- Email: [email protected]
Detection of methicillin- and aminoglycoside-resistant genes and simultaneous identification of S. aureus using triplex real-time PCR Taqman assay
Journal of Microbiological Methods 68 (2007) 157 – 162 www.elsevier.com/locate/jmicmeth
Detection of methicillin- and aminoglycoside-resistant genes and simultaneous identification of S. aureus using triplex real-time PCR Taqman assay Negar Shafiei Sabet, Geetha Subramaniam, Parasakthi Navaratnam, Shamala Devi Sekaran ⁎ Department of Medical Microbiology, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia Received 1 March 2006; received in revised form 7 July 2006; accepted 13 July 2006 Available online 28 August 2006
Abstract In this study we describe a triplex real-time PCR assay that enables the identification of S. aureus and detection of two important antibiotic resistant genes simultaneously using real-time PCR technology in a single assay. In this triplex real-time PCR assay, the mecA (methicillin resistant), femA (species specific S. aureus) and aacA-aphD (aminoglycoside resistant) genes were detected in a single test using dual-labeled Taqman probes. The assay gives simultaneous information for the identification of S. aureus and detection of methicillin and aminoglycoside resistance in staphylococcal isolates. 152 clinical isolates were subjected to this triplex real-time PCR assay. The results of the triplex real-time PCR assay correlated with the results of the phenotypic antibiotic susceptibility testing. The results obtained from triplex real-time PCR assay shows that the primer and probe sets were specific for the identification of S. aureus and were able to detect methicillin- and aminoglycosideresistant genes. The entire assay can be performed within 3 h which is a very rapid method that can give simultaneous information for the identification of S. aureus and antibiotic resistance pattern of a staphylococcal isolate. The application of this rapid method in microbiology laboratories would be a valuable tool for the rapid identification of the S. aureus isolates and determination of their antibiotic resistance pattern with regards to methicillin and aminoglycosides. © 2006 Elsevier B.V. All rights reserved. Keywords: Aminoglycoside; Methicillin; Real-time PCR; Taqman; S. aureus; Staphylococci
1. Introduction In past decades methicillin-resistant S. aureus (MRSA) has been reported as an important pathogen with increasing prevalence rates throughout the world. MRSA isolates have been reported as both nosocomial and community-acquired pathogens (Maltezou and Giamarellou, 2006). Severe infections caused by MRSA are associated with high mortality rates and hence the early detection of MRSA is important for therapeutic purposes and will have a major impact on reducing the mortality rate (Cosgrove et al., 2003). Conventional methods of identification are time consuming and have their limitations in terms of generating false-positive and false-negative results (Riberio et al., 1999; Schwarzkopf et al., 1993). The detection of mecA gene by
⁎ Corresponding author. Tel.: +60 3 79675759; fax: +60 3 79676672. E-mail address: [email protected] (S.D. Sekaran). 0167-7012/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2006.07.008
PCR as a rapid method of identification of MRSA has been wellestablished (Martineau et al., 2000). The PCR-based methods are regarded as more reliable methods for the detection of methicillin resistance due to the fact that methicillin resistance is often expressed heterogeneously (Chambers, 1997). It was in the early 1960s that the first methicillin-resistant S. aureus strain was isolated (Barber, 1961). In early 1980s the endemic MRSA strains carrying multiple resistance determinants were reported to cause worldwide nosocomial infections (Hryniewicz, 1999). These multi-resistance phenotypic patterns were observed in the majority of MRSA strains until the mid-1990s. Hence most of the tests that were developed focused on the detection of only mecA gene which gives a proper clue for choosing glycopeptides as alternative therapeutic agents (Strommenger et al., 2003; Kearns et al., 1999; Schmitz et al., 1997). However during the past 8 years MRSA clones having less broad resistance patterns have been reported especially in Europe where they have emerged as epidemic strains (Witte et al., 2001). The detection of mecA gene
158
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
alone is no more informative when deciding alternative therapy. Therefore the genotypic tests for the identification of MRSA need to include the other relevant antibiotic resistant genes as well, since the resistance to these older antibiotics have become clinically relevant again. (Strommenger et al., 2003). A number of conventional gel-based PCR methods in the multiplex format have been published (Ardic et al., 2006; Strommenger et al., 2003); but real-time PCR so far reported has focused on one antibiotic resistant determinant i.e. mecA gene only (Reischl et al., 2000; Shrestha et al., 2002; Tan et al., 2001). In this study we describe a triplex real-time PCR assay that enables the simultaneous identification of S. aureus and detection of two important antibiotic resistant genes. The triplex real-time PCR assay has enabled the detection of mecA and aacA-aphD gene as well as simultaneously identifying S. aureus in a single test. 2. Materials and methods 2.1. Bacterial strains Clinical isolates were obtained from University Malaya Medical Center (UMMC). Among the152 staphylococcal clinical isolates investigated, there were 48 Methicillin-Resistant S. aureus (MRSA), 45 Methicillin Sensitive S. aureus (MSSA), 48 Methicillin-Resistant Coagulase Negative S. aureus (MRCoNs) and 11 Methicillin Sensitive Coagulase Negative S. aureus (MSCoNs). The ATCC strains used as reference strains were ATCC 14990 S. epidermidis, ATCC 15305 S. saprophyticus, ATCC 35663 S. xylosus, ATCC 27840 S. capitis spp. capitis, ATCC 43809 S. lugdunensis, ATCC 29970 S. haemolyticus, ATCC 27844 S. hominis spp. hominis and ATCC 43300 S. aureus (MRSA). 2.2. Staphylococci identification and antimicrobial susceptibility testing The Staphylococci isolates were cultured on Colombia blood agar plates (Oxoid, Basingstoke, UK) and incubated at 37 °C for 24 h. The Staphylococci isolates used in this study were identified as S. aureus or CoNs by colony morphology, Gram stain, catalase reaction, coagulase production and the result of API Staph. System (bioMérieux, France). Resistance to methicillin, gentamycin and kanamycin were detected using the methods recommended by the Clinical and
