Detection of human genome mutations associated with pregnancy complications using 3-D microarray based on macroporous polymer monoliths

Talanta 147 (2016) 537–546

Contents lists available at ScienceDirect

Talanta journal homepage: www.elsevier.com/locate/talanta

Detection of human genome mutations associated with pregnancy complications using 3-D microarray based on macroporous polymer monoliths A.S. Glotov a,b, E.S. Sinitsyna c,d, M.M. Danilova b, E.S. Vashukova b, J.G. Walter e, F. Stahl e, V.S. Baranov a,b, E.G. Vlakh c,d, T.B. Tennikova c,d,n a

Faculty of Biology, Saint-Petersburg State University, St. Petersburg, Russia D.O. Ott Research Institute of Obstetrics and Gynecology, Russian Academy of Medical Sciences, St. Petersburg, Russia Institute of Chemistry, Saint-Petersburg State University, St. Petersburg, Russia d Institute of Macromolecular Compound, Russian Academy of Sciences, St. Petersburg, Russia e Institute for Technical Chemistry, Leibniz University, Hannover, Germany b

с

art ic l e i nf o

a b s t r a c t

Article history: Received 8 June 2015 Received in revised form 21 September 2015 Accepted 27 September 2015

Analysis of variations in DNA structure using a low-density microarray technology for routine diagnostic in evidence-based medicine is still relevant. In this work the applicability of 3-D macroporous monolithic methacrylate-based platforms for detection of different pathogenic genomic substitutions was studied. The detection of nucleotide replacements in F5 (Leiden G/A, rs6025), MTHFR (C/T, rs1801133) and ITGB3 (T/C, rs5918), involved in coagulation, and COMT (C/G, rs4818), TPH2 (T/A, rs11178997), PON1 (T/A rs854560), AGTR2 (C/A, rs11091046) and SERPINE1 (5G/4G, rs1799889), associated with pregnancy complications, was performed. The effect of such parameters as amount and type of oligonucleotide probe, amount of PCR product on signal-to-noise ratio, as well as mismatch discrimination was analyzed. Sensitivity and specificity of mutation detections were coincided and equal to 98.6%. The analysis of SERPINE1 and MTHFR genotypes by both NGS and developed microarray was performed and compared. & 2015 Elsevier B.V. All rights reserved.

Keywords: Mutations Single nucleotide polymorphism (SNP) DNA microarrays Macroporous polymer monoliths Pregnancy complications

1. Introduction The microarray technology is used in biomedicine for more than 20 years with tremendous impact in many aspects of both practice and research. This nanomethodology appeared to be quite important innovation providing, among others, highly precise and robust approach to medical genetics diagnostics [1,2]. The discussed technology allows application of very small amounts of starting material, the reaction is performed in nanovolumes, and, that is the main achievement, a simultaneous multiparametric analysis of multiple genes can be easily carried out. The sensitivity of probe detection is comparable to that established for standard PCR methods currently widely used for DNA diagnostics and, in some cases, appears to be even higher [3]. The application of microarray technology makes possible the analysis of various DNA changes: translocation, duplications, deletions, microdeletion and single nucleotide substitutions [4,5]. n Corresponding author at: Institute of Macromolecular Compounds, Bolshoy pr. 31, 199004 St. Petersburg, Russia. Fax: þ7 812 323 68 69. E-mail address: [email protected] (T.B. Tennikova).

http://dx.doi.org/10.1016/j.talanta.2015.09.066 0039-9140/& 2015 Elsevier B.V. All rights reserved.

High-density SNP microarrays are most common and enable simultaneous genotyping of more than a million SNPs. Such biochips are expensive but nevertheless used in microdeletions screening [6], genome wide association studies (GWAS) [7,8], in diagnostics of some hereditary and common diseases [9–11]. Despite undoubting advantages of high-density SNP microarrays, today they are replaced by next generation sequencing (NGS). NGS represents a genetic technology with highest performance [12]. However, this progressive methodology has its own disadvantages. The main can be related to a high cost per run and a higher indel error rate [13]. Today NGS, together with GWAS, seem to be more attractive and, thus, practically usable comparing to conventional genetic diagnostics [14]. The development of low-density biochips, especially for routine diagnostics in evidence-based medicine, is still important [2,15]. The most significant, after genetic diseases, are the health problems related to a predisposition to cardio vascular affections [16]. Among those, pre-eclampsia as pregnancy complication caused by thrombophilia, occupies a particular place [17]. Thrombophilia is the abnormality of blood coagulation that increases the risk of thrombosis [18]. Factor V Leiden, prothrombin mutations,

538

A.S. Glotov et al. / Talanta 147 (2016) 537–546

variations in 5,10-methylenetetrahydrofolate reductase gene and others represent the most common inherited causes of thrombophilia [19–21]. The same factors lead to the risk of preeclampsia and other pregnancy complications [17]. However, apart from the genes of thrombophilia, more than several 100 genes are involved in pregnancy complications [22]. The most widespread of genetic tests used for diagnostics of hereditary predisposition to disorders of pregnancy were applied for hereditary thrombophilia detection. For that the different types of microarrays were used. These are electronic microarray-based diagnostic assay [10] three-biosensor panel for visual detection thrombophilia-associated mutations [18], Verigenes F5/F2/MTHFR Nucleic Acid Tests [20], Human cardio vascular diseases (CVD) focused genotyping array [23], and others. Most of these techniques were focused on the analysis of certain markers, but not for detection of different types of oligonucleotide substitutions. There are two main approaches for DNA microarray fabrication: (1) in situ synthesis of oligonucleotides on the support and (2) printing of pre-synthesized oligonucleotides onto a solid substrate [24]. The efficiency of DNA microarray depends tremendously on the properties of used support. Among existing platforms for DNA microarrays so called two-dimensional (2-D) and three-dimensional (3-D) are known and practically used. In first case, DNA hybridizes with oligonucleotide bound to a rigid monolayer microarray's surface. 2-D microarrays based on glass slides, non-porous synthetic polymers and metals provide the uniform signal and satisfactory reproducibility of the results [25]. At the same time, 3-D devices have much higher immobilization capacity and, consequently, demonstrate the increased analytical sensitivity, as well as provide similar to solution conditions for immobilized biomolecules and, therefore, prevent the loss of their biological activity [26]. Polyacrylamide gel pads [27,28] and agarose gel films [29] attached to a glass surface represent the widely used 3-D supports for DNA microarrays. However, there are still some drawbacks peculiar to gel-based devices. First misadventure is related to the necessity of gel surface activation by additional chemical treatments, which are inconvenient and sometimes even laborious [27,29]. Second, the three-dimensional gel structure can represent an additional barrier for diffusion of large DNA molecules and require long incubation times. And finally, it is difficult to wash away the non-specifically bound labeled targets that results in high background signal and makes this technology especially difficult to identify single nucleotide mismatch. The microarrays based on nitrocellulose membranes coated with different functional polymers allowing the covalent oligonucleotide immobilization are another popular example of 3-D materials. Due to their enormous binding capacity they provide much higher signal intensity in comparison with 2-D microarrays [30]. Nevertheless, similarly to polyacrylamide and agarose, nitrocellulose itself also does not contain the functional groups for covalent binding and needs in additional activation. Recently, the idea of fabrication of 3-D microarrays based on rigid macroporous monolithic materials has been realized in our group [31–33]. Previously, we developed the method of preparation of polymer monolithic layers, optimized the ligand immobilization procedure and proved the suitability of these macroporous monolithic materials for creation of both protein and DNA microarrays [32,33]. The developed polymethcarylate layers are characterized by much higher probe loading, higher yield of target–ligand pair formation and, consequently, higher efficiency/ sensitivity comparably to 2-D glass matrixes. Contrary to other 3-D materials used for microarrays, the discussed polymer media contain in situ introduced reactive groups that can be directly used for easy one-step probe immobilization [31,33,34]. Among the other advantages of polymer monoliths, good spot morphology, mechanical and chemical stability, as well as featured porous

