Detection of Hepatitis C Virus Helicase Activity Using the Scintillation Proximity Assay System

ANALYTICAL BIOCHEMISTRY ARTICLE NO.

257, 120 –126 (1998)

AB982560

Detection of Hepatitis C Virus Helicase Activity Using the Scintillation Proximity Assay System Kiyoshi Kyono, Masahiko Miyashiro, and Ikuhiko Taguchi1 Lead Generation Research Laboratory, Tanabe Seiyaku Co., Ltd., 16-89 Kashima 3-chome, Yodogawa-ku, Osaka 532-0031, Japan

Received October 6, 1997

The C-terminal two-thirds of the nonstructural protein 3 (NS3) of hepatitis C virus (HCV) possesses RNA helicase activity. This enzyme is considered to be involved in the viral replication and is expected to be one of the target molecules of anti-HCV drugs. The conventional method for the measurement of RNA helicase activity includes the step of gel electrophoresis which makes the screening of multiple samples inconvenient. In this study, to establish a high-throughput screening system for HCV helicase inhibitors, we applied the scintillation proximity assay (SPA) system to the detection of this enzymatic activity. We could detect the helicase activity using the NS3 protein purified by an immunoaffinity column. The activity was dependent on the concentration of the enzyme and the reaction time. The RNA helicase activity measured by the SPA system was in a good correlation with that obtained by the conventional method. Furthermore, the SPA system showed better reproducibility and less deviation of the data than the conventional method, which makes the former suitable for quantitative analysis. Since any separation step is not required and microtiter plates can be used in this method, it has the advantage of dealing with multiple samples. © 1998 Academic Press

Hepatitis C virus (HCV)2 is the major etiologic agent of non-A, non-B viral hepatitis (1, 2). Chronic and per-

To whom correspondence should be addressed. Fax: 181-6-3002593. E-mail: [email protected]. 2 Abbreviations used: AdoBzSO2F, fluorosulfonylbenzoyladenosine; SPA, scintillation proximity assay; AcNPV, Autographa californica nuclear polyhedrosis virus; BVDV, bovine viral diarrhea virus; HCV, hepatitis C virus; ds, double strand; ss, single strand; FCS, fetal calf serum; PBS, phosphate-buffered saline; Mops, 3-morpholinopropanesulfonic acid. 1

120

sistent infection by HCV often leads to liver cirrhosis and hepatocellular carcinoma (3, 4). HCV is a positivestrand RNA virus which is a member of the family Flaviviridae (5–7). The viral genome is about 9500 nucleotides and contains a single open reading frame which encodes a polyprotein of 3010 to 3033 amino acids (5, 7, 8). This polyprotein is processed into structural (C, E1, and E2) and nonstructural (NS2, NS3, NS4A, NS4B, NS5A, and NS5B) proteins by host and viral proteases (9 –12). One-third of the N-terminal of the NS3 protein (20 kDa) is a serine proteinase which cleaves the NS3– NS4A, NS4A–NS4B, NS4B–NS5A, and NS5A–NS5B junctions (11, 13–17). This proteinase activity is thought to be necessary for the viral replication, and many researchers bring it into focus as a therapeutic target. The C-terminal two-thirds of the NS3 has conserved amino acid motifs predictive of nucleoside triphosphatase (NTPase) and RNA helicases, which belong to the DEAD box protein family. Many RNA helicases and RNA-dependent NTPases from various organisms ranging from Escherichia coli to humans and viruses belong to the DEAD box protein family. These RNA helicases catalyze the unwinding of the double-strand RNA and secondary (stem–loop) structures in a single-strand RNA, and are thought to be involved in RNA splicing, ribosome assembly, translational initiation, viral replication, and transcriptional processes (18, 19). The helicases intrinsically possess NTPase activity, which hydrolyzes nucleoside triphosphates in the presence of RNA and provides the energy source for unwinding. At present, many researchers are trying to find the NS3 protease inhibitors for therapeutic purpose. However, it is thought that the use of inhibitors of other viral enzymes or viral proteins together with protease inhibitors is necessary to prevent the emergence of 0003-2697/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.

