- Email: [email protected]
Detection of mRNA for the transforming growth factor β family in human articular chondrocytes by the polymerase chain reaction
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Pages 602-608
October 31, 1991
DETECTION OF mRNA FOR THE TRANSFORMING GROWTH FACTOR B FAMILY IN HUMAN ARTICULAR CHONDROCYTES BY THE POLYMERASE CHAIN REACTION
A. Frazer, J. M. Seid, K. A. Hart I , H. Bentley, R. A. D. Bunning 2, and R. G. G. Russell Department of Human Metabolism and Clinical Biochemistry, University of Sheffield Medical School, Sheffield S10 2RX, U K IlCI Pharmaceuticals, Alderley Park, Macclesfield, Cheshire SK10 4TG, U K 2Division of Biomedical Sciences, Sheffield City Polytechnic, Sheffield S1 1WB, U K Received September 2, 1991
The Transforming Growth Factor-B (TGFB) family of polypeptides elicits diverse biological actions on a wide range of cell types. There are known to be several isoforms of TGFB coded for by different genes, with possibly differential expression and potencies. We have demonstrated that there is constitutive expression of three forms of transforming growth factor B in adult human articular chondrocytes. The presence of 10% fetal calf serum in the culture medium may influence expression. The addition of transforming growth factor B or interleukin 1B to the culture medium does not appear to consistently influence the expression of TGFB by the cells. ~ 1991Aoa~e~ic Press,
Inc.
Introduction. The transforming growth factors beta (TGFBs) are homodimeric peptide growth factors which have been shown to act on chondrocytes (1). TGFBs have been implicated in a wide variety of biological processes including inflammation and tissue repair (2), but their precise role requires clarification. TGF13s are one of the few agents known to inhibit the production by fibroblasts of proteinases, such as plasminogen activator and stromelysin, which may be involved in the degradation of extracellular matrix proteins. Furthermore, TGF13 stimulates the production of inhibitors of plasminogen activator (3) and of metalloproteinases, i.e. tissue inhibitor of metalloproteinases (TIMP) (4). TGF13 also stimulates the synthesis of extracellular matrix components, such as collagen and fibronectin (5). These actions may be important in the maintenance of the integrity of extracellular matrix and, along with the effects of TGFB on matrix synthesis, may promote tissue repair. TGF13 has a molecular weight of 25 kD and each of its monomeric units consists of 112 amino acids. The amino acid sequence is unrelated to any known previously and is identical in man, monkeys, cows, pigs and chickens (2). The family of TGF13s exists in at least five different isoforms, of which three have been wholly or partially characterised. TGF13 1 was originally
Abbreviations: TGFB, transforming growth factor beta; IL 113,interleukin 1 beta; PBS, phosphate buffered saline; rh, recombinant human; PCR, polymerase chain reaction; Taq, Thermus aquaticus; B2MG, B2 microglobulin; bp, base pairs; IL 6, interleukin 6; IL 8, interleukin 8. 0006-291X/91 $1.50 Copyright © 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
602
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
isolated from human platelets but has now been shown to come from many sources, including bone cells and monocyte-macrophages (6). TGFB 2 has been purified from porcine platelets, bovine bone and cultured human glioblastoma cells and, although it shares only 71% homology with TGFB 1, has similar actions to TGFB 1 (7). TGFB 3 has been identified by screening cDNA libraries (8) and has been expressed in recombinant form (9). TGFBs 4 and 5 have been cloned from non-mammalian sources (10,11). The TGFBs appear to have a very complicated regulatory network including autoregulation of their own expression (12). Actions of TGFB on chondrocytes include the inhibition of IL 1 induced protease activity and degradation of cartilage proteoglycan (13), stimulation of DNA synthesis in chick growth-plate chondrocytes (14) and partial inhibition of IL 1 stimulated cartilage resorption in vitro (15). In bovine cartilage organ cultures, TGFB stimulates biosynthesis and decreases the catabolism of proteoglycans (16). These observations suggest a possible role for TGFB in limiting cartilage degradation. The three forms, TGFB 1,2 and 3, may act in concert and, with other mediators, may stimulate the regeneration of extracellular matrix for connective tissue repair in conditions such as rheumatoid arthritis and osteoarthritis. Here, we have demonstrated the expression of TGFB 1,2 and 3 in human articular chondrocytes, under different experimental conditions, using cytokine MAPPing (message amplification phenotyping). This is a technique based on the identification of mRNAs from small numbers of cells. Following reverse transcription, specific sequences of cDNA are amplified using the polymerase chain reaction. The method permits the isolation of mRNA from one to a few thousand cells and enables several mRNA species to be identified simultaneously (17). Materials and Methods