structure allowing the efficient operations with different classes of substances, has to be also mentioned. Additionally, it should be noted that macroporous structure of these supports provides a homogeneous liquid phase environment rather than a heterogeneous liquid–solid interface, which definitely will improve the nucleic acid hybridization inside the pores. The aim of present study was to confirm the analytical potential of macroporous monolithic layers for detection and discrimination of different cases of pathogenic genomic substitutions. The variations in F5 (Leiden G/A, rs6025), MTHFR (C/T, rs1801133) and ITGB3 (T/C, rs5918), involved in coagulation, as well as COMT (C/G, rs4818), TPH2 (T/A, rs11178997), PON1 (T/A, rs854560), AGTR2 (C/A, rs11091046) and SERPINE1 (5G/4G, rs1799889) associated with pregnancy complications [20,35–39], were selected for test experiments. The lab-made macroporous platforms of poly (glycidyl methacrylate-co-ethylene glycol dimethacrylate) covalently bound to the surface of specially treated glass slides were used for microarray preparation.

2. Materials and methods 2.1. DNA isolation DNA samples from the blood of 36 donors were isolated by phenol-chloroform extraction as recently described [40]. Among those, 26 samples were used for microarray development and 10 ones were applied for control procedure. DNA concentration was evaluated by Qubit™ software (Invitrogen, USA) with Qubit™ DNA HS Assay Kits according to the manufacturer's instructions. All donors have signed the informed consent. 2.2. DNA primers and probes synthesis The nucleotide sequences of genes fragments (primers and probes) were obtained from online «Ensemble» database (EU/USA). Primers needed to amplify these fragments were selected using the program «Oligo 6» (USA) and «Primer3web» (http://bioinfo.ut. ee/primer3). The specificity of primers was justified using the program «Nucleotide-nucleotide BLAST» (NCBI, USA). Oligonucleotides intended for immobilization on a biochip and primers were obtained using 394 DNA/RNA synthesizer (Applied Biosystems, USA) according to standard phosphoroamidate method. The 3′ end of each oligonucleotide probe beard a spacer with free amino group, which was introduced during synthesis using 3′Amino-Modifier C7 CGP 500 (Glen Research, USA). Nucleotide sequences of immobilized oligos, primers and target mutations (polymorphisms) are presented in Table 1. 2.3. Asymmetric multiplex polymerase chain reaction (PCR) The conditions for asymmetric PCR were exactly the same as those for symmetric method with exception of ratios of primers used. In our case, the forward and Cy5-labeled reverse primer ratio was 1:10 in order to obtain significant excess of labeled singlestranded PCR product. PCR reactions were set in 50 ml of reaction volume with 20–100 ng template (DNA), 0.4 pmol forward and 4 pmol reverse primers, 67 mM Tris–HCl (pH 8.6), 166 mM (NH4)2SO4, 0.01% Triton X-100, 1.5 mM MgCl2, 0.2 mM each dNTP (Sileks, Russia), and 2.5 U Taq DNA polymerase (Sileks, Russia). PCR conditions were as follows: an initial denaturation at 94 °C for 4 min followed by 37 amplification cycles of 30 s denaturation at 94 °C, 30 s annealing at 60 °C, 1 min elongation at 72 °C, and 5 min final elongation at 72 °C. PCR was run on thermal cycler 2720 (Applied Biosystems, USA). The presence of PCR products was confirmed via 6% polyacrylamide gel electrophoresis (Sigma, USA)

A.S. Glotov et al. / Talanta 147 (2016) 537–546

539

Table 1 The sequences of used oligonucleotide probes. Gene, polymorphism

Nucleotide

Sequence

Length

G/C-pair

Abbreviation

MTHFR, 677C 4T (rs1801133)

C T C T C T C T G A G A T C T C C G C G T A T A T A C A T A T A T A 5G 4G

CTGCGGGAGCCGATTTCATC CTGCGGGAGTCGATTTCATC TGCGGGAGCCGATTTCAT TGCGGGAGTCGATTTCAT GGAGCCGATTTCATC GGAGTCGATTTCATC TGCGGGAGCCGATTTCAT TGCGGGAGTCGATTTCATC TGGACAGGCGAGGAATACAG CTGGACAGGCAAGGAATACAG ACAGGCGAGGAATACAG GACAGGCAAGGAATACAG CCTGCCTCTGGGCTCAC CTGCCTCCGGGCTCAC CCTGCCTCTGGGCTCA CCTGCCTCCGGGCTCA GCGAGGCTCATCACCAT GCGAGGCTGATCACCAT GGCGAGGCTCATCACCATCGA GGCGAGGCTGATCACCATCGA CATTACACATTGTACGCTTGT CATTACACAATGTACGCTTGT ACACATTGTACGCTTGTGTCA ACACAATGTACGCTTGTGTCA CAAGCGTACAATGTGTAATGA CAAGCGTACATTGTGTAATGA CTTTAAAAACGCTATAAAT CTTTAAAAAAGCTATAAAT CTCTGAAGACTTGGAGATACT CTCTGAAGACATGGAGATACT CTGAAGACTTGGAGATA CTGAAGACATGGAGATA GGCTCTGAAGACTTGGAGATACTGC GGCTCTGAAGACATGGAGATACTGC GACACGTGGGGGAGTCAGC GACACGTGGGGAGTCAGCC

