Detection of Mycobacterium paratuberculosis in stool samples of patients with inflammatory bowel disease by IS900-based PCR and colorimetric detection of amplified DNA

Journal of Microbiological Methods 33 (1998) 105–114

Journal of Microbiological Methods

Detection of Mycobacterium paratuberculosis in stool samples of patients with inflammatory bowel disease by IS900-based PCR and colorimetric detection of amplified DNA a, b b b Raffaele Del Prete *, Michele Quaranta , Antonio Lippolis , Vito Giannuzzi , a a ,b a Adriana Mosca , Emilio Jirillo , Giuseppe Miragliotta a

Department of Clinical Medicine, Immunology and Infectious Diseases, Section of Medical Microbiology, University of Bari, Piazza G. Cesare, 4 I-70124 Bari, Italy b IRCCS Scientific Institute for Digestive Diseases, ‘ S. de Bellis’, Castellana Grotte, Bari, Italy Accepted 27 March 1998

Abstract The hypothesis that Crohn’s disease (CD) and ulcerative colitis (UC) may result from mycobacterial infection has been proposed. Among the atypical mycobacteria, Mycobacterium paratuberculosis has been often involved in the pathogenesis of CD and UC. The polymerase chain reaction (PCR) with a single primer pair from the nucleotide sequence of the ‘Insertion Sequence’ IS900 of M. paratuberculosis followed by a non-isotopic ELISA-like detection method of amplification products for the specific detection of M. paratuberculosis in human feces was developed. Fifteen (46.8%) of the 32 stool samples from patients with histologically confirmed CD, and nine (33.3%) of the 27 stool samples from patients with UC had a 229-bp fragment of M. paratuberculosis DNA detected by ethidium bromide agarose gel electrophoresis. Of the 41 stool samples used as negative control, 30 were from healthy subjects, nine from patients with other non-specific gastrointestinal diseases, and two from patients with colon cancer. Only one of these samples, namely from one of the patients with colon cancer, was positive by PCR. With regard to cultural technique, eight stool samples from patients with CD, five samples from patients with UC and one sample from a patient with colon cancer allowed the mycobacterial growth. The amplified PCR products were identified by using a colorimetric detection procedure designed DNA Enzyme ImmunoAssay (DEIA), based on the hybridization of the denatured DNA with a non-radioactively labelled inter-primer specific oligonucleotide probe. Severe precautions were taken to exclude either the possible contamination among the samples or false-positive results. Our findings confirm other works in which M. paratuberculosis has been considered the putative etiologic agent responsible for CD and UC. In addition, the newly developed PCR-DEIA technique, revealing a higher sensitivity than cultural technique and being much more rapid, represents a useful tool for both epidemiological and therapeutic purposes.  1998 Elsevier Science B.V. Keywords: Crohn’s disease; Feces; M. paratuberculosis; PCR; Probe; Ulcerative colitis

1. Introduction *Corresponding author. Tel.: 139 80 5478486; fax: 139 80 5478537.

Crohn’s disease (CD) and ulcerative colitis (UC) are idiopathic inflammatory bowel diseases (IBD)

0167-7012 / 98 / $19.00  1998 Elsevier Science B.V. All rights reserved. PII: S0167-7012( 98 )00036-0

106

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

characterized by a chronical granulomatous inflammation that commonly involves the gastrointestinal tract (Crohn et al., 1932). A wide variety of infectious agents have been suggested in the etiopathogenesis of CD and UC (Burnham et al., 1978; Wakefield et al., 1992, 1993). In particular, M. paratuberculosis recognized as the agent of Johne’s disease, a chronic bowel disease in dairy cattle and domestic ruminants, has been taken into consideration because of the histopathologic similarities shown by these diseases (Morgan, 1987). However, although the association between mycobacteria and IBD has been suspected for many years (Dalziel, 1913; Hampson et al., 1988), the detection of M. paratuberculosis as either a whole bacterium or spheroplast-like form in tissue samples from diseased patients by routine culture techniques is difficult and time-consuming (Chiodini et al., 1986; Gitnick et al., 1989). On the other hand, M. paratuberculosis has been only recently identified either in biopsies or surgically resected human intestinal tissues from diseased patients by molecular biology techniques such as DNA probes (Moss et al., 1991; McFadden et al., 1987) and polymerase chain reaction (PCR) with conflicting results (Quirke et al., 1991; Rosemberg et al., 1991; Sanderson and Hermon-Taylor, 1992; Dell’Isola et al., 1994; Suenaga et al., 1995; Wall et al., 1993; Wu et al., 1991). Paratuberculosis (Johne’s disease), being a chronic intestinal granulomatosis infection of ruminants characterized by the multiplication of M. paratuberculosis within macrophages in the intestinal mucosa (Chiodini et al., 1984; Cocito et al., 1994), it has been demonstrated that clinically infected animals may shed organisms during the disease and, consequently, it is possible to detect M. paratuberculosis by PCR in feces of bovine (van der Giessen et al., 1992). The notion that infective bacilli are excreted in the stool with the possibility of their detection by a sensitive, specific and rapid method could be of great help for the study of factors implicated in the etiopathogenesis of IBD. With this aim we have searched for M. paratuberculosis DNA in feces from patients with IBD by PCR and non-isotopic DNA hybridization, which to our knowledge has not been previously reported. We have therefore evaluated the use of DNA sequence from insertion sequence IS900 (Green et al., 1989) for both direct detection and