Chondrocyte Culture Slices of human articular cartilage were taken from the femoral and tibial condyles of knee joints obtained following amputation for lower limb ischaemia and from femoral heads following femoral neck fracture. Chondrocytes were released from cartilage matrix by sequential enzyme digestion and grown in monolayers as previously described (18). On reaching confluence, cells were passaged into 60 mm dishes (Falcon) at a density of 5 x 105 cells per dish and maintained as before for approximately one week. Medium was removed from confluent dishes, monolayers were washed with PBS and incubated for 24 hours with either fresh medium or, for "serum-free" conditions, medium containing 0.1% bovine serum albumin (fraction V; Sigma, Poole, UK.). Chondrocytes were then washed in PBS and incubated for a further 6 hours in the presence of TGFB (10-9M) alone, or in combination with IL 1B (10 units/ml) with or without fetal calf serum. Following experimental incubations, cells were washed with PBS and stored at 70°C prior to RNA extraction. Cytokines rh IL 1B (108 units / mg) and TGFB 1 (2.28 x 10-SM) were the generous gifts of Glaxo and Genentech respectively. RNA Preparation RNA was prepared from cell monolayers by the acid guanidinium phenol chloroform (AGPC) method of Chomczynski (19). Briefly, cells were lysed in a denaturing solution containing guanidinium thiocyanate and extracted with phenol-chloroform. RNA remaining in the aqueous phase was precipitated with isopropanol and then with ethanol at -20°C. The final pellet of RNA was dissolved in water, quantitated by reading the optical density at 260 nm and stored at -20°C. cDNA Preparation Total cellular RNA (1-51xg) was converted to cDNA by reverse transcription using 400 units Molony Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Gibco BRL) in the presence of 10 ~tg random hexamer primers (Boehringer Mannheim UK) and 0.5mM of each dNTP in a buffer containing 50 mM Tris HC1, pH 8.3, 75 mM KC1, 10 mM dithiothreitol and 3 mM MgC12 in a total volume of 50 I.tl. The reaction was incubated at 37°C for 1 hour. Polvmerase Chain Reaction (PCR) cDNA was amplified by PCR using two specific oligonucleotide primers designed to detect the target cDNA. The reaction was carried out in a total 603
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
volume of 30 ~tl comprising of cDNA preparation (llxl), reaction buffer (1.0 mM "Iris HCI, pH 8.3, 50 mM KC1, 1.5 mM MgCI2 and 0.002% gelatin), dNTPs (100 I~M each), 0.8 units Taq DNA Polymerase (Amersham International plc) and 33 pmol of each primer. It was amplified in a Thermal Cycler (Hybaid). The cycle conditions were as follows : denaturation at 91°C for 1 minute, annealing at 60°C for 2 minutes and extension at 72°C for 2 minutes. The reaction products of PCR were analysed by electrophoresis on 2% agarose gels (Gibco BRL) containing 0.1 Ixg/ml ethidium bromide. If no signal appeared, more Taq DNA Polymerase was added to the PCR reaction and the sample reamplified for a total of 70 cycles to avoid false negatives. Restriction Analvsis The cDNA fragments produced by primer specific PCR were designed to contain known restriction sites. 7.5 Ixl of final PCR reaction product were further characterised by incubation with the appropriate restriction enzyme in a total volume of 37.5 lxl and the cut fragments identified on agarose gels. Primer Design and PCR Product Validation PCR primer pairs / products were validated according to the following criteria : 1) Generation of clean products resulted after amplification. 2) The PCR product was the predicted cDNA size. When possible, the primer pairs were selected to bridge an intron in the specific mRNA sequence. Thus, if the RNA samples were contaminated with genomic DNA, the product would be larger than the predicted size. 3) The PCR product should be cleaved by predicted restriction enzymes. 4) In all experiments, primers from the B2 microglobulin gene were used as controls for cDNA integrity and the presence of contaminant genomic DNA. Negative controls (without cDNA) were carried out on each primer and no product was found (data not shown). Results. Total RNA was extracted from experimental cultures and reverse transcribed and the cDNA amplified by PCR using specific oligonucleotide primers for TGFB 1, TGFB 2 or TGFB 3 (Table 1). A comparison of expression of TGFBs 1, 2 and 3 was made using RNA obtained from four chondrocyte cultures derived from separate tissue sources (Fig. 1). In each case, TGFB 1 was expressed. Expression of TGFB 2 appeared to be less consistent : it was expressed in three out of the four cases shown and there was more than one band present. At least one of these can be explained by the presence of a differentially spliced version of TGFB 2 (20), supported by restriction endonuclease digestion of a unique Kpn 1 site (Fig. 3). TGFB 3 gave very faint bands and in one case could only be detected following amplification for a further 35 cycles (data not shown). The expression of the three forms of TGFB were then studied in the presence of IL 1B (10 u/ml) or TGFB (10-9M) alone and in combination, with or without serum. The results are summarised in
Table 1. Primer DNA sequences Primer
Product Restriction Size (10p) Site
Restriction Products
TGFi31-3' ACCACTGCCGCACAACTCCGGTGAC TGF81-5' ATCTATGACAAG'FFCAAGCAGAGTA
268
Kpn I
192+76
TGF82-3' AGGCACTCTGGCI I I IGGG'FrCTGC
288
TGF82-5' GACC-,-,-,-,-,-,-,-~AGAGTACTACGCCAAGGAG
204
Taq! Kpn ! Taq ]
96+192 144+144 96+108
TGF63-3' ccn-GTATAACATAATCCAGAI-rCC TGF83-5' CTGGGCTCTGAGAATCACGGTGGTA (no intron present)
290
Bgl I!
220+70
B2MG -3' CTCCATGATGCTGC'I-rACATGTCTC f~?.MG -5' CAGGTTTACTCACGTCATCCAGCAG
293
EcoR I
All primer sequences given in 5' to 3' orientalion.