20 20 18 18 15 16 18 19 20 21 17 18 17 16 16 16 17 17 21 21 21 21 21 21 21 21 19 19 21 21 17 17 25 25 19 19

12 11 10 9 8 7 10 10 11 11 9 9 12 12 11 12 10 10 13 13 8 8 9 9 8 8 4 3 9 9 7 7 12 12 13 13

672_1 672_2 mthfr_1 mthfr_2 mthfr_3 mthfr_4 mthfr_5 mthfr_6 f5_1 f5_2 f5_3 f5_4 itgb3_1 itgb3_2 677 676 comt_1 comt_2 comt_3 comt_4 tph2_1 tph2_2 tph2_3 tph2_4 tph2_rev_1 tph2_rev_2 380 381 pon_1 pon_2 pon_3 pon_4 pon_5 pon_6 pai_2 pai_1

F5, 1691G 4A (rs6025)

ITGB3, 1565T 4C (rs5918)

COMT, C/G rs4818

TPH2, T/A rs11178997

AGTR2, 3123C4A (rs11091046) PON1, T/A rs854560

SERPINE1 (PAI1) 5G 4 4G (rs1799889)

in TBE buffer (Serva, Germany) followed by staining with ethidium bromide. 5 mL of PCR reaction products was loaded on a gel and visualized by UV transilluminator. 2.4. Probe immobilization, PCR product hybridization and image analysis The procedure of fabrication of 3-D microarray platform includes synthesis of macroporous monolithic layer inside the specially treated operative well on the glass surface (microscopic glass slides). The procedure of operative well manufacturing can be found elsewhere [32]. The polymer layer was synthesized using glycidyl methcaryate (GMA) and ethylene glycol dimethacrylate (EDMA) as monomers and cyclohexanol as a porogen. The ratios GMA/EDMA and cyclohexanol/monomers were equal to 60/ 40 vol%. 1% of 2-hydroxy-2-methylpropiophenon (initiator) from the mass of monomers was used for polymerization. All of used chemicals were purchased from Sigma-Aldrich (Germany). Polymerization mixture was purged with nitrogen for 5 min. Preliminary prepared and functionalized wells on a glass surface were filled with reaction mixture and polymerization was allowed to proceed under UV-lamp at room temperature in nitrogen medium for 30 min. The thickness of polymer layers was equal to 0.15 mm. The mean pore size, specific surface area and porosity were 1.5 μm, 25 m2/g and 60%, respectively. For fabrication of DNA microarray 200 pL of 50 mM solution of oligonucleotide probes in 3  SSC was spotted on the surface of macroporous monolithic layers in 10 replicates. The loading of ligands was carried out using the piezoelectric biochip arrayer NanoPlotter NP 2.1 (Gesim, Germany). After spotting, the slide

surface was baked at 80 °C for 2 h. Thereafter the arrays were stored for 4 h at room temperature. The washing and surface blocking procedures were performed on Eppendorf shaker (Germany). To remove unbound oligonucleotides after spotting, the slides were washed with 0.2% SDS for 10 min, then with ddH2O for 5 min. To carry out surface blocking, 1% BSA solution in 6  SSC buffer containing 0.1% SDS was used. The slides were incubated at 42 °C for 45 min, then washed twice for 10 min with ddH2O and dried with air. The hybridization procedure was carried out using Thermomixer Comfort Eppendorf in secure seal chambers (Sigma-Aldrich, Germany and Grace Biolabs, USA). For hybridization, the solution of PCR-product containing 70 ng of target DNA in hybridization buffer (30% formamide solution in 4  SSPE and 2.5  Denahards solution) was incubated at 95 °C for 3 min and then additionally in ice for 2 min. After that 1/10 volume of 20 mg/ml Topblock (Fluka, Switzerland) was added. Initial SSPE buffer 20  contains 0.02 M EDTA and 2.98 M NaCl in 0.2 M phosphate buffer, pH 7.4 (SigmaAldrich). During the incubation, the supports were shaken at 650 rpm. The hybridization was allowed to proceed for 4 h at 42 °C. After hybridization step, the slides were washed using following washing buffers: 2  SSC containing 0.1% SDS (pH 7.0) for 15 min, 1  SSC for 10 min and 0.5  SSC (pH 7.0) for 10 min. The microarrays were dried with compressed air and scanned using the 635 nm filter. Scanning was performed using GenePix4000 B scanner (Axon Instruments, USA). The GenePix 6.1 software was applied to quantify the scanned data. Mean values of all replicates were applied for calculations. Relative signal intensity was calculated as a difference of mean signal (SM) and mean background signal (BM). The reproducibility of results obtained was estimated

540

A.S. Glotov et al. / Talanta 147 (2016) 537–546

by intrafield (K1) and interfield (K2) coefficient of variation[32]: Coefficient of variation ¼standard deviation/mean of signal intensity.

Table 2 The effect of PCR-product amount of MTHFR (C/T genotype) on analytical parameters. Probes

7 ng of PCR product (PMT gain 750)