Laboratory Standards Institute (CLSI). The MICs for gentamycin and kanamycin were determined by the agar dilution method on Mueller Hinton agar (Oxoid, Basingstoke, UK). For susceptibility testing to methicillin, the Mueller Hinton agar was supplemented with NaCl (Promega, Madison, USA). The S. aureus ATCC 29213 strain was used as quality control for antimicrobial susceptibility testing. 2.3. DNA extraction The strains were grown overnight on blood agar prior to DNA extraction. The DNA extraction was performed following the method described by Unal et al. (1992). To extract the DNA, an aliquot of an overnight culture (approximately 108 cells) was suspended in 50 μl of lysostaphin (100 μg/mL in sterile deionized water, Sigma, St. Louis, MO). After incubation at 37 °C for 10 min, 50 μL proteinase K (100 μg/mL in sterile deionized water, Roche Molecular Bio-chemicals) and 150 μL 100 mM Tris buffer (Promega, Madison, USA) at pH 7.5 were added. The suspension was incubated at 37 °C for a further 10 min, boiled for 5 min and centrifuged at 13,000 rpm for 2 min. The supernatant was directly transferred to the real-time PCR premix. 2.4. Design of the triplex real-time PCR assays The femA, mecA, and aacA-aphD gene sequences are referred to as accession numbers X17688, X52593 and M18086 in the GenBank data base. The design of the primers and probes were performed using the Primer Express software (Applied Biosystems). Primers and probes were selected in a region with G/C contents of 20–80%. The primers were designed to amplify short segments of DNA within the target sequence preferably with an amplicon size less than 150 bp. The probes were selected first and then the primers were designed as close to the probes as possible. Taqman probes were specifically designed with compatible melting temperature that can be used in the triplex format. Taqman probes that have been designed in this study were labeled with different flourophores, which can then be detected at different wavelengths; therefore the 3 different targets can be detected simultaneously at 3 different wavelengths. The different fluorescently labeled Taqman probes (ProOligo, France) and the primers used in this triplex real-time PCR assay are listed in Table 1.
Table 1 Characteristics of the primers and probes used in this study Olligonucleotide
Gene
Sequence
5′ position
Length
femA-F forward primer femA-R reverse primer femA-probe mecA-F forward primer mecA-R reverse primer mecA-probe aacA-aphD-F forward primer aacA-aphD-R reverse primer aacA-aphD-probe
femA femA femA mecA mecA mecA aacA-aphD aacA-aphD aacA-aphD
ACT GTG ACG ATG AAT GCG ACA A (sense strand) ATG TTG TGG TGT TCT TAT ACC AAA TCC (anti-sense strand) Texas red-5′ CGACAACTGGCACATTGGCTATCGCTTT 3′-BHQ-2 (anti-sense strand) AAA ACT AGG TGT TGG TGA AGA TAT ACC (sense strand) GAAAGGATCTGTACTGGGTTA ATCAG (anti-sense strand) Fam-5′ TTCACCTTGTCCGTAACCTGAATCAGCT 3′-BHQ-1 (anti-sense strand) TCCTTACTTAAT GAC CGA TGT ACT CT (sense strand) TCTTCGCTT TCG CCACTT TGA (anti-sense strand) Tet-5′ CATGAAGCCGATAATTTCACGGTCGCCA 3′-BHQ-1 (anti-sense strand)
34 165 136 1592 1738 1709 584 730 707
22 27 28 27 26 28 26 21 28
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
159
2.5. Optimization of the triplex real-time PCR assay
2.6. The triplex real-time PCR assay
The best primer and probe concentrations for the triplex realtime PCR assay were determined by spanning an initial concentration range from 0.1 μM to 0.6 μM for both forward and reverse primers for each primer pair. The concentrations of the probes utilized for the optimization steps ranged from 0.1 μM to 0.25 μM. The concentrations of the MgCl2 used in triplex assay for the optimization steps ranged from 3.5 mM to 9 mM. Each concentration was tested in different experiments in the triplex format in single PCR tubes to obtain the best concentration.
Real-time PCR amplification was performed in an iCycler iQ (Bio Rad Laboratories, California, USA) thermocycler, which combines rapid and accurate thermal cycling and probe-specific detection of the amplified products. 2 μL of the extracted DNA was added to 48 μL of amplification reaction mixture in this triplex real-time PCR assay. In this triplex real-time PCR assay which is for the detection of aminoglycoside-resistant gene the PCR amplification reaction mixture contains 5 mM PCR buffer, 8.5 mM MgCl2,
Fig. 1. The representative results obtained in aminoglycoside resistance triplex real-time PCR assay. Three different colors represent three different samples that were tested for, mecA (A), femA (B) and aacA-aphD (C) genes simultaneously. The samples of this panel were MRSA clinical samples (purple amplicon curve), MSCoNS (red line) and negative control (yellow line). Pos.; positive amplification, Neg.; negative amplification. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
160
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
Table 2 The aminoglycoside resistance triplex real-time PCR and MIC results obtained with 152 clinical isolates of Staphylococci Identity
No. of isolates with:
No. of isolates Gentamycin/ examined kanamycin resistance mecA femA aacA-aphD MIC range (μg/mL)
MRSA 48 MSSA 0 MRCoNS 48 MSCoNS 0
48 45 0 0
48 0 48 0
48 45 48 11
128–256/64–256 0.25–0.5/1–4 16–256/1–8 0.25–2/0.5
the final concentration in the PCR reaction starting from 1 × 107 genomic molecule to 1 genomic molecule in the final tube in the dilution series. The specificity of the assay was determined using the collection of the gram-positive and gram-negative strains available in our laboratory. The gram-positive strains included 8 Staphylococci ATCC strains and Streptococcus spp. Among the gram-negative strains that were tested for specificity were Pseudomonas spp, Acinetobacter spp, Escherichia coli and Klebsiella spp. 3. Results
200 nM dNTP (MBI, Fermentas, USA), 0.3 μM of each primer pair, 0.2 μM of each hybridization probe and 2 μL of DNA template in a final volume of 50 μL in a single tube. The methodology in this real-time PCR assay utilizes a 2-step PCR amplification protocol, whereby the annealing step comprises the hybridization and extension steps. The thermal cycling protocol was as follows: 3 min at 95 °C for initial denaturation, 30 cycles of 2 steps consisting of 30 s at 95 °C for denaturation and 45 s at 55 °C for annealing. 2.7. Determination of specificity and sensitivity of the triplex real-time PCR assay The sensitivity of the assays was determined using a ten-fold dilution series of the DNA extract from MRSA isolate. The dilutions were prepared utilizing spectrophotometric readings taken using the GenQuant (Amersham bio sciences) to obtain
3.1. Correlation between susceptibility testing and triplex realtime PCR assays results Representative results obtained by triplex real-time PCR assay for the clinical isolates that were tested simultaneously for mecA (A), femA (B) and aacA-aphD (C) genes are shown in Fig. 1. The results of the screening of 152 clinical isolates using the developed triplex real-time PCR assay have been summarized in Table 2. The detection of genes in triplex real-time PCR assay was compared with the results obtained by standard methods. The methicillin resistance MIC range were 128–256 μg/mL for MRSA (n = 48), 0.25–1 μg/mL for MSSA (n = 45), 8–256 μg/ mL for MRCoNs (n = 48) and 0.06–0.125 μg/mL for MSCoNs (n = 11) isolates. The mecA gene was detected in all methicillinresistant isolates (MRSA n = 48, MRCoNs n = 48) in the triplex