ASSAY FOR HEPATITIS C VIRUS HELICASE

escape mutants and to get rid of HCV effectively. Therefore, we have initiated a project to establish a screening system for HCV helicase inhibitors. Several methods were reported using traditional gelbased assay to analyze the helicase activity. Generally, the double-strand nucleic acid (ds) is used as a substrate, and one strand (the short strand in most cases) is radiolabeled with 32P. The double-strand substrate and unwound strand (ss) are separated by gel electrophoresis and visualized by autoradiography. Helicase activity is quantified by cutting the bands of substrate and unwound strand from the dried gels and measuring their radioactivity. This method is not suitable for screening of multiple samples since it contains steps of electrophoresis and autoradiography. Moreover, this method is not quantitatively very accurate even though the use of Instant Imager or BAS system makes it possible to count radioactivity of the gel directly without cutting the bands from the gels. Recently, scintillation proximity assay (SPA) technology has been developed by Amersham. It is suitable for high-throughput screening since it enables the performance of assays in 96-well microtiter plates without the step to separate the bounds from free ligand. This technology is applied to the detection of various enzyme activities and receptor binding assays. As for helicase, the [3H] SPA enzyme assay system of the DNA helicase is available as a commercial kit from Amersham. Here, we describe the establishment of highthroughput screening system of the HCV helicase with modifications of this kit. We also describe the purification method for HCV helicase and the comparison between the conventional gel-based method and SPA system. MATERIALS AND METHODS

Cloning of NS3-4A Coding Region of a HCV Polyprotein For cloning of the coding region spanning from amino acid 813 in NS2 to amino acid 1723 in NS4B, we amplified three fragments (A, B, C) separately by the RT-nested PCR method with a single serum from a patient infected with HCV as the source of HCV RNA genome. Two sets of oligonucleotide primers, CP-1112S (59-TGGTACATCAA(AG)GGCAGGCTGGTCC-39) and CS-1110A (59-ATGGAAAACAGTCCAACACACGCC39) (for the first PCR), and CP-1113S (59-CGGAATTCGAGATGGC(CT)GCATCGTGCGGAGGCG-39) and CP-1111A (59-CGGTTGACGCAGGTCGCCAGGAAAGATTGC-39) (for the second PCR) were used to amplify fragment A. Similarly CP-1111S (59-GCAATCTTTCCTGGCGACCTGCG-39), CP-824A (59-GTCGTCTCAATGGTGAAGGT(AG)GG(AG)TCC-39) (for the first PCR), CP-1110S (59-GCGGTACCAGTCAACGGCGT-

121

GTGTTGGACTGTTTTC-39), CP-825A (59-GTGGGATCCAAGCTGAA(AG)TCGACTGTCTGGGTGA-39) (for the second PCR), and CP-825S (59-AGACAGTCGA(CT)TTCAGCTTGGA(CT)CC(CT)A-39), CS-902A (59-GCGAATTCATGTCCGGTGATCTGTGCTCCACA39) (for the first PCR), CP-826S (59-GCGGATCC(CT)ACCTTCACCATTGAGACGAC(AG)AC-39), CP827A (59-GCCTGCAGCTGCATTCC(CT)TG(CT) TCGATGTAAGG-39) (for the second PCR) were used to amplify and clone fragments B and C, respectively. The three fragments were first cloned into the vector pUC19 and the sequences of these fragments were determined by the dideoxy-chain-termination method, using an automated DNA sequencer (Model 373A, Applied Biosystems) and the Taq dye primer cycle sequencing kit (Perkin–Elmer Cetus). The sequence of the cDNA clone obtained corresponded to that of type 1b. The three fragments were ligated into pUC19 using appropriate restriction sites. The resulting plasmid was designated pUNS2D34D. A 2.7-kb fragment which encodes from amino acid 813 to 1723 was obtained by digestion of this plasmid with EcoRI and HindIII and inserted into the respective sites of the pMAL-cRI vector (New England Biolabs Inc.) to generate pMNS2D34D. Expression of HCV Proteins by a Recombinant Baculovirus System A 3.4-kb DNA fragment containing the HCV DNA, which encodes a putative amino acid 813 to 1723, was obtained by digestion of pMNS2D34D with EcoRI and SspI, and inserted into the EcoRI and SmaI sites of a baculovirus transfer vector pVL1392 (PharMingen) to obtain pVLNS2D34D. Next, pVLNS2D34D was cotransfected with linealized AcNPV (Autographa californica nuclear polyhedrosis virus) DNA (PharMingen) into Sf21 cells to obtain recombinant baculovirus BVNS2D34D. Sf21 cells, cultured in TNM-FH medium (Gibco BRL) supplemented with 10% fetal calf serum (FCS), were infected with recombinant baculovirus. After 72 h of culture, cells were harvested and washed once with phosphate-buffered saline (PBS). Cell pellets were stored at 280°C until use. Preparation of Immunoaffinity Column A polyclonal antibody to the HCV NS3 protein was raised in rabbits by immunization with the N-terminal portion (aa 1027 to 1303) of the NS3 protein, which was expressed in a fused form with 6 3 His tag in E. coli and purified using a Ni-column (Qiagen Inc.). IgG was purified from serum using a HiTrap protein G column (Pharmacia). The immunoaffinity column was prepared following the method described by Schneider et al. (20), with