3. Results and discussions For detection of different human genome mutations associated with pregnancy complications, the next types of substitutions were chosen to design the oligonucleotide probes: purine–purine (rs6025 G/A), purine–pyrimidine (rs11178997 T/A, rs854560 T/A, rs11091046 C/A, rs4818 C/G), pyrimidine–pyrimidine changes (rs1801133 C/T, rs5918 T/C), and repetitions of purine (5G/4G, rs1799889). A frequently used microarray approach is based on the selection of target gene polymorphisms, enabling amplification using specific PCR primers followed by discrimination of different products by hybridization with specific oligonucleotides. In order to detect different genetic variants using biochip technique it may be necessary to maximize mismatch discrimination for some targets while maintaining tolerating mismatches for others [2,5,41]. Previously, it was defined that higher specificity was achieved with the use of shorter oligonucleotide probes, but oligonucleotides with longer chains were associated with higher hybridization signals. Furthermore, mismatches located in the middle of oligonucleotide chain have a greater effect on hybridization than those disposed close to the ends of chain [2,5,41]. Hybridization is also dependent on the properties of target nucleic acid. Thus, the probe length, number and distribution of mismatches between the oligonucleotide probe and target DNA, orientation of oligonucleotide towards the solid surface, as well as presence or absence of intermediate spacer represent key parameters affecting the microarray efficiency [2,5,41]. However, among the mentioned factors, the sequence of oligonucleotide, its concentration and the concentration of PCR product [2,5,41] are the most important issues discussed for microarrays. In present study the possibilities of microarrays based on macroporous polymethacrylate monoliths to detect different human genome mutations were carefully tested with the focus on mentioned above features. 3.1. Optimization of analytical parameters In order to optimize such analytical parameters as amounts of oligonucleotide probe and PCR product, as well as the type of oligonucleotide probe, the pyrimidine–pyrimidine change in MTHFR gene (rs1801133C/T) was chosen. The oligonucleotide probes were selected on the basis of previously established conditions [2,5] with a few modifications. Particularly, four oligonucleotide pairs with a chain length from 15 to 20 nucleotides and containing from 7 to 12G/C bases were used as probes (Table 1). Except one pair, the substitutions were located in the central part of oligonucleotide sequence. The samples of rs1801133 of MTHFR with different concentrations of PCR products were used as DNA matrix. To eliminate the influence of perfect match or mismatch probe on signal-to-noise ratio, the DNA sample with heterozygous genotype (C/T) was applied at first step of optimization. The use of three different oligonucleotide concentrations equal to 25, 50 and 100 μM to print the probes allowed conclusion that the most optimal concentration was 50 μM (data not presented) due to the best SNR values. To study the effect of PCR product amount on signal-to-noise ratio (SNR), 7, 70 and 150 nanograms (ng) of analyzed material (26 DNA samples) were used. Except two probes (mthfr_3 and mthfr_4), which demonstrated very low SNR (6–7), the application for hybridization of 7 ng of PCR product gave SNR values from 25 to 48 at PMT gain equal to 750 (Table 2). Ten-times increasing of amount of PCR product led to considerable growth of

672_1 672_2 mthfr_5 mthfr_6 mthfr_1 mthfr_2 mthfr_3 mthfr_4 a b

70 ng of PCR product (PMT gain 600)

150 ng of PCR product (PMT gain 400)

SNR

K1a, %

K2b, %

SNR

K1a, %

K2b, %

SNR

K1a, %

K2b, %

25 48 26 48 27 31 7 6

6 5 8 5 6 6 6 6

8 8 11 7 9 9 12 9

130 140 145 170 215 220 21 37

7 5 6 4 4 3 8 11

8 7 10 9 8 8 11 12

767 705 760 710 460 430 46 39

7 5 6 8 3 4 3 7

9 10 9 11 9 9 8 10

Intrafield coefficient of variation. Interfield coefficient of variation.

sensitivity. Particularly, in this case SNR grew up to 130–220 for different probes (except mthfr_3 and mthfr_4). The application of 150 ng of PCR product allowed preparation of very highly sensitive system (SNR increased up to 460–760 for different probes except two mentioned above) (Table 2). Certainly, this result has to be related to the high surface capacity of used macroporous monoliths representing 3-D platforms. For comparison, the optimal amount of PCR product usually used for glass biochips is about 40 ng [42]. At used conditions intrafield coefficients of variation (K1) for MTHFR gene differed from 3% to 11%, whereas interfield coefficients of variation were in the range 7–12% for different oligonucleotide probes (Table 2). From the data obtained it can be concluded that the worse probe pair, namely, mthfr_3/mthfr_4, represented the shortest nucleotide consequence and had substitutions shifted to its 5′-end. Since this pair demonstrated very low signal intensity and, consequently, low SNR, it was excluded from analysis of homozygous genotypes. Other three pairs were used to discriminate the DNA samples with different homozygous genotypes, C/C or T/T, respectively (Fig. 1). The tested probes appeared to be highly effective. Particularly, the perfect match/mismatch ratio for C/C genotype was 3.3 and for T/T genotype this value reached 31.5. In order to evaluate the analytical potential of macroporous monolithic layers for other types of substitutions, particularly purine–purine (rs6025 G/A), purine–pyrimidine (rs11178997 T/A, rs854560 T/A, rs11091046 C/A, rs4818 C/G), pyrimidine–pyrimidine changes (rs5918 T/C), and repetitions of short purine (5G/ 4G, rs1799889) were explored. Besides AGTR2 (rs11091046) and SERPINE1 (rs1799889), for other genes two to three pairs of oligonucleotide probes for each mutation in 26 DNA samples were screened to prepare the optimal test-system. All used probes are listed in Table 1. To study the hybridization of PCR product with immobilized oligonucleotide probe, the amount of analyzed product was 70 ng. On one hand, it provides high sensitivity of detection, on another hand, the application of such amount allows the spare use of the valuable biological substances. The results on hybridization of different genotypes of F5 (Leiden G/A, rs6025) with immobilized probes are presented in Fig. 2. In all cases, the genes were correctly hybridized with probes. Between two tested pairs, the most efficient hybridization was observed for more elongated oligonucleotide probes, namely, f5_1 and f5_2, consisted of 20–21 nucleotides and characterized with higher amount of G/C pair (11) contrary to f5_3 and f5_4, for which this value was equal to 9. The perfect match/mismatch ratios were 9.5 for G/G and 4.3 for A/A genotypes. For heterozygous genotype the detected signals for both probes coincided proving the correct hybridization.

A.S. Glotov et al. / Talanta 147 (2016) 537–546

Fig. 1. SNR values obtained after hybridization of PCR products with T/T and C/C genotypes of MTHFR (C/T, rs1801133) with oligonucleotide probes immobilized on macroporous monoliths. Amount of PCR product used for hybridization was 150 ng, PMT gain was 400.