Fig. 2. (A) Example showing the Texas red fluorescence detection of MRSA strain, serial dilutions of MRSA strain corresponding to amplicon curves (the purple line — for negative control) showing sensitivity of real-time PCR assay. (B) The standard curve is generated by the iCycler software from the data in (A). The curve was linear and the slope r2 value was 0.989. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
real-time PCR assay thus correlating with the results of the phenotypic antibiotic susceptibility testing for methicillin resistance. The mecA primer and probe sets were shown to be specific for the detection of the mecA gene. The gentamycin and kanamycin resistance MIC range and triplex real-time PCR results are shown in Table 2. The aacA-aphD gene was detected in all gentamycin/kanamycin resistant isolates, thus correlating with the aminoglycoside resistance susceptibility tests as well. The primer and probe set also proved to be specific for the detection of the aacA-aphD gene. Similarly the femA gene was detected in all S. aureus isolates. The sensitivity of the real-time PCR assay using the femA probe was shown to be at 1 genomic molecule (Fig. 2A). The resulting standard curve (Fig. 2B) was linear and showed a correlation coefficient of 0.989. 4. Discussion The Methicillin-Resistant S. aureus (MRSA) strain is one of the major causes of nosocomial and community-acquired infections (Chambers, 2001). MRSA infections in severe cases of bacteremia are responsible for the high mortality rate in patients. However the mortality rates for the infections caused by methicillin susceptible strains are much lower than resistant strains (Cosgrove et al., 2003). The rapid detection of the MRSA strains in a diagnostic laboratory has a major impact in the outcome of severe infections and early detection has always been the ultimate goal for saving the life of patients infected by these multidrugresistant strains (Bergeron and Quellette, 1998; Byl et al., 1999). In the clinical setting of diagnostic microbiology laboratories, the simultaneous identification of S. aureus and determination of antimicrobial susceptibility of the strains generally requires 48 h to obtain the results (Bergeron and Quellette, 1998). Identification of the bacteria in routine diagnostic microbiology laboratories based on biochemical characteristics of cultured organisms is not only time consuming but also has the added disadvantage of producing false-positive and false-negative results. (Riberio et al., 1999; Schwarzkopf et al., 1993). Therefore a more rapid and reliable approach for the identification and determination of susceptibility testing was developed utilizing the available information at the gene level using genotypic methods. The recent advances in molecularbased methods have increased the use of DNA-based assays and their application in routine diagnostic settings. The gel-based PCR methods in the multiplex format for the identification of S. aureus and detection of antibiotic resistant genes have been described previously (Kearns et al., 1999; Schmitz et al., 1997; Strommenger et al., 2003). The real-time PCR technology is a very rapid diagnostic tool that is well-established for the detection of various microorganisms including MRSA. Studies by Edwards et al. (2001) using real-time PCR enabled the accurate identification of Coagulase Negative Staphylococci (CoNs) while that of Paule et al. (2004) used the real-time PCR for the direct detection of S. aureus from nasal swabs. In the studies by Reischl et al. (2000), Shrestha et al. (2002) and Tan et al. (2001), real-time PCR was used for the identification of MRSA by detecting S. aureus species specific marker, Sa442 and mecA gene for methicillin-resistance determination. In our study we have combined the detection of MRSA and aminoglycoside resistance determinants simultaneously in the
161
single assay. We developed the triplex real-time PCR assay for the determination of two important antibiotic-resistant genes, mecA and aacA-aphD genes, and identification of S. aureus in the single test. The triplex real-time PCR assay using three dual-labeled Taqman probes that could detect three genes, mecA, femA and aacA-aphD simultaneously at a time. The results obtained in susceptibility testing and detection of genes in triplex real-time PCR assay correlated with each other and was also found to be in accordance with that of Reischl et al. (2000), Shrestha et al. (2002) and Tan et al. (2001) who reported that the mecA gene assay reliably determines methicillin resistance in S. aureus. The mecA gene was detected in all the MRCoNs isolates as well. All gentamycin/kanamycin resistant isolates were shown to carry the aacA-aphD gene. The specificity of the assay has been tested with a panel of the strains available in our laboratory and no cross reactivity was observed. The real-time PCR method has proved to be more sensitive and rapid as compared to the culture-based method (Riviere et al., 2006). The real-time PCR assay for the detection of template DNA as low as 1 genomic molecule proved to be a very sensitive assay. The correlation coefficient, which is used to analyse a standard curve (ten-fold dilutions plotted against Ct values) obtained by linear regression analysis was 0.989 which shows a positive correlation as the closer the value to 1 is, the better the fit. The duration of performing the triplex real-time PCR assay is 3 h as compared to the conventional gel-based PCR assay which may take between 6 and 8 h. It is, therefore a rapid assay that can be used in microbiology laboratories. The costs associated with each reaction need to be calculated for the incorporation of this assay into routine diagnostic microbiology laboratories. However triplex realtime assay can be reserved for specialized microbiology laboratories or reference laboratories. Application of this rapid method and its effective use in serious cases will have a major impact in reducing the mortality rate and will be useful to physicians when prescribing antibiotics before starting the empirical therapy, thereby reducing the indiscriminate use of broad spectrum antibiotics. Acknowledgement This study was funded by the IRPA grant: 0-02-03-0112 PR 0047/19-10 and partly by Vote F F0100/2004A. References Ardic, N., Sareyyupoglu, B., Ozyurt, M., Haznedaroglu, T., Llga, U., 2006. Investigation of aminoglycoside modifying enzyme genes in methicillinresistant staphylococci. Microbiol. Res. 161, 49–54. Barber, M., 1961. Methicillin-resistant staphylococci. J. Clin. Pathol. 14, 385–393. Bergeron, M.G., Quellette, 1998. Preventing antibiotic resistance through rapid genotype identification of bacteria and of their antibiotic resistance genes in the clinical microbiology laboratory. J. Clin. Microbiol. 36, 2169–2172. Byl, B., Clevenbergh, P., Jacobs, F., Struelens, M.J., Zech, F., Kentos, A., Thys, J.P., 1999. Impact of infectious diseases specialists and microbiological data on the appropriateness of antimicrobial therapy for bacterimia. Clin. Infect. Dis. 29, 60–66. Chambers, H.F., 1997. Methicllin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin. Microbiol. Rev. 10, 781–791. Chambers, H.F., 2001. The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis. 7, 178–182.