604
184+109
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
C1
C2
C3
1 2 34
7 8 0
121314
C4
171810
Figure 1 Detection of TGF8 expression in 4 samples of cultured human chondrocytes (C1, C2, C3, C4) by PCR amplification using specific oligonucleotide primers for the multiple forms TGF8 1, 2 and 3. Lane 1, Kb ladder; lanes 2,7,12,1 7, TGFB1; lanes 3,8,13,18, TGFB2; lanes 4,9,14,19, TGF83.
Table 2. The results of one experiment of the three carried out are shown in Fig. 2 . In each experiment, the expression of TGFB 1 was apparently unaffected by the culture conditions and appeared not to be influenced by the presence of serum or the addition of IL 1B or TGFB. The results obtained from all three experiments for TGFBs 2 and 3 were variable but overall there was no evidence that expression was influenced by either TGFB or IL lB. However in some experiments, the presence of serum appeared to influence expression. The fidelity of the amplified fragments was confirmed by restriction analysis and these results are shown in Fig.3. In each case the single band resolved into two bands of expected size, the possible two bands for TGFB 2 were distinguished using two different restriction enzymes. In summary these results indicate that all three forms of TGFB are expressed in cultured human chondrocytes and that their expression is constitutive.
Table 2
Primer/Condition
With serum
Without serum
1
2
3
4
5
6
7
8
-t+
+ +
-t-
-I-
-I+ +
-F + +
-I+ +
-I+ +
+ + +
+ + +
+ + -
+ + +
+ -I+
+ + +
+ -I-
+ + -
+ + +
+ + -
+ + +
+ + -
+ + +
+ + +
-I+ +
+ + +
Expt.1
TGF81 TGFB2 TGF83 Expt.2
TGF81 TGF82 TGF83 Expt.3
TGF81 TGF82 TGFB3
1 and 5, control; 2 and 6, IL 1 8 (10 units/ml); + : band of appropriate size present : no bands present
3 and 7, TGF81 (10 -9 M); 4 and 8, IL 18 + TGFS.
605
V o l . 1 80, N o. 2, 1991
A
BIOCHEMICAL A N D BIOPHYSICAL RESEARCH COMMUNICATIONS
B
C
D
iB
1234
5678
1234
5678
1234
5878
1234
5878
Figure 2 The effect of incubation conditions on TGF8 expression. Lanes 1+5, control; lanes 2+6, IL 113(10 units / ml); lanes 3+7, TGFi31 (10-9 M); lanes 4+8, IL 18+TGF81. Lanes 1-4, without serum; lanes 5-8, with serum. A, TGFI3 1 ; B, TGF8 2; C, TGFi3 3; D, B2 microglobulin.
Discussion. In this study we have used a method of mRNA phenotyping to demonstrate for the first time that TGFBs 1, 2 and 3 are constitutively expressed in cultured human chondrocytes. It has previously been shown that mRNA for TGFB 1 is present in many cell lines, bone marrow cells and cells of the developing fetal liver (21,22). TGFB 2 mRNA is expressed in developing bone and in some mesenchymal tissue (23). mRNAs for TGFBs 1 and 3 are expressed in murine
TGFI31
TGFB2
TGFB3
U R
URIR2
UR
B2 M G
UR
|
Identification of PCR products by restriction analysis. In each case, one band resolves into two bands
of expected size. U, unrestricted; R, restricted. For TGFI32, two enzymes (RlandR2) are used to distinguish between the two bands seen, due to the presence of an alternative splicing site. Rt : Kpn R2 : Taq II
606
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
embryos and adult tissues (24,25), also in human breast cancer cell lines (26), but expression of three isoforms of TGFI3 has not yet been shown in human articular chondrocytes. IL 11] is known to induce IL 6 and IL 8 production in human articular chondrocytes (27,28) and although IL 113is not constitutively expressed in human connective tissue cells, expression can be induced by stimulation with IL 113 (29). In this system, expression of TGFI]s in chondrocytes does not appear to be affected by IL lB. Our findings demonstrate that TGFI] 1 is constitutively expressed by chondrocytes in vitro and is the form of the cytokine which is most consistently found. TGFI]s 2 and 3 are also constitutively expressed but less consistently. TGFI] does not appear to regulate its own expression in chondrocytes in an autocrine manner. Patterns of expression may be dependent upon interactions with other cytokines, either present in the serum or added to the culture system. It is not yet known how the patterns of gene expression relate to the biological activity. As in bone, TGFB could be synthesized by chondrocytes in a latent form, secreted and stored in the matrix prior to its activation. Thus its regulation could be post transcriptional. Further insight into the mechanisms of regulation of the TGFI3s, the possibility of their autoinduction and the effect of culture conditions should be possible when message levels can be measured. The PCR method as currently used is not quantitative, but a quantitative method has been developed (30). TGFI3 may be important in repair mechanisms, since it promotes regeneration of extracellular matrix and inhibition of matrix degradation (13,15). It may also be protective in inflammatory situations such as rheumatoid arthritis. More recently it has been shown to suppress acute and chronic arthritis in an animal model (31). TGFI] has been found in synovial effusions and joint connective tissues from patients with rheumatoid arthritis (32,33). Our studies suggest that chondrocytes may be one potential source of TGFI] in synovial fluid. Acknowledgments. We are grateful to the Arthritis and Rheumatism Council, the Nuffield Foundation and the Science and Engineering Research Council for support. References
1. 2. 3. 4.