As it seen from Fig. 3A for COMT (C/G, rs4818) gene the best hybridization was observed for comt_3 and comt_4 probes consisting of 21 nucleotides and characterized with amount of G/C pair equal to 13. The perfect match/mismatch ratios were 4.5 for G/G and 13 for C/C genotypes. The similar results were also observed for AGTR2 (C/A, rs11091046) gene (see Supplementary, Supplementary, Fig. S1C). The perfect match/mismatch ratios were 18.8 for C/C genotype and 5.7 for A/A genotype. In the case of hybridization of different genotypes of PON1 (T/A, rs854560) with immobilized probes, the signal-to-noise ratio was raised with increase of oligonucleotide probe length (as well as G/ C pair). Among three tested pairs the most efficient hybridization was observed for oligonucleotides pon_5 and pon_6 consisted of 25 nucleotide units and characterized with higher amount of G/C pair (12) contrary to other probes (see Table 1). The perfect match/ mismatch ratios were 4.1 for T/T genotype and 2.6 for A/A genotype. As it was expected, for heterozygous genotype the detected signals for both probes were coincided (see Supplementary, Fig. S1А). In the investigation of TPH2, the effective probes (tph2_rev_1 and tph2_rev_2) consisted of 21 nucleotide units and characterized with amount of G/C pair equal to 9. The perfect match/mismatch ratios were 2.5 for T/T (for reverse strand –A/A). We did not check the A/A homozygous genotype due to the absence of A/A control sample caused by low frequency of this genotype in population ( o0.01). Among three oligonucleotide pairs studied for TPH2 polymorphism the hybridization was detected only for

541

oligonucleotides probes characterized with reverse sequence relatively to corresponding gene. Such effect may be associated with tertiary structure of DNA molecule [43]. Contrary to above discussed genes, where the application of oligonucleotide probe with chain length 18–21nucleotides was found to be optimal, in the case of ITGB3 (T/C, rs5918), two pairs of probes consisted of 16–17 nucleotides with 11–12G/C pairs were used. The results obtained are presented in Fig. 3B. The pair itgb_1 and itgb_2 demonstrated the better analytical potential comparatively to another oligonucleotide pair. In the case of AGTR2 (C/A, rs11091046) gene, the oligonucleotide pair, consisting of 19 nucleotides and containing only 3–4G/C, demonstrated the perfect match/mismatch ratios equal to 18.8 for C/C genotype and 5.7 for A/A genotype (see Supplementary, Fig. S1C). Basic hybridization characteristic of TPH2 (T/A, rs11178997), PON1 (T/A, rs854560), AGTR2 (C/A, rs11091046) and SERPINE1 (5G/ 4G, rs1799889) with immobilized probes are given in Supplementary data Fig. S1. In addition, contrary to genes containing SNP substitution, in the case of SERPINE1 (5G/4G), lower SNR values were obtained. This result is probably caused by peculiarities of hybridization between sequences containing homopolymeric tracts [44]. The perfect match/mismatch ratios were 3.7 for 5G/5G genotype and 5.6 for 4G/4G genotype. Based on highest SNR values the optimal characteristics of oligonucleotide probes for each type of nucleotide substitutions were summarized in the Table 3. It can be concluded that to create the efficient biochip based on macroporous monoliths, the optimal oligonucleotide probes were characterized with chain length of 18–25 nucleotides, the content of G/C bases was in the range of 9– 13 and the nucleotide substitutions were located in a central part of oligonucleotide sequence. According to the previous reports, hybridization signals were attenuated by different degrees depending on the identity of the mismatch, the position of the mismatch within the probe, and the length of the PCR product. However, the same mismatch caused different degrees of attenuation depending on the position of the probe within the hybridizing product. For example, the improved mismatch discrimination was observed for PCR products where a higher part of total length was proximal to the array surface. For all genotypes intrafield coefficients of variation did not exceed 11%, whereas the maximum values of interfield coefficients of variation except SERPINE1 were not more than 14%. In the case of SERPINE1 K2 was equal to 17%. 3.2. Common analysis of genotypes using optimized microarray To study the correctness of hybridization of different PCR products being in one mixture with corresponding oligonucleotide probes, the common biochips containing all optimal probes were prepared. In general, the biochip contained 16 oligonucleotide probes for analysis of SNP in 8 genes. Each probe was printed in 6 replicates. Three series of experiments were performed. In each series three biochips were treated with the mixture of PCR products corresponding to: (1) homozygous genotypes of wild variants; (2) homozygous genotypes of mutant variants; and (3) heterozygous genotypes. To prepare the mixture of PCR products, 40 ng of DNA for each gene except SERPINE1 were used. The amount of SERPINE1 was equal to 100 ng of DNA due to low SNR values detected on individual hybridization microarray. Thus, the total amount of DNA (the same 26 DNA samples) in the mixture was 380 ng. SNR parameters of performed experiments are shown in Table 4. As it was expected, the hybridization of SERPINE1 DNA of homozygous genotypes with immobilized probes was characterized with low SNR values.

542

A.S. Glotov et al. / Talanta 147 (2016) 537–546

Fig. 2. Probe printing scheme (A), hybridization pattern (B) and SNR signals obtained after hybridization of PCR products of F5 with printed probes. Amount of PCR products used for hybridization was 70 ng, PMT gain was 400.

3.3. Analysis of random mixtures using optimized microarray The accuracy of hybridizations was verified using mixtures of PCR products of following genotypes (chosen from investigated 26 DNA samples): mixture 1–F5 (rs6025 GA), MTHFR (rs1801133 TT), ITGB3 (rs5918 TT), TPH2 (rs11178997 TT), AGTR2 (rs11091046 CC), PON1 (rs854560 TT), SERPINE1 (rs1799889 5G5G) and COMT (rs4818 GG), and mixture 2–F5 (rs6025 GG), MTHFR (rs1801133 CT), ITGB3 (rs5918 CC), TPH2 (rs11178997 TA), AGTR2 (rs11091046

AA), PON1 (rs854560 TA), SERPINE1 (rs1799889 4G4G) and COMT (rs4818 CC). For example, the biochip scheme, image of hybridization pattern and SNR parameters, obtained with use of mixture 2, are shown in Fig. 4. Obviously that SNR parameters calculated after hybridization of immobilized oligonucleotide probes with corresponding DNA being in the random mixture were coincided with the results obtained for recognition of certain genotype in three previous experiments (Fig. 4C). Considering this fact, the certain intervals of perfect match/mismatch SNR ratio for

A.S. Glotov et al. / Talanta 147 (2016) 537–546

543

Fig. 3. SNR signals obtained after hybridization of PCR products of COMT and ITGB3 genes with corresponding oligonucleotide probes. Amount of PCR products used for hybridization was 70 ng, PMT gain 400.