162
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
Clinical and Laboratory Standards Institute. Method for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standardseventh addition and performance standards for antimicrobial susceptibility testing. M0-A7 and M100-S16.Wyne. Pa. Cosgrove, S.E., Sakoulas, G., Perencevich, E.N., Schwaber, M.J., Karchamer, A.W., Carmeli, Y., 2003. Comparison of mortality associated with methicillin-resistant and methicillin-susceptible Staphylococcus aureus bacterimia: a meta-analysis. Clin. Infect. Dis. 36, 53–59. Edwards, K.J., Kaufmann, M.E., Saunders, N.A., 2001. Rapid and accurate identification of coagulase negative staphylococci by real-time PCR. J. Clin. Microbiol. 39, 3047–3051. Hryniewicz, W., 1999. Epidemiology of MRSA. Infect. 27 (Suppl. 2), S13–S16. Kearns, A.M., Seiders, P.R., Wheeler, J., Freeman, R., Steward, M., 1999. Rapid detection of methicillin-resistant staphylococci by multiplex PCR. J. Hosp. Infect. 43, 33–37. Maltezou, H., Giamarellou, H., 2006. Community-acquired methicillin-resistant Staphylococcus aureus infections. Int. J. Antimicrob. Agents 27, 87–96. Martineau, F., Picard, F.J., Lansac, N., Menard, C., Roy, H.P., Ouellette, M., Bergeron, M.G., 2000. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidemidis. Antimicrob. Agents Chemother. 44, 231–238. Paule, S.M., Pasquariello, A.C., Hacek, D.M., Fisher, A.G., Thomson, R.B., Kaul, K.L., Peterson, L.R., 2004. Direct detection of Staphylococcus aureus from adult and neonate nasal swab specimens using real-time polymerase chain reaction. J. Mol. Diagnostics 6, 191–196. Reischl, U., Linde, H.J., Metz, M., Leppmeier, B., Lehn, N., 2000. Rapid identification of methicillin-resistant Staphylococcus aureus and simultaneous species confirmation using real-time PCR. J. Clin. Microbiol. 38, 2429–2433. Riberio, J., Vieira, F.D., King, T., D'Arezzo, J.B., Boyce, J.M., 1999. Misclassification of susceptible strains of Staphylococcus aureus as
methicillin-resistant Staphylococcus aureus by rapid automated susceptibility testing system. J. Clin. Microbiol. 37, 1619–1620. Riviere, D., Szczebara, F.M., Bereaud, J., Frere, J., Hechard, Y., 2006. Development of a real-time PCR assay for quantification of Acanthamoeba trophozoites and cysts. J. Microbiol. Methods 64, 78–83. Schmitz, F.J., Mackenzie, C.R., Hofmann, B., Verhoef, J., Finkeneigen, M., Hewz, H.P, Kohrer, K., 1997. Specific information concerning, taxonomy, pathogenecity and methicillin resistance of staphylococci obtained by multiplex PCR. J. Med. Microbiol. 46, 773–778. Schwarzkopf, Karch, A.H., Schmidt, H., Lenz, W., Heesemaan, J., 1993. Phenotypic and genotypic characterization of epidemic clumping factor-negative, oxacillinresistant Staphylococcus aureus. J. Clin. Microbiol. 31, 2281–2285. Shrestha, N.K., Tuohy, M.J., Hall, G.S., Isada, C.M., Procop, G.W., 2002. Rapid identification of Staphylococcus aureus and the mecA gene from BacT/ ALERT blood culture bottles by using the Light Cycler system. J. Clin. Microbiol. 40, 2659–2661. Strommenger, B., Kettlitz, C., Werner, G., Wolfgang, W., 2003. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 41, 4089–4094. Tan, T.Y., Corden, S., Barnes, R., Cookson, B., 2001. Rapid identification of methicillin-resistant Staphylococcus aureus from positive blood cultures by real-time fluorescence PCR. J. Clin. Microbiol. 39, 4529–4531. Unal, S., Hoskins, J., Flokowitsch, J.E., Wu, C.Y.E., Preston, D.A., Skatrud, P.L., 1992. Detection of methicillin-resistant staphylococci by using the polymerase chain reaction. J. Clin. Microbiol. 30, 1685–1691. Witte, W., Braulke, C., Cuny, C., Heuck, D., Kresken, M., 2001. Changing pattern of antibiotic resistance in methicillin-resistant Staphylococcus aureus from German hospitals. Infect. Control Hosp. Epidemiol. 22, 683–686.