Centrella, M., McCarthy, T.L. and Canalis, E. (1988) FASEB J. 2, 3066-3073. Sporn, M.B. and Roberts, A.B. (1989) JAMA 262, 938-941. Laiho,M., Saksela,O, Andreasen,P.A.and Keski-Oja,J.(1986)J. Cell. Biol.103, 2403-2410. Sporn, M.B., Roberts, A.B., Wakefield, L.M. and de Crombrugghe, B. (1987) J. Cell. Biol. 105, 1039-1045. 5. Ignotz, R.A. and Massague, J. (1986) J. Biol Chem. 264, 4337-4345. 6. Rappolee, D.A., Mark, D., Banda, M.J. and Werb Z. (1989) Science 241,708-712. 7. Roberts, A.B. and Sporn, M.B. (1989) In Peptide Growth Factors and Their Receptors, Handbook of Experimental Pharmacology, Vol. 95, pp.419-472. Springer-Verlag, Heidelberg. 8. Graycar, J.L., Miller, D.A., Arrick, B.A., Lyons, R.M., Moses, H.L. and Derynck, R (1989) Mol. Endocrinol.3, 1977-1986. 9. ten Dijke, P., Iwata, K.K., Thorikay, M., Schwedes, J., Stewart, A. and Pieler, C. (1990) Ann. N.Y. Acad. Sci.,593, 26-42. 10. Jakowlew, S.B., Dillard, P.J., Sporn, M.B. and Roberts, A.B. (1988) Mol. Endocrinol. 2, 1186-1195. 11. Kondaiah P., Sands, M.J., Smith, J.M., Fields, A., Roberts, A.B., Sporn M.B. and Melton, D.A. (1990) J. Biol. Chem., 265, 1089-1093. 607
Vo I. 180, N o. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
12. Bascom, C.C., Wolfshohl, J.R., Coffey, R.J. Jr., Madisen,L., Webb, N.R., Purchio, A.R., Derynck, R. and Moses, H.L. (1989) Mol. Cell. Biol. 9, 5508-5515. 13. Chandrasekhar S. and Harvey A.K. (1988) Biochem. Biophys. Res. Commun. 157,13521359. 14. Rosier, R.N., O'Keefe, R.J., Crabb, I.D. and Puzas, J.E. (1989) Connect. Tiss. Res. 20, 295-301. 15. Andrews, H.J., Edwards, T.A., Cawston, T.E. and Hazleman, B.L. (1989) Biochem. Biophys. Res. Comm. 162, 144-150. 16. Morales, T.I. and Roberts, A.B. (1988) J. Biol. Chem. 263, 12828-12831. 17. Brenner, C.A., Tam, A.W., Nelson, P.A., Engleman, E.G., Suzuki, N., Fry, K.E. and Larrick, J.W. (1989) BioTechniques 7, 1096-1103. 18. Gowen, M., Wood, D.D., Ihrie, E.J., Meats, J.E. and Russell, R.G.G. (1984) Biochim. Biophys. Acta, 797, 186-193. 19. Chomczynski, P. and Sacchi, N. (1987) Anal. Biochem. 162, 156-159. 20. Webb, N.R., Madisen, L., Rose, T.M., and Purchio, A.F. (1988) DNA, 7, 493-497. 21. Lehnert, S.A. and Akhurst, R.J. (1988) Development 104, 263-273. 22. Wilcox, J.N. and Derynck, R (1988) Mol. Cell. Biol. 8, 3415-3422. 23. Pelton, R.W., Nomura, A., Moses H.L. and Hogan, B.L.M. (1989) Development 106, 759-767. 24. Miller, D.A., Lee, A., Pelton, R.W., Chen, E.Y., Moses, H.L. and Derynck, R. (1989) Mol. Endocrinol. 3, 1108-1114. 25. Miller, D.A., Lee, A., Matsui, Y., Chen, E.Y., Moses, H.L. and Derynck, R. (1989) Mol. Endocrinol. 3:12, 1926-1934. 26. Arrick, B.A., Korc, M. and Derynck, R. (1990) Cancer Res. 50, 299-303. 27. Bunning, R.A.D., Russell, R.G.G. and Van Damme, J. (1990) Biochem. Biophys. Res. Comm. 166, 1163-1170. 28. Van Damme, J., Bunning, R.A.D., Conings, R., Russell, R.G.G.and Opdenakker, G. (1990) Cytokine, 2, 106-111. 29. Seid, J.M., Rahman, S., Graveley, R., Bunning, R.A.D., Fuchs, S., Nordmann, R. and Russell, R.G.G. (1990) Calcif. Tissue Int. 46, Supp. 2, 181. 30. Wang, A.M., Doyle, M.V. and Mark D.F.(1989) Proc.Natl.Acad.Sci.USA, 86, 9717-9721. 31. Brandes,M.E.,Allen,J.B., Ogawa,Y. and Wahl,S.M.(1991) J. Clin. Invest. 87, 1108-1113. 32. Fava,R., Olsen,N., Keski-Oja,J., Moses,H.and Pincus,T.(1989) J.Exp.Med.169, 291-296. 33. Lafyatis, R., Thompson, N.L., Remmers, E.F., Flanders, K.C., Roche, N.S., Kim, S-J., Case, J.P., Sporn, M.B., Roberts, A.B. and Wilder, R.L. (1989) J. Immunol. 143, 11421148.