544

A.S. Glotov et al. / Talanta 147 (2016) 537–546

Table 3 Parameters of oligonucleotide probes with high SNR depending on type of DNA substitutions. Type of substitution Purine–purine

G/A

Purine–pyrimidine

T/A C/A C/G

Pyrimidine–pyrimidine

C/T

Repeats of short purine

5G/4G

Best pair of oligonucleotides probes

MaxSNR

TGGACAGGCGAGGAATACAG CTGGACAGGCAAGGAATACAG GGCTCTGAAGACTTGGAGATACTGC GGCTCTGAAGACATGGAGATACTGC CTTTAAAAACGCTATAAAT CTTTAAAAAAGCTATAAAT GGCGAGGCTCATCACCATCGA GGCGAGGCTGATCACCATCGA TGCGGGAGCCGATTTCAT TGCGGGAGTCGATTTCAT GACACGTGGGGGAGTCAGC GACACGTGGGGAGTCAGCC

1400

Table 4 Analytical parameters of biochip hybridization pattern of PCR products with heterozygous, wild homozygous and mutant homozygous genotypes obtained for optimal oligonucleotide probes. Probes

f5_1 f5_2 mthfr_1 mthfr_2 itgb3_1 itgb3_2 com_3 com_4 tph_rev_1 tph_rev_2 380 381 pon_5 pon_6 pai_2 pai_1 a

Heterozygous genotype, PMT gain 400

Wild homozygous genotype, PMT gain 400

Mutant homozygous genotype, PMT gain 400

SNR

SNR

SNR

109 718 93 77 70 77 77 77 189 723 120 717 93 711 111 717 244 730 277 723 24 74 10 71 240 724 258 721 24 72 56 77

1577 7 17 1 1357 8 287 12 250 7 16 47 0 264 7 22 1387 6 362 7 16 857 7 557 2 27 2 164 7 11 597 3 197 1 97 6

294a 7 19 560a 7 40 37 1 1227 11 577 5 155 710 177 1 1857 4 – – 37 1 97 0 97 0 16 71 47 2 27 71

PMT gain 350.

discrimination of genotypes were proposed. The sensitivity and specificity of mutation detection analysis were evaluated by examination of 10 control biochips and 10 control DNA samples. Genotypes of control samples were detected by Sanger sequencing in Laboratory of prenatal diagnostics of D.O. Ott Research Institute of Obstetrics and Gynecology early [46]. The results of mutation detection for different genes are collected in Table 5. Except two cases, namely, the signal from one heterozygous genotype in TPH2 (rs11178997) gene and one heterozygous genotype in ITGB3 (rs5918) gene, all mutations were detected correctly. According to the results obtained sensitivity and specificity of developed microarray were coincided and equal to 98.6%. 3.4. Comparison of developed microarray and standard NGS method One of the objectives of our study was to compare analytical performance of developed microarray and standard NGS method (Electronic Supplementary data). For example, the sensitivity and specificity of detection in the experimental DNA samples of MTHFR (C/T, rs1801133) and SERPINE1 (5G/4G, rs1799889) heterozygous genotypes were compared. Indeed, the choice of mentioned variants was not occasional. The rs1801133 of MTHFR was included in comparison as a “good” marker. The variant of this gene represents the most common type of SNP [45] and can be detected perfectly by various techniques

Max prefect/mismatch ratios

Length

G/C-pair

9.5

20–21

11

575

4.1

25

12

150

18.8

19

3–4

815

13.0

21

13

470

31.4

18

9–10

115

5.6

19

13

[18,20,47–49]. Moreover, in the developed microarray 677C/T polymorphism demonstrated good analytical parameters, namely, perfect match/mismatch ratios and SNR values. In turn, rs1799889 of SERPINE1 was included into consideration as a “problem” marker [50,51]. The polymorphism of this gene represents ins/del variant and, as it is known, the detection of this gene by some techniques meets the problems and even fails. Thus, SNP and ins/del variants were evaluated using both technologies. The hybridization procedure of PCR product on macroporous monolithic layers was performed according to developed protocol; nucleotide substitution determination in chosen genes by NGS on Ion Torrent was carried out using “AmpliSeq” panel included forenamed genes (see Supplementary, Table S1), AmpliSeq Library Kit v2.0 and Ion 314™ Chip according to the Life Technologies (USA) protocol. The detection of nucleotide variation was carried out using «UGENE» software [52]. The examples of analysis of SERPINE1 and MTHFR genotypes by NGS sequencing on PGM (Ion Torrent) are given in Supplementary, Fig. S2. Genotypes in MTHFR were identified correctly by both technologies, but in SERPINE1 NGS sequencing the results were wrong or accidental due to imperfect signal alignment of the same nucleotide repeats. Summary of genotyping accuracy in all DNA samples by both methods is shown in Table 6. Both technologies demonstrate high sensitivity, but in the case of ins/del variation, the developed micro array technique had greater accuracy and specificity.

4. Conclusions Despite the development of the next generation sequencing technologies, low-density microarrays remain relevant for solving of a number of diagnostic problems. Among those, the precise diagnostics of mutations and polymorphisms in pregnancy complication genes related to thrombophilia looks as crucial. The results of our experiments revealed that new type of microarray based on rigid macroporous monolithic layers might be successfully used to detect the most frequent variants of nucleotide substitutions in human genome. The developed array allowed the correct determination of polymorphisms of eight genes: F5 (Leiden G/A, rs6025), MTHFR (C/T, rs1801133), ITGB3 (T/C, rs5918), COMT (C/G, rs4818), TPH2 (T/A, rs11178997), PON1 (T/A rs854560), AGTR2 (C/A, rs11091046) and SERPINE1 (5G/4G, rs1799889). Both, sensitivity and specificity were equal to 98.6%. The comparison of developed microarray and standard NGS method demonstrated high sensitivity, but in the case of ins/del variation, the biochip demonstrated greater accuracy and specificity. Thus, we may presume obvious advantages of biochip technology regarding to determination of certain substitution types. Moreover, the absolute applicability of monolithic macroporous platforms to fabricate the chips was confirmed for such fine analysis.

A.S. Glotov et al. / Talanta 147 (2016) 537–546

545

Fig. 4. Probe printing scheme (A), hybridization pattern (B) and SNR values (C) obtained after hybridization of PCR products from mixture 2 (see explanation in the text) with printed probes.

Acknowledgments

help in organization of all measurements and valuable discussions.

This work was financially supported by Grant of Russian Scientific Foundation (project 14-50-00069) and by personal Fellowship of President of Russian Federation (SP-2763.2015.4) for Dr. E. Sinitsyna. We also thank Prof. Thomas Scheper for his great

Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.talanta.2015.09.066.