Detection of methicillin- and aminoglycoside-resistant genes and simultaneous identification of S. aureus using triplex real-time PCR Taqman assay Negar Shafiei Sabet, Geetha Subramaniam, Parasakthi Navaratnam, Shamala Devi Sekaran ⁎ Department of Medical Microbiology, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia Received 1 March 2006; received in revised form 7 July 2006; accepted 13 July 2006 Available online 28 August 2006
Abstract In this study we describe a triplex real-time PCR assay that enables the identification of S. aureus and detection of two important antibiotic resistant genes simultaneously using real-time PCR technology in a single assay. In this triplex real-time PCR assay, the mecA (methicillin resistant), femA (species specific S. aureus) and aacA-aphD (aminoglycoside resistant) genes were detected in a single test using dual-labeled Taqman probes. The assay gives simultaneous information for the identification of S. aureus and detection of methicillin and aminoglycoside resistance in staphylococcal isolates. 152 clinical isolates were subjected to this triplex real-time PCR assay. The results of the triplex real-time PCR assay correlated with the results of the phenotypic antibiotic susceptibility testing. The results obtained from triplex real-time PCR assay shows that the primer and probe sets were specific for the identification of S. aureus and were able to detect methicillin- and aminoglycosideresistant genes. The entire assay can be performed within 3 h which is a very rapid method that can give simultaneous information for the identification of S. aureus and antibiotic resistance pattern of a staphylococcal isolate. The application of this rapid method in microbiology laboratories would be a valuable tool for the rapid identification of the S. aureus isolates and determination of their antibiotic resistance pattern with regards to methicillin and aminoglycosides. © 2006 Elsevier B.V. All rights reserved. Keywords: Aminoglycoside; Methicillin; Real-time PCR; Taqman; S. aureus; Staphylococci
1. Introduction In past decades methicillin-resistant S. aureus (MRSA) has been reported as an important pathogen with increasing prevalence rates throughout the world. MRSA isolates have been reported as both nosocomial and community-acquired pathogens (Maltezou and Giamarellou, 2006). Severe infections caused by MRSA are associated with high mortality rates and hence the early detection of MRSA is important for therapeutic purposes and will have a major impact on reducing the mortality rate (Cosgrove et al., 2003). Conventional methods of identification are time consuming and have their limitations in terms of generating false-positive and false-negative results (Riberio et al., 1999; Schwarzkopf et al., 1993). The detection of mecA gene by
⁎ Corresponding author. Tel.: +60 3 79675759; fax: +60 3 79676672. E-mail address: [email protected] (S.D. Sekaran). 0167-7012/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2006.07.008
PCR as a rapid method of identification of MRSA has been wellestablished (Martineau et al., 2000). The PCR-based methods are regarded as more reliable methods for the detection of methicillin resistance due to the fact that methicillin resistance is often expressed heterogeneously (Chambers, 1997). It was in the early 1960s that the first methicillin-resistant S. aureus strain was isolated (Barber, 1961). In early 1980s the endemic MRSA strains carrying multiple resistance determinants were reported to cause worldwide nosocomial infections (Hryniewicz, 1999). These multi-resistance phenotypic patterns were observed in the majority of MRSA strains until the mid-1990s. Hence most of the tests that were developed focused on the detection of only mecA gene which gives a proper clue for choosing glycopeptides as alternative therapeutic agents (Strommenger et al., 2003; Kearns et al., 1999; Schmitz et al., 1997). However during the past 8 years MRSA clones having less broad resistance patterns have been reported especially in Europe where they have emerged as epidemic strains (Witte et al., 2001). The detection of mecA gene
158
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
alone is no more informative when deciding alternative therapy. Therefore the genotypic tests for the identification of MRSA need to include the other relevant antibiotic resistant genes as well, since the resistance to these older antibiotics have become clinically relevant again. (Strommenger et al., 2003). A number of conventional gel-based PCR methods in the multiplex format have been published (Ardic et al., 2006; Strommenger et al., 2003); but real-time PCR so far reported has focused on one antibiotic resistant determinant i.e. mecA gene only (Reischl et al., 2000; Shrestha et al., 2002; Tan et al., 2001). In this study we describe a triplex real-time PCR assay that enables the simultaneous identification of S. aureus and detection of two important antibiotic resistant genes. The triplex real-time PCR assay has enabled the detection of mecA and aacA-aphD gene as well as simultaneously identifying S. aureus in a single test. 2. Materials and methods 2.1. Bacterial strains Clinical isolates were obtained from University Malaya Medical Center (UMMC). Among the152 staphylococcal clinical isolates investigated, there were 48 Methicillin-Resistant S. aureus (MRSA), 45 Methicillin Sensitive S. aureus (MSSA), 48 Methicillin-Resistant Coagulase Negative S. aureus (MRCoNs) and 11 Methicillin Sensitive Coagulase Negative S. aureus (MSCoNs). The ATCC strains used as reference strains were ATCC 14990 S. epidermidis, ATCC 15305 S. saprophyticus, ATCC 35663 S. xylosus, ATCC 27840 S. capitis spp. capitis, ATCC 43809 S. lugdunensis, ATCC 29970 S. haemolyticus, ATCC 27844 S. hominis spp. hominis and ATCC 43300 S. aureus (MRSA). 2.2. Staphylococci identification and antimicrobial susceptibility testing The Staphylococci isolates were cultured on Colombia blood agar plates (Oxoid, Basingstoke, UK) and incubated at 37 °C for 24 h. The Staphylococci isolates used in this study were identified as S. aureus or CoNs by colony morphology, Gram stain, catalase reaction, coagulase production and the result of API Staph. System (bioMérieux, France). Resistance to methicillin, gentamycin and kanamycin were detected using the methods recommended by the Clinical and
Laboratory Standards Institute (CLSI). The MICs for gentamycin and kanamycin were determined by the agar dilution method on Mueller Hinton agar (Oxoid, Basingstoke, UK). For susceptibility testing to methicillin, the Mueller Hinton agar was supplemented with NaCl (Promega, Madison, USA). The S. aureus ATCC 29213 strain was used as quality control for antimicrobial susceptibility testing. 2.3. DNA extraction The strains were grown overnight on blood agar prior to DNA extraction. The DNA extraction was performed following the method described by Unal et al. (1992). To extract the DNA, an aliquot of an overnight culture (approximately 108 cells) was suspended in 50 μl of lysostaphin (100 μg/mL in sterile deionized water, Sigma, St. Louis, MO). After incubation at 37 °C for 10 min, 50 μL proteinase K (100 μg/mL in sterile deionized water, Roche Molecular Bio-chemicals) and 150 μL 100 mM Tris buffer (Promega, Madison, USA) at pH 7.5 were added. The suspension was incubated at 37 °C for a further 10 min, boiled for 5 min and centrifuged at 13,000 rpm for 2 min. The supernatant was directly transferred to the real-time PCR premix. 2.4. Design of the triplex real-time PCR assays The femA, mecA, and aacA-aphD gene sequences are referred to as accession numbers X17688, X52593 and M18086 in the GenBank data base. The design of the primers and probes were performed using the Primer Express software (Applied Biosystems). Primers and probes were selected in a region with G/C contents of 20–80%. The primers were designed to amplify short segments of DNA within the target sequence preferably with an amplicon size less than 150 bp. The probes were selected first and then the primers were designed as close to the probes as possible. Taqman probes were specifically designed with compatible melting temperature that can be used in the triplex format. Taqman probes that have been designed in this study were labeled with different flourophores, which can then be detected at different wavelengths; therefore the 3 different targets can be detected simultaneously at 3 different wavelengths. The different fluorescently labeled Taqman probes (ProOligo, France) and the primers used in this triplex real-time PCR assay are listed in Table 1.