608
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Pages 602-608
October 31, 1991
DETECTION OF mRNA FOR THE TRANSFORMING GROWTH FACTOR B FAMILY IN HUMAN ARTICULAR CHONDROCYTES BY THE POLYMERASE CHAIN REACTION
A. Frazer, J. M. Seid, K. A. Hart I , H. Bentley, R. A. D. Bunning 2, and R. G. G. Russell Department of Human Metabolism and Clinical Biochemistry, University of Sheffield Medical School, Sheffield S10 2RX, U K IlCI Pharmaceuticals, Alderley Park, Macclesfield, Cheshire SK10 4TG, U K 2Division of Biomedical Sciences, Sheffield City Polytechnic, Sheffield S1 1WB, U K Received September 2, 1991
The Transforming Growth Factor-B (TGFB) family of polypeptides elicits diverse biological actions on a wide range of cell types. There are known to be several isoforms of TGFB coded for by different genes, with possibly differential expression and potencies. We have demonstrated that there is constitutive expression of three forms of transforming growth factor B in adult human articular chondrocytes. The presence of 10% fetal calf serum in the culture medium may influence expression. The addition of transforming growth factor B or interleukin 1B to the culture medium does not appear to consistently influence the expression of TGFB by the cells. ~ 1991Aoa~e~ic Press,
Inc.
Introduction. The transforming growth factors beta (TGFBs) are homodimeric peptide growth factors which have been shown to act on chondrocytes (1). TGFBs have been implicated in a wide variety of biological processes including inflammation and tissue repair (2), but their precise role requires clarification. TGF13s are one of the few agents known to inhibit the production by fibroblasts of proteinases, such as plasminogen activator and stromelysin, which may be involved in the degradation of extracellular matrix proteins. Furthermore, TGF13 stimulates the production of inhibitors of plasminogen activator (3) and of metalloproteinases, i.e. tissue inhibitor of metalloproteinases (TIMP) (4). TGF13 also stimulates the synthesis of extracellular matrix components, such as collagen and fibronectin (5). These actions may be important in the maintenance of the integrity of extracellular matrix and, along with the effects of TGFB on matrix synthesis, may promote tissue repair. TGF13 has a molecular weight of 25 kD and each of its monomeric units consists of 112 amino acids. The amino acid sequence is unrelated to any known previously and is identical in man, monkeys, cows, pigs and chickens (2). The family of TGF13s exists in at least five different isoforms, of which three have been wholly or partially characterised. TGF13 1 was originally
Abbreviations: TGFB, transforming growth factor beta; IL 113,interleukin 1 beta; PBS, phosphate buffered saline; rh, recombinant human; PCR, polymerase chain reaction; Taq, Thermus aquaticus; B2MG, B2 microglobulin; bp, base pairs; IL 6, interleukin 6; IL 8, interleukin 8. 0006-291X/91 $1.50 Copyright © 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
602
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
isolated from human platelets but has now been shown to come from many sources, including bone cells and monocyte-macrophages (6). TGFB 2 has been purified from porcine platelets, bovine bone and cultured human glioblastoma cells and, although it shares only 71% homology with TGFB 1, has similar actions to TGFB 1 (7). TGFB 3 has been identified by screening cDNA libraries (8) and has been expressed in recombinant form (9). TGFBs 4 and 5 have been cloned from non-mammalian sources (10,11). The TGFBs appear to have a very complicated regulatory network including autoregulation of their own expression (12). Actions of TGFB on chondrocytes include the inhibition of IL 1 induced protease activity and degradation of cartilage proteoglycan (13), stimulation of DNA synthesis in chick growth-plate chondrocytes (14) and partial inhibition of IL 1 stimulated cartilage resorption in vitro (15). In bovine cartilage organ cultures, TGFB stimulates biosynthesis and decreases the catabolism of proteoglycans (16). These observations suggest a possible role for TGFB in limiting cartilage degradation. The three forms, TGFB 1,2 and 3, may act in concert and, with other mediators, may stimulate the regeneration of extracellular matrix for connective tissue repair in conditions such as rheumatoid arthritis and osteoarthritis. Here, we have demonstrated the expression of TGFB 1,2 and 3 in human articular chondrocytes, under different experimental conditions, using cytokine MAPPing (message amplification phenotyping). This is a technique based on the identification of mRNAs from small numbers of cells. Following reverse transcription, specific sequences of cDNA are amplified using the polymerase chain reaction. The method permits the isolation of mRNA from one to a few thousand cells and enables several mRNA species to be identified simultaneously (17). Materials and Methods