546

A.S. Glotov et al. / Talanta 147 (2016) 537–546

Table 5 Accuracy of genotypes discrimination by the analysis of 3-D microarray based on macroporous monoliths. Gene, polymorphism Genotypes Wild/mutant SNR ratio interval

Correct genotypes

Uncorrect genotypes

MTHFR, 677C 4T (rs1801133)

4 4 2 6 3 1 5 1 3 3 2 5 5 4 – 3 1 1 4 5 1 3 5 2 73

0 0 0 0 0 0 0 1 0 0 0 0 0 1 N/An – 0 0 0 0 0 0 0 0 0 2

F5, 1691G 4A (rs6025) ITGB3, 1565T 4C (rs5918) COMT, C/G rs4818

TPH2, T/A rs11178997 AGTR2, 3123C 4A (rs11091046) PON1, T/A rs854560

SERPINE1 (PAI1) 5G 44G (rs1799889) All n

C/C C/T T/T G/G G/A A/A T/T T/C C/C C/C C/G G/G T/T T/A A/A C/C C/A A/A T/T T/A A/A 5G/5G 5G/4G 4G/4G

47 1.3–2.5 o 0.1 43.5 0.6–3.2 o 0.6 44 0.4–2.2 o 0.3 41.9 0.4–1.2 o 0.1 47.3 0.9–2.4 – 45.9 0.4–2.4 o 0.3 42.2 0.9–1.7 o 0.5 42.5 0.3–1.6 o 0.26

N/A–signal was not obtained.

Table 6 The comparison of analytical features of the NGS method and developed microarray. Genotype

Frequency of correct genotypes NGS sequencing (Ion Torrent)

SERPINE1 (PAI1), rs1799762 (5G 44G) 5G/5G 0/1 5G/4G 0/3 4G/4G 3/3 All 3/7 MTHFR, rs1801133 (677C 4T) 677C/C 1/1 677C/T 3/3 677T/T 3/3 All 7/7

Biochip

1/1 3/3 3/3 7/7 1/1 3/3 3/3 7/7

References [1] S.A. Cook, A. Rosenzweig, Circ. Res. 91 (2002) 559–564. [2] D. Gryadunov, E. Dementieva, V. Mikhailovich, T. Nasedkina, A. Rubina, E. Savvateeva, E. Fesenko, A. Chudinov, D. Zimenkov, A. Kolchinsky, A. Zasedatelev, Expert Rev. Mol. Diagn. 11 (2011) 839–853. [3] S. Landi, F. Gemignani, L. Gioia-Patricola, A. Chabrier, F. Canzian, Biotechniques 35 (2003) 816–820. [4] H.Y. Wang, M. Luo, I.V. Tereshchenko, D.M. Frikker, X. Cui, J.Y. Li, G. Hu, Y. Chu, M.A. Azaro, Y. Lin, L. Shen, Q. Yang, M.E. Kambouris, R. Gao, W. Shih, H. Li, Genome Res. 15 (2005) 276–283. [5] T.V. Nasedkina, N.A. Guseva, O.A. Gra, O.N. Mityaeva, A.V. Chudinov, A. S. Zasedatelev, Mol. Diagn. Ther. 13 (2009) 91–102. [6] E.R. Riggs, D.H. Ledbetter, C.L. Martin, Curr. Genet. Med. Rep. 2 (2014) 146–150. [7] N.L. Smith, M.H. Chen, A. Dehghan, D.P. Strachan, S. Basu, N. Soranzo, C. Hayward, I. Rudan, M. Sabater-Lleal, J.C. Bis, M.P. de Maat, A. Rumley, X. Kong, Q. Yang, F.M. Williams, V. Vitart, H. Campbell, A. Mälarstig, K. L. Wiggins, C.M. Van Duijn, W.L. McArdle, J.S. Pankow, A.D. Johnson, A. Silveira, B. McKnight, A.G. Uitterlinden, N. Aleksic, J.B. Meigs, A. Peters, W. Koenig, M. Cushman, S. Kathiresan, J.I. Rotter, E.G. Bovill, A. Hofman, E. Boerwinkle, G. H. Tofler, J.F. Peden, B.M. Psaty, F. Leebeek, A.R. Folsom, M.G. Larson, T. D. Spector, A.F. Wright, J.F. Wilson, A. Hamsten, T. Lumley, J.C. Witteman, W. Tang, C.J. O'Donnell, Circulation 121 (2010) 1382–1392. [8] W. Tang, M. Teichert, D.I. Chasman, J.A. Heit, P.E. Morange, G. Li, N. Pankratz, F. W. Leebeek, G. Paré, M. de Andrade, C. Tzourio, B.M. Psaty, S. Basu, R. Ruiter,