Table 1 Characteristics of the primers and probes used in this study Olligonucleotide
Gene
Sequence
5′ position
Length
femA-F forward primer femA-R reverse primer femA-probe mecA-F forward primer mecA-R reverse primer mecA-probe aacA-aphD-F forward primer aacA-aphD-R reverse primer aacA-aphD-probe
femA femA femA mecA mecA mecA aacA-aphD aacA-aphD aacA-aphD
ACT GTG ACG ATG AAT GCG ACA A (sense strand) ATG TTG TGG TGT TCT TAT ACC AAA TCC (anti-sense strand) Texas red-5′ CGACAACTGGCACATTGGCTATCGCTTT 3′-BHQ-2 (anti-sense strand) AAA ACT AGG TGT TGG TGA AGA TAT ACC (sense strand) GAAAGGATCTGTACTGGGTTA ATCAG (anti-sense strand) Fam-5′ TTCACCTTGTCCGTAACCTGAATCAGCT 3′-BHQ-1 (anti-sense strand) TCCTTACTTAAT GAC CGA TGT ACT CT (sense strand) TCTTCGCTT TCG CCACTT TGA (anti-sense strand) Tet-5′ CATGAAGCCGATAATTTCACGGTCGCCA 3′-BHQ-1 (anti-sense strand)
34 165 136 1592 1738 1709 584 730 707
22 27 28 27 26 28 26 21 28
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
159
2.5. Optimization of the triplex real-time PCR assay
2.6. The triplex real-time PCR assay
The best primer and probe concentrations for the triplex realtime PCR assay were determined by spanning an initial concentration range from 0.1 μM to 0.6 μM for both forward and reverse primers for each primer pair. The concentrations of the probes utilized for the optimization steps ranged from 0.1 μM to 0.25 μM. The concentrations of the MgCl2 used in triplex assay for the optimization steps ranged from 3.5 mM to 9 mM. Each concentration was tested in different experiments in the triplex format in single PCR tubes to obtain the best concentration.
Real-time PCR amplification was performed in an iCycler iQ (Bio Rad Laboratories, California, USA) thermocycler, which combines rapid and accurate thermal cycling and probe-specific detection of the amplified products. 2 μL of the extracted DNA was added to 48 μL of amplification reaction mixture in this triplex real-time PCR assay. In this triplex real-time PCR assay which is for the detection of aminoglycoside-resistant gene the PCR amplification reaction mixture contains 5 mM PCR buffer, 8.5 mM MgCl2,
Fig. 1. The representative results obtained in aminoglycoside resistance triplex real-time PCR assay. Three different colors represent three different samples that were tested for, mecA (A), femA (B) and aacA-aphD (C) genes simultaneously. The samples of this panel were MRSA clinical samples (purple amplicon curve), MSCoNS (red line) and negative control (yellow line). Pos.; positive amplification, Neg.; negative amplification. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
160
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
Table 2 The aminoglycoside resistance triplex real-time PCR and MIC results obtained with 152 clinical isolates of Staphylococci Identity
No. of isolates with:
No. of isolates Gentamycin/ examined kanamycin resistance mecA femA aacA-aphD MIC range (μg/mL)
MRSA 48 MSSA 0 MRCoNS 48 MSCoNS 0
48 45 0 0
48 0 48 0
48 45 48 11
128–256/64–256 0.25–0.5/1–4 16–256/1–8 0.25–2/0.5
the final concentration in the PCR reaction starting from 1 × 107 genomic molecule to 1 genomic molecule in the final tube in the dilution series. The specificity of the assay was determined using the collection of the gram-positive and gram-negative strains available in our laboratory. The gram-positive strains included 8 Staphylococci ATCC strains and Streptococcus spp. Among the gram-negative strains that were tested for specificity were Pseudomonas spp, Acinetobacter spp, Escherichia coli and Klebsiella spp. 3. Results
200 nM dNTP (MBI, Fermentas, USA), 0.3 μM of each primer pair, 0.2 μM of each hybridization probe and 2 μL of DNA template in a final volume of 50 μL in a single tube. The methodology in this real-time PCR assay utilizes a 2-step PCR amplification protocol, whereby the annealing step comprises the hybridization and extension steps. The thermal cycling protocol was as follows: 3 min at 95 °C for initial denaturation, 30 cycles of 2 steps consisting of 30 s at 95 °C for denaturation and 45 s at 55 °C for annealing. 2.7. Determination of specificity and sensitivity of the triplex real-time PCR assay The sensitivity of the assays was determined using a ten-fold dilution series of the DNA extract from MRSA isolate. The dilutions were prepared utilizing spectrophotometric readings taken using the GenQuant (Amersham bio sciences) to obtain
3.1. Correlation between susceptibility testing and triplex realtime PCR assays results Representative results obtained by triplex real-time PCR assay for the clinical isolates that were tested simultaneously for mecA (A), femA (B) and aacA-aphD (C) genes are shown in Fig. 1. The results of the screening of 152 clinical isolates using the developed triplex real-time PCR assay have been summarized in Table 2. The detection of genes in triplex real-time PCR assay was compared with the results obtained by standard methods. The methicillin resistance MIC range were 128–256 μg/mL for MRSA (n = 48), 0.25–1 μg/mL for MSSA (n = 45), 8–256 μg/ mL for MRCoNs (n = 48) and 0.06–0.125 μg/mL for MSCoNs (n = 11) isolates. The mecA gene was detected in all methicillinresistant isolates (MRSA n = 48, MRCoNs n = 48) in the triplex
Fig. 2. (A) Example showing the Texas red fluorescence detection of MRSA strain, serial dilutions of MRSA strain corresponding to amplicon curves (the purple line — for negative control) showing sensitivity of real-time PCR assay. (B) The standard curve is generated by the iCycler software from the data in (A). The curve was linear and the slope r2 value was 0.989. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