Chondrocyte Culture Slices of human articular cartilage were taken from the femoral and tibial condyles of knee joints obtained following amputation for lower limb ischaemia and from femoral heads following femoral neck fracture. Chondrocytes were released from cartilage matrix by sequential enzyme digestion and grown in monolayers as previously described (18). On reaching confluence, cells were passaged into 60 mm dishes (Falcon) at a density of 5 x 105 cells per dish and maintained as before for approximately one week. Medium was removed from confluent dishes, monolayers were washed with PBS and incubated for 24 hours with either fresh medium or, for "serum-free" conditions, medium containing 0.1% bovine serum albumin (fraction V; Sigma, Poole, UK.). Chondrocytes were then washed in PBS and incubated for a further 6 hours in the presence of TGFB (10-9M) alone, or in combination with IL 1B (10 units/ml) with or without fetal calf serum. Following experimental incubations, cells were washed with PBS and stored at 70°C prior to RNA extraction. Cytokines rh IL 1B (108 units / mg) and TGFB 1 (2.28 x 10-SM) were the generous gifts of Glaxo and Genentech respectively. RNA Preparation RNA was prepared from cell monolayers by the acid guanidinium phenol chloroform (AGPC) method of Chomczynski (19). Briefly, cells were lysed in a denaturing solution containing guanidinium thiocyanate and extracted with phenol-chloroform. RNA remaining in the aqueous phase was precipitated with isopropanol and then with ethanol at -20°C. The final pellet of RNA was dissolved in water, quantitated by reading the optical density at 260 nm and stored at -20°C. cDNA Preparation Total cellular RNA (1-51xg) was converted to cDNA by reverse transcription using 400 units Molony Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Gibco BRL) in the presence of 10 ~tg random hexamer primers (Boehringer Mannheim UK) and 0.5mM of each dNTP in a buffer containing 50 mM Tris HC1, pH 8.3, 75 mM KC1, 10 mM dithiothreitol and 3 mM MgC12 in a total volume of 50 I.tl. The reaction was incubated at 37°C for 1 hour. Polvmerase Chain Reaction (PCR) cDNA was amplified by PCR using two specific oligonucleotide primers designed to detect the target cDNA. The reaction was carried out in a total 603
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
volume of 30 ~tl comprising of cDNA preparation (llxl), reaction buffer (1.0 mM "Iris HCI, pH 8.3, 50 mM KC1, 1.5 mM MgCI2 and 0.002% gelatin), dNTPs (100 I~M each), 0.8 units Taq DNA Polymerase (Amersham International plc) and 33 pmol of each primer. It was amplified in a Thermal Cycler (Hybaid). The cycle conditions were as follows : denaturation at 91°C for 1 minute, annealing at 60°C for 2 minutes and extension at 72°C for 2 minutes. The reaction products of PCR were analysed by electrophoresis on 2% agarose gels (Gibco BRL) containing 0.1 Ixg/ml ethidium bromide. If no signal appeared, more Taq DNA Polymerase was added to the PCR reaction and the sample reamplified for a total of 70 cycles to avoid false negatives. Restriction Analvsis The cDNA fragments produced by primer specific PCR were designed to contain known restriction sites. 7.5 Ixl of final PCR reaction product were further characterised by incubation with the appropriate restriction enzyme in a total volume of 37.5 lxl and the cut fragments identified on agarose gels. Primer Design and PCR Product Validation PCR primer pairs / products were validated according to the following criteria : 1) Generation of clean products resulted after amplification. 2) The PCR product was the predicted cDNA size. When possible, the primer pairs were selected to bridge an intron in the specific mRNA sequence. Thus, if the RNA samples were contaminated with genomic DNA, the product would be larger than the predicted size. 3) The PCR product should be cleaved by predicted restriction enzymes. 4) In all experiments, primers from the B2 microglobulin gene were used as controls for cDNA integrity and the presence of contaminant genomic DNA. Negative controls (without cDNA) were carried out on each primer and no product was found (data not shown). Results. Total RNA was extracted from experimental cultures and reverse transcribed and the cDNA amplified by PCR using specific oligonucleotide primers for TGFB 1, TGFB 2 or TGFB 3 (Table 1). A comparison of expression of TGFBs 1, 2 and 3 was made using RNA obtained from four chondrocyte cultures derived from separate tissue sources (Fig. 1). In each case, TGFB 1 was expressed. Expression of TGFB 2 appeared to be less consistent : it was expressed in three out of the four cases shown and there was more than one band present. At least one of these can be explained by the presence of a differentially spliced version of TGFB 2 (20), supported by restriction endonuclease digestion of a unique Kpn 1 site (Fig. 3). TGFB 3 gave very faint bands and in one case could only be detected following amplification for a further 35 cycles (data not shown). The expression of the three forms of TGFB were then studied in the presence of IL 1B (10 u/ml) or TGFB (10-9M) alone and in combination, with or without serum. The results are summarised in
Table 1. Primer DNA sequences Primer
Product Restriction Size (10p) Site
Restriction Products
TGFi31-3' ACCACTGCCGCACAACTCCGGTGAC TGF81-5' ATCTATGACAAG'FFCAAGCAGAGTA
268
Kpn I
192+76
TGF82-3' AGGCACTCTGGCI I I IGGG'FrCTGC
288
TGF82-5' GACC-,-,-,-,-,-,-,-~AGAGTACTACGCCAAGGAG
204
Taq! Kpn ! Taq ]
96+192 144+144 96+108
TGF63-3' ccn-GTATAACATAATCCAGAI-rCC TGF83-5' CTGGGCTCTGAGAATCACGGTGGTA (no intron present)
290
Bgl I!
220+70
B2MG -3' CTCCATGATGCTGC'I-rACATGTCTC f~?.MG -5' CAGGTTTACTCACGTCATCCAGCAG
293
EcoR I
All primer sequences given in 5' to 3' orientalion.