122

KYONO, MIYASHIRO, AND TAGUCHI

slight modifications. Briefly, rabbit anti-NS3 IgG (47 mg) was absorbed into a HiTrap protein G column (Pharmacia) in 20 mM sodium phosphate buffer, pH 8.2. After crosslinking with 4 mg/ml dimethyl pimelimidate dihydrochloride (Pierce, Rockford, IL) in 0.2 M triethanolamine, pH 8.2, the column was washed with 0.2 M triethanolamine, pH 8.2 and blocked remaining reactive sites with 0.1 M ethanolamine, pH 8.2. The column was washed with 0.1 M glycine–HCl, pH 2.8 and then equilibrated with 20 mM sodium phosphate buffer, pH 8.2. Immunoaffinity Purification of Recombinant NS3 Protein Frozen cell pellets infected with the recombinant baculovirus were homogenized in buffer A (20 mM Tris–HCl, pH7.5, 25 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 100 kIU/ml aprotinin, 1 mg/ml leupeptin, 5 mg/ml pepstatin) using a Teflon pestle tissue homogenizer. The homogenate was overlaid on 60% (lower layer)– 40% (upper layer) sucrose solutions in buffer A and centrifuged (200,000g, 60 min). The portion on the 60% sucrose layer (membrane fraction) was collected and solubilized in buffer A containing 1% Triton X-100 without dithiothreitol and protease inhibitors. The suspension was centrifuged (6700g, 5 min) and the supernatant was collected. NaCl was then added to a final concentration of 150 mM. This solubilized membrane fraction was diluted twofold with column buffer (20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100) and then applied to the immunoaffinity column. The column was washed with 10 column volumes of column buffer and 8 column volumes of 0.5 M NaCl buffer (0.5 M NaCl, 10 mM Tris–HCl, pH 7.5, 1 mM EDTA, 0.5% Triton X-100). Bound proteins were eluted with EG buffer (40% (v/v) ethylene glycol, 1 M NaCl, 50 mM sodium acetate, pH 6.0, 1 mM EDTA) (21). Protein-containing fractions of the eluate were pooled, dialyzed against 50% glycerol buffer (50% glycerol, 50 mM NaCl, 10 mM Tris–HCl, pH 7.5, 1 mM EDTA, 0.01% 2-mercaptoethanol, 0.01% Triton X-100) overnight at 4°C, and then stored at 220°C. Proteins were separated on SDS–10% polyacrylamide gels following Laemmli’s method and detected using a silver staining kit (Pharmacia). Western blot analysis was carried out using mouse anti-NS3 monoclonal antibody (Biodesign), Vectastain ABC-PO (mouse IgG) kit (Vector), and the enhanced chemiluminescence system (Amersham). Helicase Assay (SPA System) The structure of RNA/DNA hetero duplex used as the substrate for the HCV helicase is shown in Fig. 1.