specific identification of M. paratuberculosis in human fecal samples by PCR. The purposes of the present study are: (i) to determine the sensitivity and specificity of the one-step PCR and the extraction method for detection of M. paratuberculosis genomic DNA (IS900), and (ii) to compare the relative performance of colorimetric and electrophoretic detection of PCR products.

2. Materials and methods

2.1. Reagents All reagents were purchased from Sigma Chemical Co., USA, unless otherwise specified.

2.2. Bacterial strains M. paratuberculosis strain (ATCC 19698) was used. Bacteria were cultured aerobically at 358C on Lowenstein-Jensen solid medium (Becton-Dickinson Microbiology Systems, Cockeysville, MD, USA) supplemented with 1 m g / ml of mycobactin J (Collins et al., 1985). Mycobacteria were harvested by centrifugation, suspended in 1 ml of sterile phosphate buffered saline (PBS), and stored at 2808C until their use.

2.3. Patients and stool specimens Consecutive stool samples were collected during the clinically active disease in sterile containers from patients hospitalized at the IRCCS Scientific Institute for Digestive Diseases ‘S. de Bellis’ Castellana Grotte, Bari, Italy, and immediately stored at 2208C. Then specimens were transported to the Laboratory of Microbiology of the Department of Clinical Medicine, Immunology and Infectious Diseases, University of Bari, where half of them were processed by microbiological methods within 2 h after arrival, and the remainder were used for the PCR. A total of 100 stool samples, 32 from patients affected by CD and 27 from patients with UC, 30 from healthy subjects with neither history nor symptoms of IBD, 11 samples from patients affected by nonspecific gastrointestinal diseases (five with irritable bowel syndrome, two with colon diverticulitis, two

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

with colon polyps and two with colon cancer) were submitted to the traditional culture technique and PCR for the detection of IS900 DNA. Diagnosis of CD and UC was established on the basis of clinical, radiological, endoscopical, and histopathological characteristics. No patient was taking antimycobacterial or other antibacterial chemotherapy at the time of stool sampling. Gender, age and gastrointestinal diseases for each group of patients are shown in Table 1.

2.4. Culture of bacteria from fecal samples Cultures were performed as follows. One gram of feces was suspended in 2 ml of sterile PBS, pH 7.2, and shaken for 10 min at room temperature. Samples were left at room temperature for 30 min and then centrifuged at 28003g for 1 min to deposit the relatively large and insoluble particulate matter. The supernatant was removed, transferred to a new tube, and centrifuged at 30003g for 5 min. After centrifugation the supernatant was eliminated and the pellet was homogenized with 6% (w / v) 1 M NaOH. The sample was then mixed with 1 ml of 10% (w / v) hexadecyltrimethyl ammonium bromide (CTAB) and shaken vigorously. After incubation at 358C for 1 h with occasional mixing by inverting the tube, the resulting mixture was neutralized with 4% (w / v) 1 N H 2 SO 4 . Finally, material was inoculated into Lowenstein-Jensen solid medium supplemented with 1 m g / ml of mycobactin J and cultured as described before. All samples were cultured in duplicate and examined for visible colonies daily for 1 week and then weekly for up to 12 weeks and the relative growth scored.

2.5. Identification of mycobacteria isolated from fecal samples Isolates growing on Lowenstein-Jensen medium were presumptively identified as M. paratuberculosis on the basis of their slow growth, mycobactin J dependency, strong acid-fast staining (by Ziehl-Neelsen staining), colonial morphology and distinct rod morphology (Vestal, 1981). In order to identify the isolates, bacteria collected from culture were treated as below and the ex-

107

tracted DNA was used for PCR-IS900 and nonisotopic hybridization assay.

