturbances in Lyme borreliosis: a report of four cases and review of other published reports. Br Heart J 1990;63:162–8. [4] Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Gruwaldt E, Davis JP. Lyme disease—a tick borne spirochetosis? Science 1982;216: 1317– 9. [5] Craft JE, Fischer DK, Shimamoto GT, Steere AC. Antigens of Borrelia burgdorferi recognized during Lyme disease. Appearance of a new immunoglobulin M response and expansion of the immunoglobulin G response late in the illness. J Clin Invest 1986; 78:934–9. [6] Simpson WJ, Garon CF, Schwan TG. Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi. Microb Pathog 1990;8:109–18. [7] Fikrig E, Barthold SW, Persing DH, Sun X, Kantor FS, Flavell RA. Borrelia burgdorferi strain 25015: characterization of outer surface protein A and vaccination against infection. J Immunol 1992;148: 2256– 60. [8] Fikrig E, Barthold SW, Kantor FS, Flavell RA. Protection of mice against the Lyme disease agent by immunizing with recombinant OspA. Science 1990;250:533–6. [9] Gilmore RD, Kappel KJ, Dolan MC, Burkot TR, Johnson BJ. Outer surface protein C (OspC), but not P39, is a protective immunogen against a tick-transmitted Borrelia burgdorferi challenge: evidence for a conformational protective epitope in OspC. Infect Immun 1996; 64:2234–9. [10] Probert WS, Crawford M, Cadiz RB, LeFebvre RB. Immunization with outer surface (Osp) A, but not OspC, provides cross-protection of mice challenged with North American isolates of Borrelia burgdorferi. J Infect Dis 1997;175:400–5. [11] Simon MM, Schaible UE, Kramer MD, Eckerskorn C, Museteanu C, Muller-Hermelink KK, Wallich R. Recombinant outer surface protein from Borrelia burgdorferi induces antibodies protective against spirochetal infection in mice. J Infect Dis 1991;164: 123–32. [12] Seinost G, Dykhuizen DE, Dattywyler RJ, et al. Four clones of Borrelia burgdorferi sensu stricto cause invasive infection in humans. Infect Immun 1999;67:3518 –24. [13] Theisen M, Frederiksen B, Lebech AM, Vuust J, Hansen K. Polymorphism in the OspC gene of Borrelia burgdorferi and immunoreactivity of OspC protein: implication for taxonomy and for use of OspC protein as a diagnostic agent. J Clin Microbiol 1993; 31:2570–6.

278

Y. Xu et al. / Microbial Pathogenesis 35 (2003) 269–278

[14] Wang I-N, Dykhuizen DE, Qui W, Dunn JJ, Bosler EM, Luft BJ. Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto. Genetics 1999;151:15–30. [15] Baranton G, Seinost G, Theodore G, Postic D, Dykhuizen D. Distinct levels of genetic diversity of Borrelia burgdorferi are associated with different aspects of pathogenicity. Res Microbiol 2001;154:149–56. [16] Diatchenko L, Lau Y-FC, Campbell AP, et al. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci 1996; 93:6025–30. [17] Lisitsyn N, Wigler M. Cloning the differences between two complex genomes. Science 1993;259:946 –51. [18] Lisitsyn NA. Representational difference analysis: finding the differences between genomes. TIG 1995;11:303–7. [19] Fraser C, Casjens S, Huang WM, et al. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 1997;390:580– 6. [20] Luft BJ, Mudri S, Jiang W, et al. The 93-kilodalton protein of Borrelia burgdorferi: an immunodominant protoplasmic cylinder antigen. Infect Immun 1992;60:4309 –21.

[21] Barbour AG. Isolation and cultivation of Lyme disease spirochetes. Yale J Biol Med 1984;57:521–5. [22] Berger BW, Johnson RC, Kodner C, Coleman L. Cultivation of Borrelia burgdorferi from erythema migrans lesions and perilesional skin. J Clin Microbiol 1992;30:359–61. [23] Wormser GP, Nowakowski J, Nadelman RB, Bittker S, Cooper D, Pavia C. Improving the yield of blood cultures for patients with early Lyme disease. J Clin Microbiol 1998;36:296– 8. [24] Bruno JF, Xu Y, Song J, Berelowitz M. Molecular cloning and functional expression of a brain-specific somatostatin receptor. Proc Natl Acad Sci USA 1992;89:11151–5. [25] Fikrig E, Barthold SW, Sun W, Feng W, Telford III SR, Flavell RA. Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity. Immunity 1997;6:531– 9. [26] Elias AF, Stewart PE, Grimm D, Caimano MJ, Eggers CH, Tilly K, Bono JL, Akins DR, Radolf JD, Schwan TG, Patricia Rosa P. Clonal polymorphism of Borrelia burgdorferi strain B31 MI: implications for mutagenesis in an infectious strain background. Infect Immun 2002; 70:2139–50.