The template RNA was synthesized by Sawady Technology (Tokyo, Japan). The release strand DNA (referred to as annealed oligo, specific radioactivity .1700 Ci/mmol) was purchased from Amersham. Those sequences are shown below. Template RNA: 59-ACGUAGGUUCUGAG GGUGGCGGUACUAACGUC-39, 32 mer Annealed oligo: 59-TAGTACC GCCACCCTCAGAACC[3H]T25-39, 47 mer Both strands were mixed at a molar ratio of annealed oligo to template RNA of 1:1.66 in 100 ml of substrate dilution buffer in the helicase [3H] SPA enzyme assay system (Amersham). The mixture was heated at 100°C for 5 min and transferred to 65°C for 30 min and then incubated at 25°C overnight. The hybridized product, helicase substrate, was stored at 4°C. A schematic diagram of helicase assay is shown in Fig. 1. Standard helicase reactions were carried out according to the manufacturer’s manual in the helicase [3H] SPA enzyme assay system unless otherwise indicated. The reaction mixture (50 ml) containing 10 ml (20 ng) of purified NS3 protein, 1 ml of substrate (40 fmol, 6,250 cpm/pmol), 25 mM Mops–KOH, pH 6.5, 5 mM ATP, and 3 mM MgCl2 was incubated at 37°C for 30 min in OptiPlate (Packard). The reaction was terminated by adding 10 ml of stop/capture reagent containing 0.9 pmol of capture oligo (Amersham) and incubated at 37°C for 15 min. All experiments were triplicated. Helicase activity was calculated as the percentage unwinding (the percentage of SPA count of annealed oligo unwound by the enzyme to the one unwound by heat denaturation). Helicase Assay (Conventional Method) For the substrate for conventional helicase assay, RNA/DNA hetero duplex was labeled with 32P instead of 3H. To label with 32P, cold annealed oligo whose sequence corresponds to the 3H-labeled annealed oligo was synthesized and end-labeled with [g-32P]ATP (Amersham) using Megalabel (Takara Syuzo, Kyoto, Japan). The resulting 32P-labeled annealed oligo was annealed with the template RNA as described above. The reaction mixture (20 ml) containing 4 ml (8 ng) of purified NS3 protein, 0.4 ml of substrate (16 fmol), 25 mM Mops–KOH, pH 6.5, 5 mM ATP, and 3 mM MgCl2 was incubated at 37°C for 30 min. The reaction was terminated by adding 5 ml of 53 RNA sample buffer (0.1 M Tris–HCl, pH 7.5, 50 mM EDTA, 0.5% SDS, 0.1% NP-40, 0.1% BPB, 0.1% XC). Mixtures were electrophoresed on 15% polyacrylamide (acryl-bis, 29:1)–

ASSAY FOR HEPATITIS C VIRUS HELICASE

123

hetero duplex, that is the substrate for the HCV helicase, was prepared by annealing both strands. In this method, the 3H-labeled annealed oligo released from the template RNA as a result of helicase action anneals to the capture oligo. Since the capture oligo is biotinylated on its 59 end, when streptavidincoated SPA beads are added, the unwound annealed oligo binds to the bead via the capture oligo and is able to stimulate the scintillant, resulting in a signal increase. Unwinding activity can be quantified by counting this signal. Immunoaffinity Purification of the NS3 Protein

FIG. 1. Schematic diagram of the HCV helicase assay using a [3H] SPA system. As a result of helicase action, the [3H] oligonucleotide (annealed oligo) is unwound from the template RNA and the released oligonucleotide anneals to a complementary biotinylated oligonucleotide (capture oligo). The radiolabeled complex binds to streptavidincoated SPA beads and stimulates the scintillant, resulting in a signal increase.