2.6. Genomic DNA extraction from M. paratuberculosis cultures Genomic DNA was extracted from the mycobacterial strains by the method described by van Soolingen et al. (1991) with minor modifications. Bacterial cells were pelleted from the culture by centrifugation at 28503g (ALC 4227 Refrigerated Centrifuge) for 10 min and lysed by the standard lysis solution TE buffer (10 mM Tris–HCl, 1 mM EDTA pH 8.0) containing lysozyme (5 mg / ml). After incubation at 378C for 1 h, sodium dodecyl sulfate (SDS; 5%) and proteinase K (10 mg / ml) were added, and the mixture was incubated at 558C for 3 h. Then, sodium chloride and CTAB at final concentration of 0.73% and 0.57 M, respectively, were added to the lysed specimens. Tubes were briefly vortexed and incubated for 10 min. After centrifugation at 14 0003g for 5 min, DNA was extracted and purified from bacteria by the nucleic acid extraction protocol of the IsoQuick TM kit (ORCA Research, Bothell, WA, USA). Pellets were resuspended with 100 m l of sample buffer (Reagent A). After incubation for 5–10 min at room temperature, the cellular samples were lysed and stabilized by mixing equal volumes of the cell suspensions (100 m l) and 100 m l of lysis solution, a chaotrope solution containing 4 M guanidine thiocyanate, 25 mM sodium citrate, 0.5% Sarkosyl, (Reagent 1). Cells were mixed vigorously by vortexing until resuspended. These solutions were transferred to microcentrifuge tubes and, following the manufacturer’s protocol for rapid DNA extraction, the IsoQuick TM organic (non-phenolic) extraction reagent (Reagent 2) and the extraction buffer (Reagent 3) were added to the guanidinium lysate, vortexed, mixed and centrifuged. The upper aqueous phases were transferred to fresh tubes, and the sodium acetate reagent (Reagent 4) and isopropanol were added. The DNA was pelleted by centrifugation at 12 0003g for 10 min and washed with 70% ethanol. After removal of the ethanol by vacuum drying, DNA was dissolved in 100 m l of TE buffer.

108

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

2.7. Treatment of stool samples and genomic DNA extraction To recover the microbial cells, stool samples were homogenated and the bacterial fraction was separated by differential centrifugation according to the protocol described by Salyers et al. (1988). After thawing, |100 mg of solid stool or 200 m l of liquid fecal sample were suspended in 1.5 ml of sterile 50 mM sodium phosphate buffer (pH 7.5). The suspension was centrifuged at 28003g for 2 min to pellet large fecal debris. Five hundred m l of the supernatant were transferred to a new tube and centrifuged at 5003g to pellet the remainder particulate material. The supernatant fluid was saved, and the pellet was suspended in 500 m l of phosphate buffered saline (pH 7.8) and recentrifuged. The two supernatant fractions were combined and centrifuged at 14 0003 g to pellet bacteria. The bacterial pellet was suspended in 1 ml of sterile PBS. The mixture was centrifuged at 5003g, the pellet was discarded, and the supernatant fluid was centrifuged at 17003g. To obtain the nucleic acids, the bacterial pellet was suspended in 100 m l of lysis buffer (10 mM Tris– HCl, 1 mM EDTA pH 8.0), containing 100 m g of freshly prepared lysozyme and incubated for 1 h at 378C. Then 300 m l of a 50 mM NaCl solution supplemented with sodium dodecyl sulfate (SDS, 10% w / v) and 800 m g proteinase K were added to the sample and the incubation was continued at 558C for 3 h. Ten percent CTAB and 4 M NaCl were added separately to a final concentration of 1.25% CTAB and 0.45 M NaCl. After incubation at 568C for 30 min, the mixture was centrifuged at 14 0003g for 5 min and DNA was extracted and purified from the bacterial pellet by the nucleic acid extraction protocol of the IsoQuick TM rapid nucleic acid extraction kit. To verify the homogenization / DNA extraction procedure two control tubes, one without feces and the other with spiked feces, were included in each step of homogenization / DNA extraction procedure.

2.8. Primers and PCR reaction assay Twenty-five m l of the resulting DNA solution were used as template for PCR in a single-step amplification with primers described by Vary et al.