real-time PCR assay thus correlating with the results of the phenotypic antibiotic susceptibility testing for methicillin resistance. The mecA primer and probe sets were shown to be specific for the detection of the mecA gene. The gentamycin and kanamycin resistance MIC range and triplex real-time PCR results are shown in Table 2. The aacA-aphD gene was detected in all gentamycin/kanamycin resistant isolates, thus correlating with the aminoglycoside resistance susceptibility tests as well. The primer and probe set also proved to be specific for the detection of the aacA-aphD gene. Similarly the femA gene was detected in all S. aureus isolates. The sensitivity of the real-time PCR assay using the femA probe was shown to be at 1 genomic molecule (Fig. 2A). The resulting standard curve (Fig. 2B) was linear and showed a correlation coefficient of 0.989. 4. Discussion The Methicillin-Resistant S. aureus (MRSA) strain is one of the major causes of nosocomial and community-acquired infections (Chambers, 2001). MRSA infections in severe cases of bacteremia are responsible for the high mortality rate in patients. However the mortality rates for the infections caused by methicillin susceptible strains are much lower than resistant strains (Cosgrove et al., 2003). The rapid detection of the MRSA strains in a diagnostic laboratory has a major impact in the outcome of severe infections and early detection has always been the ultimate goal for saving the life of patients infected by these multidrugresistant strains (Bergeron and Quellette, 1998; Byl et al., 1999). In the clinical setting of diagnostic microbiology laboratories, the simultaneous identification of S. aureus and determination of antimicrobial susceptibility of the strains generally requires 48 h to obtain the results (Bergeron and Quellette, 1998). Identification of the bacteria in routine diagnostic microbiology laboratories based on biochemical characteristics of cultured organisms is not only time consuming but also has the added disadvantage of producing false-positive and false-negative results. (Riberio et al., 1999; Schwarzkopf et al., 1993). Therefore a more rapid and reliable approach for the identification and determination of susceptibility testing was developed utilizing the available information at the gene level using genotypic methods. The recent advances in molecularbased methods have increased the use of DNA-based assays and their application in routine diagnostic settings. The gel-based PCR methods in the multiplex format for the identification of S. aureus and detection of antibiotic resistant genes have been described previously (Kearns et al., 1999; Schmitz et al., 1997; Strommenger et al., 2003). The real-time PCR technology is a very rapid diagnostic tool that is well-established for the detection of various microorganisms including MRSA. Studies by Edwards et al. (2001) using real-time PCR enabled the accurate identification of Coagulase Negative Staphylococci (CoNs) while that of Paule et al. (2004) used the real-time PCR for the direct detection of S. aureus from nasal swabs. In the studies by Reischl et al. (2000), Shrestha et al. (2002) and Tan et al. (2001), real-time PCR was used for the identification of MRSA by detecting S. aureus species specific marker, Sa442 and mecA gene for methicillin-resistance determination. In our study we have combined the detection of MRSA and aminoglycoside resistance determinants simultaneously in the
161
single assay. We developed the triplex real-time PCR assay for the determination of two important antibiotic-resistant genes, mecA and aacA-aphD genes, and identification of S. aureus in the single test. The triplex real-time PCR assay using three dual-labeled Taqman probes that could detect three genes, mecA, femA and aacA-aphD simultaneously at a time. The results obtained in susceptibility testing and detection of genes in triplex real-time PCR assay correlated with each other and was also found to be in accordance with that of Reischl et al. (2000), Shrestha et al. (2002) and Tan et al. (2001) who reported that the mecA gene assay reliably determines methicillin resistance in S. aureus. The mecA gene was detected in all the MRCoNs isolates as well. All gentamycin/kanamycin resistant isolates were shown to carry the aacA-aphD gene. The specificity of the assay has been tested with a panel of the strains available in our laboratory and no cross reactivity was observed. The real-time PCR method has proved to be more sensitive and rapid as compared to the culture-based method (Riviere et al., 2006). The real-time PCR assay for the detection of template DNA as low as 1 genomic molecule proved to be a very sensitive assay. The correlation coefficient, which is used to analyse a standard curve (ten-fold dilutions plotted against Ct values) obtained by linear regression analysis was 0.989 which shows a positive correlation as the closer the value to 1 is, the better the fit. The duration of performing the triplex real-time PCR assay is 3 h as compared to the conventional gel-based PCR assay which may take between 6 and 8 h. It is, therefore a rapid assay that can be used in microbiology laboratories. The costs associated with each reaction need to be calculated for the incorporation of this assay into routine diagnostic microbiology laboratories. However triplex realtime assay can be reserved for specialized microbiology laboratories or reference laboratories. Application of this rapid method and its effective use in serious cases will have a major impact in reducing the mortality rate and will be useful to physicians when prescribing antibiotics before starting the empirical therapy, thereby reducing the indiscriminate use of broad spectrum antibiotics. Acknowledgement This study was funded by the IRPA grant: 0-02-03-0112 PR 0047/19-10 and partly by Vote F F0100/2004A. References Ardic, N., Sareyyupoglu, B., Ozyurt, M., Haznedaroglu, T., Llga, U., 2006. Investigation of aminoglycoside modifying enzyme genes in methicillinresistant staphylococci. Microbiol. Res. 161, 49–54. Barber, M., 1961. Methicillin-resistant staphylococci. J. Clin. Pathol. 14, 385–393. Bergeron, M.G., Quellette, 1998. Preventing antibiotic resistance through rapid genotype identification of bacteria and of their antibiotic resistance genes in the clinical microbiology laboratory. J. Clin. Microbiol. 36, 2169–2172. Byl, B., Clevenbergh, P., Jacobs, F., Struelens, M.J., Zech, F., Kentos, A., Thys, J.P., 1999. Impact of infectious diseases specialists and microbiological data on the appropriateness of antimicrobial therapy for bacterimia. Clin. Infect. Dis. 29, 60–66. Chambers, H.F., 1997. Methicllin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin. Microbiol. Rev. 10, 781–791. Chambers, H.F., 2001. The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis. 7, 178–182.