0.53 TBE– 0.1% SDS gels at 20 mA of constant current in a cold room. The gel was dried and autoradiography was carried out. The radioactivities of the bands were measured by Instant Imager (Packard). The percentage of annealed oligo unwound by the enzyme (percentage unwinding) was determined by comparison with a heat-denatured sample (100% unwinding). RESULTS AND DISCUSSION

The Principle of Detection of the HCV Helicase Activity Using a [3H] SPA System The schematic diagram of the principle of this method is shown in Fig. 1. The HCV helicase has been reported to function in a 39-to-59 direction with respect to the template strand, and to unwind not only the RNA/RNA duplex but also the RNA/DNA hetero duplex (22). It has been demonstrated that as few as three unpaired nucleotides on the 39-end of the template strand were sufficient to unwind efficiently for RNA helicase of bovine viral diarrhea virus (BVDV) related to HCV (23). Therefore, we utilized the 3H-labeled annealed oligo in the helicase [3H] SPA enzyme assay system kit as the release strand, and designed the template RNA which had sequences complementary to the annealed oligo (except poly[3H]dTMPs) and five additional bases each on both ends. The RNA/DNA

Insect cells infected with recombinant baculovirus which expresses a polyprotein from amino acid 813 in NS2 to amino acid 1723 in NS4B were used as a starting material. It was expected that the helicase domain located in the C-terminal portion of the NS3 protein would also be expressed in a native form, since we could successfully detect the NS3 protease activity using lysates from these cells. In addition, we confirmed that NS3 formed the complex with NS4A, which was also expressed in these cells, and localized in the membrane (data not shown). Therefore, the membrane fraction was prepared by sucrose discontinuous densitygradient centrifugation of the cell lysates. Using this membrane fraction, we initially evaluated the ability of the NS3 protein to displace the annealed oligo from the template RNA by the SPA system. Strand displacement was dependent on the amount of the membrane fraction added and the time of reaction. In contrast, in the case of the membrane fraction from the cells infected with the wild-type baculovirus (AcNPV), it could not be detected (data not shown). Therefore, it was thought that the expressed NS3 was responsible for this activity. However, when a standard SPA assay was carried out in the absence of ATP and MgCl2, the SPA count of this sample was lower than that of the background (count derived from free annealed oligos presented in the substrate solution). It was supposed to be due to the presence of DNase in the membrane fraction. To ascertain this, the same experiment was performed by the conventional method. The result of autoradiogram showed the degradation of the annealed oligo and the template RNA. This meant that not only DNase but also RNase was contained in the membrane fraction. It was necessary to use the highly purified NS3 with the elimination of DNase and RNase as an enzyme source for the measurement of HCV helicase activity. For this purpose, we tried to perform a one-step purification using an immunoaffinity column coupled with rabbit polyclonal antibodies specific to NS3. The NS3 protein was purified as described under Materials and Methods and the purity was evaluated

124

KYONO, MIYASHIRO, AND TAGUCHI

FIG. 3. Effect of enzyme concentration on substrate unwinding. The helicase reactions were carried out with the indicated amount of the NS3 protein under the standard assay conditions as described under Materials and Methods. Data are expressed as the mean 6 SE (n 5 3). FIG. 2. Purification of the HCV NS3 protein by immunoaffinity chromatography. (A) Silver-stained SDS–polyacrylamide gel. The membrane fraction (lane 1) was prepared from BVNS2D34D-infected Sf21 cells as described under Materials and Methods. This crude material was applied to an HCV NS3-specific antibody column. Lane 2 shows the EG buffer eluate from this column. Molecular size standards are shown in lane M. (B) Western blot analysis with the HCV NS3-specific monoclonal antibody of the same material shown in A.

by silver staining and Western blot analysis (Figs. 2A and 2B). Figure 2A shows that there were two major bands of 70 and 64 kDa, and three minor bands of approximately 75 kDa in the eluate. Western blot analysis was carried out using anti-NS3 mouse monoclonal antibody which could recognize the C-terminal portion (aa 1175 to 1657) of the NS3 protein (aa 1027 to 1657). A major band of 70 kDa and a faint band of 56 kDa were detected (Fig. 2B). Considering the size of the polypeptides, 70-kDa protein was NS3 and 56-kDa protein was a proteolytic product of NS3. The fact that 56-kDa protein could not be detected by silver staining indicates that its content in the eluate is extremely low. Since 64-kDa protein and three 75-kDa proteins observed by silver staining were not detected by Western blot analysis using the rabbit anti-NS3 antibody used for purification (data not shown), it is supposed that they were copurified with NS3 by interacting with NS3 or by nonspecific binding to the column. This eluate fraction contained the NS3 protease activity (data not shown), which indicates that NS3 was purified in a native form by the elution using ethylene glycol; therefore, it was expected that this fraction retained also RNA helicase activity located in the C-terminal of NS3. Neither DNase nor RNase activity was detected in this eluate. We obtained the NS3-enriched eluate suitable for the helicase assay, even though the NS3 protein was not completely homogeneous.