604
184+109
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
C1
C2
C3
1 2 34
7 8 0
121314
C4
171810
Figure 1 Detection of TGF8 expression in 4 samples of cultured human chondrocytes (C1, C2, C3, C4) by PCR amplification using specific oligonucleotide primers for the multiple forms TGF8 1, 2 and 3. Lane 1, Kb ladder; lanes 2,7,12,1 7, TGFB1; lanes 3,8,13,18, TGFB2; lanes 4,9,14,19, TGF83.
Table 2. The results of one experiment of the three carried out are shown in Fig. 2 . In each experiment, the expression of TGFB 1 was apparently unaffected by the culture conditions and appeared not to be influenced by the presence of serum or the addition of IL 1B or TGFB. The results obtained from all three experiments for TGFBs 2 and 3 were variable but overall there was no evidence that expression was influenced by either TGFB or IL lB. However in some experiments, the presence of serum appeared to influence expression. The fidelity of the amplified fragments was confirmed by restriction analysis and these results are shown in Fig.3. In each case the single band resolved into two bands of expected size, the possible two bands for TGFB 2 were distinguished using two different restriction enzymes. In summary these results indicate that all three forms of TGFB are expressed in cultured human chondrocytes and that their expression is constitutive.
Table 2
Primer/Condition
With serum
Without serum
1
2
3
4
5
6
7
8
-t+
+ +
-t-
-I-
-I+ +
-F + +
-I+ +
-I+ +
+ + +
+ + +
+ + -
+ + +
+ -I+
+ + +
+ -I-
+ + -
+ + +
+ + -
+ + +
+ + -
+ + +
+ + +
-I+ +
+ + +
Expt.1
TGF81 TGFB2 TGF83 Expt.2
TGF81 TGF82 TGF83 Expt.3
TGF81 TGF82 TGFB3
1 and 5, control; 2 and 6, IL 1 8 (10 units/ml); + : band of appropriate size present : no bands present
3 and 7, TGF81 (10 -9 M); 4 and 8, IL 18 + TGFS.
605
V o l . 1 80, N o. 2, 1991
A
BIOCHEMICAL A N D BIOPHYSICAL RESEARCH COMMUNICATIONS
B
C
D
iB
1234
5678
1234
5678
1234
5878
1234
5878
Figure 2 The effect of incubation conditions on TGF8 expression. Lanes 1+5, control; lanes 2+6, IL 113(10 units / ml); lanes 3+7, TGFi31 (10-9 M); lanes 4+8, IL 18+TGF81. Lanes 1-4, without serum; lanes 5-8, with serum. A, TGFI3 1 ; B, TGF8 2; C, TGFi3 3; D, B2 microglobulin.
Discussion. In this study we have used a method of mRNA phenotyping to demonstrate for the first time that TGFBs 1, 2 and 3 are constitutively expressed in cultured human chondrocytes. It has previously been shown that mRNA for TGFB 1 is present in many cell lines, bone marrow cells and cells of the developing fetal liver (21,22). TGFB 2 mRNA is expressed in developing bone and in some mesenchymal tissue (23). mRNAs for TGFBs 1 and 3 are expressed in murine
TGFI31
TGFB2
TGFB3
U R
URIR2
UR
B2 M G
UR
|
Identification of PCR products by restriction analysis. In each case, one band resolves into two bands
of expected size. U, unrestricted; R, restricted. For TGFI32, two enzymes (RlandR2) are used to distinguish between the two bands seen, due to the presence of an alternative splicing site. Rt : Kpn R2 : Taq II
606
Vol. 180, No. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
embryos and adult tissues (24,25), also in human breast cancer cell lines (26), but expression of three isoforms of TGFI3 has not yet been shown in human articular chondrocytes. IL 11] is known to induce IL 6 and IL 8 production in human articular chondrocytes (27,28) and although IL 113is not constitutively expressed in human connective tissue cells, expression can be induced by stimulation with IL 113 (29). In this system, expression of TGFI]s in chondrocytes does not appear to be affected by IL lB. Our findings demonstrate that TGFI] 1 is constitutively expressed by chondrocytes in vitro and is the form of the cytokine which is most consistently found. TGFI]s 2 and 3 are also constitutively expressed but less consistently. TGFI] does not appear to regulate its own expression in chondrocytes in an autocrine manner. Patterns of expression may be dependent upon interactions with other cytokines, either present in the serum or added to the culture system. It is not yet known how the patterns of gene expression relate to the biological activity. As in bone, TGFB could be synthesized by chondrocytes in a latent form, secreted and stored in the matrix prior to its activation. Thus its regulation could be post transcriptional. Further insight into the mechanisms of regulation of the TGFI3s, the possibility of their autoinduction and the effect of culture conditions should be possible when message levels can be measured. The PCR method as currently used is not quantitative, but a quantitative method has been developed (30). TGFI3 may be important in repair mechanisms, since it promotes regeneration of extracellular matrix and inhibition of matrix degradation (13,15). It may also be protective in inflammatory situations such as rheumatoid arthritis. More recently it has been shown to suppress acute and chronic arthritis in an animal model (31). TGFI] has been found in synovial effusions and joint connective tissues from patients with rheumatoid arthritis (32,33). Our studies suggest that chondrocytes may be one potential source of TGFI] in synovial fluid. Acknowledgments. We are grateful to the Arthritis and Rheumatism Council, the Nuffield Foundation and the Science and Engineering Research Council for support. References
1. 2. 3. 4.