162
N.S. Sabet et al. / Journal of Microbiological Methods 68 (2007) 157–162
Clinical and Laboratory Standards Institute. Method for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standardseventh addition and performance standards for antimicrobial susceptibility testing. M0-A7 and M100-S16.Wyne. Pa. Cosgrove, S.E., Sakoulas, G., Perencevich, E.N., Schwaber, M.J., Karchamer, A.W., Carmeli, Y., 2003. Comparison of mortality associated with methicillin-resistant and methicillin-susceptible Staphylococcus aureus bacterimia: a meta-analysis. Clin. Infect. Dis. 36, 53–59. Edwards, K.J., Kaufmann, M.E., Saunders, N.A., 2001. Rapid and accurate identification of coagulase negative staphylococci by real-time PCR. J. Clin. Microbiol. 39, 3047–3051. Hryniewicz, W., 1999. Epidemiology of MRSA. Infect. 27 (Suppl. 2), S13–S16. Kearns, A.M., Seiders, P.R., Wheeler, J., Freeman, R., Steward, M., 1999. Rapid detection of methicillin-resistant staphylococci by multiplex PCR. J. Hosp. Infect. 43, 33–37. Maltezou, H., Giamarellou, H., 2006. Community-acquired methicillin-resistant Staphylococcus aureus infections. Int. J. Antimicrob. Agents 27, 87–96. Martineau, F., Picard, F.J., Lansac, N., Menard, C., Roy, H.P., Ouellette, M., Bergeron, M.G., 2000. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidemidis. Antimicrob. Agents Chemother. 44, 231–238. Paule, S.M., Pasquariello, A.C., Hacek, D.M., Fisher, A.G., Thomson, R.B., Kaul, K.L., Peterson, L.R., 2004. Direct detection of Staphylococcus aureus from adult and neonate nasal swab specimens using real-time polymerase chain reaction. J. Mol. Diagnostics 6, 191–196. Reischl, U., Linde, H.J., Metz, M., Leppmeier, B., Lehn, N., 2000. Rapid identification of methicillin-resistant Staphylococcus aureus and simultaneous species confirmation using real-time PCR. J. Clin. Microbiol. 38, 2429–2433. Riberio, J., Vieira, F.D., King, T., D'Arezzo, J.B., Boyce, J.M., 1999. Misclassification of susceptible strains of Staphylococcus aureus as
methicillin-resistant Staphylococcus aureus by rapid automated susceptibility testing system. J. Clin. Microbiol. 37, 1619–1620. Riviere, D., Szczebara, F.M., Bereaud, J., Frere, J., Hechard, Y., 2006. Development of a real-time PCR assay for quantification of Acanthamoeba trophozoites and cysts. J. Microbiol. Methods 64, 78–83. Schmitz, F.J., Mackenzie, C.R., Hofmann, B., Verhoef, J., Finkeneigen, M., Hewz, H.P, Kohrer, K., 1997. Specific information concerning, taxonomy, pathogenecity and methicillin resistance of staphylococci obtained by multiplex PCR. J. Med. Microbiol. 46, 773–778. Schwarzkopf, Karch, A.H., Schmidt, H., Lenz, W., Heesemaan, J., 1993. Phenotypic and genotypic characterization of epidemic clumping factor-negative, oxacillinresistant Staphylococcus aureus. J. Clin. Microbiol. 31, 2281–2285. Shrestha, N.K., Tuohy, M.J., Hall, G.S., Isada, C.M., Procop, G.W., 2002. Rapid identification of Staphylococcus aureus and the mecA gene from BacT/ ALERT blood culture bottles by using the Light Cycler system. J. Clin. Microbiol. 40, 2659–2661. Strommenger, B., Kettlitz, C., Werner, G., Wolfgang, W., 2003. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 41, 4089–4094. Tan, T.Y., Corden, S., Barnes, R., Cookson, B., 2001. Rapid identification of methicillin-resistant Staphylococcus aureus from positive blood cultures by real-time fluorescence PCR. J. Clin. Microbiol. 39, 4529–4531. Unal, S., Hoskins, J., Flokowitsch, J.E., Wu, C.Y.E., Preston, D.A., Skatrud, P.L., 1992. Detection of methicillin-resistant staphylococci by using the polymerase chain reaction. J. Clin. Microbiol. 30, 1685–1691. Witte, W., Braulke, C., Cuny, C., Heuck, D., Kresken, M., 2001. Changing pattern of antibiotic resistance in methicillin-resistant Staphylococcus aureus from German hospitals. Infect. Control Hosp. Epidemiol. 22, 683–686.