Detection of HCV Helicase Activity by the SPA System To investigate the dependency of the enzyme concentration, serial dilutions of purified NS3 were prepared and used for helicase assay as described under Materials and Methods. The results shown in Fig. 3 indicate that the rate of substrate unwinding increased with the enzyme concentration, and that most of the substrates were unwound at 40 ng/well of the enzyme. The time course shown in Fig. 4 was examined over 90 min using the amount of enzyme which could unwind about 70% of the substrate in a 60-min reaction (20 ng/well). The unwinding reaction proceeded linearly up to 30 min and reached plateau (64% unwinding) in a 60-min incubation. Comparison of the SPA System with the Conventional Method To investigate the relationship between the SPA system and the conventional method, we performed the

FIG. 4. Time course of helicase activity by purified HCV NS3 protein. The helicase reactions were carried out at 20 ng of the purified enzyme as described under Materials and Methods with the following modifications. The reactions were terminated at the indicated incubation time. Data are expressed as the mean 6 SE (n 5 3).

ASSAY FOR HEPATITIS C VIRUS HELICASE

125

The release of the radiolabeled annealed oligo from the template RNA was observed in the complete reaction mixture, while the omission of ATP or MgCl2, or substitution of ATP with a nonhydrolyzable ATP analog, AdoBzSO2F, eliminated the unwinding activity. Thus we could confirm that the HCV helicase activity was dependent on the presence of ATP and Mg21 in our assay system as it has been reported by other groups. Using the SPA system, the same set of experiments as described above was carried out and the results are shown in Fig. 5b. The results obtained by this method showed a good correlation with those obtained by the conventional method. Also, this method showed less deviation of the data and better reproducibility than the conventional method. Since it is not necessary to perform gel electrophoresis in this method, the time needed to complete all the steps of an assay is very short. Moreover, since SPA system does not need any separation steps and all the steps can be performed in the same 96-well microtiter plate in the presence of a low-energy beta emitter, it enables dealing with a large number of samples at the same time safely and easily. In conclusion, our results demonstrate that this SPA system is suitable for quantitative assay of HCV helicase and is useful for high-throughput screening of the inhibitors. This method will accelerate the finding of the inhibitors of HCV helicase. ACKNOWLEDGMENTS

FIG. 5. Comparison of the SPA system with the conventional method in detection of HCV helicase activity. Using standard reaction conditions (except as described below), helicase activity was assessed by both the conventional method (a) and the SPA system (b). (a) The autoradiogram of the helicase reaction. The typical result of three experiments is shown. Values of percentage unwinding were calculated by quantifying the radioactivity of each band, and are indicated below a. Results are means 6 SE (n 5 3). Lanes 1 and 2 represent reaction mixtures lacking enzyme that were either left native (2E) or boiled (boiled). Lane 3, complete reaction mixture. Lanes 4, 5, and 6, complete reaction mixtures with ATP omitted (lane 4), with the nonhydrolyzable analog AdoBzSO2F substituted for ATP (lane 5), or with MgCl2 omitted (lane 6). (b) The same helicase reactions as indicated in a were carried out by SPA system. Results are means 6 SE (n 5 3). Values above the bars indicate percentage unwinding.

helicase assay by the conventional method. The products of the reaction were electrophoresed using a 15% gel. Bands were visualized by autoradiography and are shown in Fig. 5a. The values of percentage unwinding obtained by quantitating the radioactivities of the bands are indicated below each lane.

We are greatly indebted to Drs. T. Ishizuka, S. Komatsubara, M. Sugiura, and K. Kawashima for encouraging and supporting this work. We also thank Dr. A. Aoyama for critical reading of the manuscript.