Centrella, M., McCarthy, T.L. and Canalis, E. (1988) FASEB J. 2, 3066-3073. Sporn, M.B. and Roberts, A.B. (1989) JAMA 262, 938-941. Laiho,M., Saksela,O, Andreasen,P.A.and Keski-Oja,J.(1986)J. Cell. Biol.103, 2403-2410. Sporn, M.B., Roberts, A.B., Wakefield, L.M. and de Crombrugghe, B. (1987) J. Cell. Biol. 105, 1039-1045. 5. Ignotz, R.A. and Massague, J. (1986) J. Biol Chem. 264, 4337-4345. 6. Rappolee, D.A., Mark, D., Banda, M.J. and Werb Z. (1989) Science 241,708-712. 7. Roberts, A.B. and Sporn, M.B. (1989) In Peptide Growth Factors and Their Receptors, Handbook of Experimental Pharmacology, Vol. 95, pp.419-472. Springer-Verlag, Heidelberg. 8. Graycar, J.L., Miller, D.A., Arrick, B.A., Lyons, R.M., Moses, H.L. and Derynck, R (1989) Mol. Endocrinol.3, 1977-1986. 9. ten Dijke, P., Iwata, K.K., Thorikay, M., Schwedes, J., Stewart, A. and Pieler, C. (1990) Ann. N.Y. Acad. Sci.,593, 26-42. 10. Jakowlew, S.B., Dillard, P.J., Sporn, M.B. and Roberts, A.B. (1988) Mol. Endocrinol. 2, 1186-1195. 11. Kondaiah P., Sands, M.J., Smith, J.M., Fields, A., Roberts, A.B., Sporn M.B. and Melton, D.A. (1990) J. Biol. Chem., 265, 1089-1093. 607
Vo I. 180, N o. 2, 1991
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
12. Bascom, C.C., Wolfshohl, J.R., Coffey, R.J. Jr., Madisen,L., Webb, N.R., Purchio, A.R., Derynck, R. and Moses, H.L. (1989) Mol. Cell. Biol. 9, 5508-5515. 13. Chandrasekhar S. and Harvey A.K. (1988) Biochem. Biophys. Res. Commun. 157,13521359. 14. Rosier, R.N., O'Keefe, R.J., Crabb, I.D. and Puzas, J.E. (1989) Connect. Tiss. Res. 20, 295-301. 15. Andrews, H.J., Edwards, T.A., Cawston, T.E. and Hazleman, B.L. (1989) Biochem. Biophys. Res. Comm. 162, 144-150. 16. Morales, T.I. and Roberts, A.B. (1988) J. Biol. Chem. 263, 12828-12831. 17. Brenner, C.A., Tam, A.W., Nelson, P.A., Engleman, E.G., Suzuki, N., Fry, K.E. and Larrick, J.W. (1989) BioTechniques 7, 1096-1103. 18. Gowen, M., Wood, D.D., Ihrie, E.J., Meats, J.E. and Russell, R.G.G. (1984) Biochim. Biophys. Acta, 797, 186-193. 19. Chomczynski, P. and Sacchi, N. (1987) Anal. Biochem. 162, 156-159. 20. Webb, N.R., Madisen, L., Rose, T.M., and Purchio, A.F. (1988) DNA, 7, 493-497. 21. Lehnert, S.A. and Akhurst, R.J. (1988) Development 104, 263-273. 22. Wilcox, J.N. and Derynck, R (1988) Mol. Cell. Biol. 8, 3415-3422. 23. Pelton, R.W., Nomura, A., Moses H.L. and Hogan, B.L.M. (1989) Development 106, 759-767. 24. Miller, D.A., Lee, A., Pelton, R.W., Chen, E.Y., Moses, H.L. and Derynck, R. (1989) Mol. Endocrinol. 3, 1108-1114. 25. Miller, D.A., Lee, A., Matsui, Y., Chen, E.Y., Moses, H.L. and Derynck, R. (1989) Mol. Endocrinol. 3:12, 1926-1934. 26. Arrick, B.A., Korc, M. and Derynck, R. (1990) Cancer Res. 50, 299-303. 27. Bunning, R.A.D., Russell, R.G.G. and Van Damme, J. (1990) Biochem. Biophys. Res. Comm. 166, 1163-1170. 28. Van Damme, J., Bunning, R.A.D., Conings, R., Russell, R.G.G.and Opdenakker, G. (1990) Cytokine, 2, 106-111. 29. Seid, J.M., Rahman, S., Graveley, R., Bunning, R.A.D., Fuchs, S., Nordmann, R. and Russell, R.G.G. (1990) Calcif. Tissue Int. 46, Supp. 2, 181. 30. Wang, A.M., Doyle, M.V. and Mark D.F.(1989) Proc.Natl.Acad.Sci.USA, 86, 9717-9721. 31. Brandes,M.E.,Allen,J.B., Ogawa,Y. and Wahl,S.M.(1991) J. Clin. Invest. 87, 1108-1113. 32. Fava,R., Olsen,N., Keski-Oja,J., Moses,H.and Pincus,T.(1989) J.Exp.Med.169, 291-296. 33. Lafyatis, R., Thompson, N.L., Remmers, E.F., Flanders, K.C., Roche, N.S., Kim, S-J., Case, J.P., Sporn, M.B., Roberts, A.B. and Wilder, R.L. (1989) J. Immunol. 143, 11421148.
608