L. Rose, S.M. Armasu, T. Lumley, S.R. Heckbert, A.G. Uitterlinden, M. Lathrop, K. M. Rice, M. Cushman, A. Hofman, J.C. Lambert, N.L. Glazer, J.S. Pankow, J. C. Witteman, P. Amouyel, J.C. Bis, E.G. Bovill, X. Kong, R.P. Tracy, E. Boerwinkle, J.I. Rotter, D.A. Trégouët, D.W. Loth, B.H. Stricker, P.M. Ridker, A.R. Folsom, N. L. Smith, Genet. Epidemiol. 37 (2013) 512–521. [9] I. Schrijver, M.J. Lay, J.L. Zehnder, Am. J. Clin. Pathol. 119 (2003) 490–496. [10] S. Moutereau, R. Narwa, C. Matheron, N. Vongmany, E. Simon, M. Goossens, Hum. Mutat. 23 (2004) 621–628. [11] E.V. Theodoraki, T. Nikopensius, J. Suhorutsenko, V. Peppes, P. Fili, G. Kolovou, V. Papamikos, D. Richter, N. Zakopoulos, K. Krjutskov, A. Metspalu, G. V. Dedoussis, BMC Med. Genet. 11 (2010) 28. [12] F.S. Ong, J.C. Lin, K. Das, D.S. Grosu, J.B. Fan, Genomics 102 (2013) 137–139. [13] K. Robasky, N.E. Lewis, G.M. Church, Nat. Rev. Genet. 15 (2014) 56–62. [14] R. Patnala, J. Clements, J. Batra, BMC Genet. 14 (2013) 39. [15] S.L. Marasso, D. Mombello, M. Cocuzza, D. Casalena, I. Ferrante, A. Nesca, P. Poiklik, K. Rekker, A. Aaspollu, S. Ferrero, C.F. Pirri, Biomed. Microdevices 16 (2014) 661–670. [16] R.B. Schnabel, A. Baccarelli, H. Lin, P.T. Ellinor, E.J. Benjamin, Clin. Chem. 58 (2012) 113–126. [17] M.J. Kupferminc, Clin. Obstet. Gynecol. 48 (2005) 406–415. [18] M.A. Vlachou, K.M. Glynou, P.C. Ioannou, T.K. Christopoulos, G. Vartholomatos, Biosens. Bioelectron. 26 (2010) 228–234. [19] P.C. Cooper, S.M. Rezende, Int. J. Lab. Hematol. 29 (2007) 153–162. [20] J.A. Lefferts, P. Jannetto, G.J. Tsongalis, Exp. Mol. Pathol. 87 (2009) 105–108. [21] L.A. Lotta, M. Wang, J. Yu, I. Martinelli, F. Yu, S.M. Passamonti, D. Consonni, E. Pappalardo, M. Menegatti, S.E. Scherer, L.L. Lewis, H. Akbar, Y. Wu, M. N. Bainbridge, D.M. Muzny, P.M. Mannucci, R.A. Gibbs, F. Peyvandi, BMC Med. Genom., 5, (2012) 7. [22] 〈www.HuGENavigator.net〉. [23] J.T.R. Gaunt, G.D. Lowe, D.A. Lawlor, J.P. Casas, I.N. Day, Eur. J. Hum. Genet. 21 (2013) 779–783. [24 G. Ventimiglia, S. Petralia, BioNanoSci 3 (2013) 428–450. [25] P. Angenendt, J. Glökler, D. Murphy, H. Lehrach, D. Cahill, Anal. Biochem. 309 (2002) 253–260. [26] G.C. Le Goff, B.P. Corgier, C.A. Mandon, G. De Crozals, C. Chaix, L.J. Blum, C. A. Marquette, Biosens. Bioelectron. 35 (2012) 94–100. [27] D. Proudnikov, E. Timofeev, A. Mirzabekov, Anal. Biochem. 259 (1998) 34–41. [28] F.N. Rehman, M. Audeh, E.S. Abrams, P.W. Hammond, M. Kenney, T.C. Boles, Nucleic Acid Res. 27 (2) (1999) 649–655 , January 15. [29] H. Wang, J. Li, H.P. Liu, Q.J. Liu, Q. Mei, Y.J. Wang, J. Zhu, N. He, Z. Lu, Nucleic Acids Res. 30 (2002) e61. [30] M. Cretich, V. Sedini, F. Damin, M. Pelliccia, L. Sola, M. Chiari, Anal. Biochem. 397 (2010) 84–88. [31] M. Yu Slabospitskaya, E.G. Vlakh, N.N. Saprykina, T.B. Tennikova, J. Appl. Polym. Sci. 111 (2009) 692–700. [32] M. Rober, J. Walter, E. Vlakh, F. Stahl, C. Kasper, T. Tennikova, Anal. Chim. Acta 644 (2009) 95–103. [33] E.S. Sinitsyna, J.G. Walter, E.G. Vlakh, F. Stahl, C. Kasper, T.B. Tennikova, Talanta 93 (2012) 139–146. [34] E.S. Sinitsyna, Yu. N. Sergeeva, E.G. Vlakh, N.N. Saprykina, T.B. Tennikova, React. Funct. Polym. 69 (2009) 385–392. [35] L.D. Hill, T.P. York, J.P. Kusanovic, R. Gomez, L.J. Eaves, R. Romero, J.F. Strauss, PLoS One 6 (2011) e16681. [36] L.M. Procopciuc, G. Caracostea, G. Zaharie, M. Puscas, G. Iordache, M. Popa, D. Colcear, I. Olteanu, F. Stamatian, J. Renin Angiotensin Aldosterone Syst. 12 (2011) 539–548. [37] M. Yaghmaei, M. Hashemi, A. Azarian, A. Moazeni-Roodi, M. Mokhtari, A. Naghavai, S. Salimi, M. Mohammadi, M. Taheri, S. Ghavami, Arch. Med. Res. 42 (2011) 324–328. [38] R.K. Dogra, R. Das, J. Ahluwalia, R.M. Kumar, K.K. Talwar, J. Thromb. Thrombolysis 34 (2012) 276–282. [39] P.A. Fasching, F. Faschingbauer, T.W. Goecke, A. Engel, L. Häberle, A. Seifert, F. Voigt, M. Amann, D. Rebhan, P. Burger, J. Kornhuber, A.B. Ekici, M. W. Beckmann, E.B. Binder, J. Psychiatr. Res. 46 (2012) 1109–1117. [40] J. Sambrook, E.P. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Coldspring Harbour Lab, Coldspring Harbour, New York, 1989. [41] J. Tomlinson, C. Harrison, N. Boonham, S.A. Goodchild, S.A. Weller, BMC Res. Notes 7 (2014) 251. [42] S. Taylor, S. Smith, B. Windle, A. Guiseppi-Elie, Nucleic Acids Res. 31 (2003) e87. [43] T. Strachan, A.P. Read, Human Molecular Genetics, Wiley-Liss, New York, 1999. [44] M.W. Karaman, S. Groshen, C.-C. Lee, B.L. Pike, J.G. Hacia, Nucleic Acids Res. 33 (2005) e33. [45] G.R. Abecasis, D. Altshuler, A. Auton, L.D. Brooks, R.M. Durbin, R.A. Gibbs, M. E. Hurles, G.A. McVean, Nature 467 (7319) (2010) 1061–1073. [46] 〈http://www.r-project.org〉. Development Core Team. [47] G. Szabo, L. Lazar, B. Nagy, J. Rigo Jr., Pregnancy Hypertens 2 (2012) 242. [48] A.R. Guerzoni, P.M. Biselli, M.F. Godoy, D.R. Souza, R. Haddad, M.N. Eberlin, E. C. Bertelli, E.M. Goloni-Bertello, Arq. Bras. Cardiol. 92 (2009) 263–268. [49] E. Aytekin, S.G. Ergun, M.A. Ergun, F.E. Percin, Genet. Test. Mol. Biomarkers 18 (2014) 717–721. [50] J. Wilhelm, H. Reuter, B. Tews, A. Pingoud, M. Hahn, Biol. Chem. 383 (2002) 1423–1433. [51] M. Nauck, H. Wieland, W. Marz, Clin. Chem. 45 (1999) 1141–1147. [52] K. Okonechnikov, O. Golosova, M. Fursov, Bioinformatics 28 (2012) 1166–1167.