REFERENCES 1. Choo, Q. L., Kuo, G., Weiner, A. J., Overby, L. R., Bradley, D. W., and Houghton, M. (1989) Science 244, 359 –362. 2. Kuo, G., Choo, Q. L., Alter, H. J., Gitnick, G. L., Redeker, A. G., Purcell, R. H., Miyamura, T., Dienstag, J. L., Alter, M. J., and Stevens, C. E. (1989) Science 244, 362–364. 3. Saito, I., Miyamura, T., Ohbayashi, A., Harada, H., Katayama, T., Kikuchi, S., Watanabe, Y., Koi, S., Onji, M., and Ohta, Y. (1990) Proc. Natl. Acad. Sci. USA 87, 6547– 6549. 4. Bukh, J., Miller, R. H., Kew, M. C., and Purcell, R. H. (1993) Proc. Natl. Acad. Sci. USA 90, 1848 –1851. 5. Choo, Q. L., Richman, K. H., Han, J. H., Berger, K., Lee, C., Dong, C., Gallegos, C., Coit, D., Medina-Selby, R., and Barr, P. J. (1991) Proc. Natl. Acad. Sci. USA 88, 2451–2455. 6. Miller, R. H., and Purcell, R. H. (1990) Proc. Natl. Acad. Sci. USA 87, 2057–2061. 7. Takamizawa, A., Mori, C., Fuke, I., Manabe, S., Murakami, S., Fujita, J., Onishi, E., Andoh, T., Yoshida, I., and Okayama, H. (1991) J. Virol. 65, 1105–1113. 8. Kato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T., and Shimotohno, K. (1990) Proc. Natl. Acad. Sci. USA 87, 9524 –9528.

126

KYONO, MIYASHIRO, AND TAGUCHI

9. Hijikata, M., Kato, N., Ootsuyama, Y., Nakagawa, M., and Shimotohno, K. (1991) Proc. Natl. Acad. Sci. USA 88, 5547–5551. 10. Hijikata, M., Mizushima, H., Tanji, Y., Komoda, Y., Hirowatari, Y., Akagi, T., Kato, N., Kimura, K., and Shimotohno, K. (1993) Proc. Natl. Acad. Sci. USA 90, 10773–10777. 11. Hijikata, M., Mizushima, H., Akagi, T., Mori, S., Kakiuchi, N., Kato, N., Tanaka, T., Kimura, K., and Shimotohno, K. (1993) J. Virol. 67, 4665– 4675. 12. Grakoui, A., Wychowski, C., Lin, C., Feinstone, S. M., and Rice, C. M. (1993) J. Virol. 67, 1385–1395. 13. Grakoui, A., McCourt, D. W., Wychowski, C., Feinstone, S. M., and Rice, C. M. (1993) J. Virol. 67, 2832–2843. 14. Bartenschlager, R., Ahlborn-Laake, L., Mous, J., and Jacobsen, H. (1993) J. Virol. 67, 3835–3844. 15. Tomei, L., Failla, C., Santolini, E., De Francesco, R., and La Monica, N. (1993) J. Virol. 67, 4017– 4026.

16. Eckart, M. R., Selby, M., Masiarz, F., Lee, C., Berger, K., Crawford, K., Kuo, C., Kuo, G., Houghton, M., and Choo, Q. L. (1993) Biochem. Biophys. Res. Commun. 192, 399 – 406. 17. Tanji, Y., Hijikata, M., Hirowatari, Y., and Shimotohno, K. (1994) Gene 145, 215–219. 18. Schmid, S. R., and Linder, P. (1992) Mol. Microbiol. 6, 283–291. 19. Fuller-Pace, F. V. (1994) Trends Cell Biol. 4, 271–274. 20. Schneider, C., Newman, R. A., Sutherland, D. R., Asser, U., and Greaves, M. F. (1982) J. Biol. Chem. 257, 10766 –10769. 21. Thompson, N. E., Hager, D. A., and Burgess, R. R. (1992) Biochemistry 31, 7003–7008. 22. Kim, D. W., Gwack, Y., Han, J. H., and Choe, J. (1995) Biochem. Biophys. Res. Commun. 215, 160 –166. 23. Warrener, P., and Collett, M. S. (1995) J. Virol. 69, 1720 – 1726.