(1990) targeting the 59 region of IS900. Amplification of the IS900 gene target was conducted in a single 100 m l reaction volume containing DNA in 13 PCR buffer (10 mM Tris–HCl (pH 8.3), 50 mM KCl, 2 mM MgCl 2 , 100 m g of gelatin per ml, 5% glycerol), 200 m M (each) dATP, dCTP, dGTP, and dUTP, 2.5 U of AmpliTaq TM polymerase (PerkinElmer, Norwalk, CT, USA), 0.5 U of uracil-Nglycosylase (UNG, Perkin-Elmer), 50 pmol of each primer. The primer pairs IS900 / 150C (CCGCTAATTGAGAGATGCGATTGG) and IS900 / 921 (AATCAACTCCAGCGCGGCCTCG), synthesized by Sorin (Sorin Biomedica, Saluggia, Italy), were used to amplify a 229-base pair (bp) target sequence of IS900, the multiple copy (15–20) of insertion sequence of 1451 bp in the genome of M. paratuberculosis and highly specific for this microorganism (Green et al., 1989). The reaction mixtures were heated to 508C for 2 min and 958C for 5 min and were then subjected to 35 cycles of 948C for 1 min, 558C for 1 min and 728C for 1 min, and with a final extension at 728C for 10 min in a DNA thermal cycler (GeneAmp PCR System 9600; Perkin-Elmer). Stool samples were analysed by PCR in blinded fashion and run in duplicate with PCR mixture and water instead of genomic DNA as PCR negative control and a positive control tube containing 10 fg of M. paratuberculosis DNA. Stringent controls and severe precautions were taken to exclude the possible contamination among the samples.

2.9. Gel electrophoresis After amplification, 10 m l of the PCR product was mixed with 5 m l of layer mix (0.25% bromophenol blue and 0.25% xylene cyanol in 15% Ficoll Type 400) and run in 13 TAE buffer (103 TAE50.4 M Tris-acetate and 0.01 M EDTA) on a 2% agarose gel containing 5 m g ml 21 (final concentration) ethidium bromide. A sample was considered positive if a signal corresponding to an amplified product of the expected 229 bp fragment was seen under UV light on a 302 nm ultraviolet transilluminator (Pharmacia LKB, Biotechnology AB, Uppsala, Sweden). Bands of appropriate size were identified by comparison with DNA marker of known size (DNA molecularweight marker X, Boehringer Mannheim GmbH, W. Germany) (Sambrook et al., 1989).

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

2.10. PCR-DEIA hybridization assay The identification of the amplified DNA products was verified by hybridization technique using the non-radiometric ELISA-based detection of PCR-amplified DNA system DEIA (GEN-ETI-K, DNA enzyme immunoassay, Sorin Biomedica, Saluggia, Italy) (Mazza et al., 1991; Del Prete et al., 1997). The DEIA test was performed according to the manufacturer’s instructions. In this test 20 m l of the PCR products hybridized to the microtiter platebound biotinylated probe 25 nucleotide long oligonucleotide, located internal to the amplified DNA, with the sequence of a repeated unit (final concentration of the coated probe 0.5 ng /m l; IS PAR: 59 AGGTTGTGCCACAACCACCTCCGTA 39), synthesized by Sorin Biomedica and supplied along with the DEIA kit, were revealed by ELISA technology with a monoclonal antibody against double-stranded DNA. After the addition of the anti-double-stranded DNA antibody, enabling the detection of the hybridization event, and the peroxidase-labeled antimouse Ig antibody, the reaction was visualized by adding the chromogenic substrate tetramethylbenzidine derivate solution. After incubation in the dark at room temperature for 30 min, the reaction was stopped by adding 1 N sulphuric acid solution. The OD of the color reaction was read with a spectrophotometer (MR 580 MicroELISA Auto Reader; Dynatech Instruments, Santa Monica, CA, USA) at wavelength of 450 nm (A 450 ), with 620 nm as the reference wavelength (dual mode). The results were expressed in units of optical density (OD). In order to value the hybridization procedure, 20 m l of positive control (final concentration 2.5 ng /m l of mycobacterial complemental sequence of IS900: TACGGAGGTGGTTGTGGCACAACCT) and 20 m l of negative control, both supplied by the manufacturer

109

with the DEIA kit, were included in each batch of the clinical samples. Zero adjustment was done against a well containing everything except the PCR product. As suggested by the manufacturer, the OD cutoff values were calculated, for each experiment, as the mean of the two negative controls plus 0.15 A 450 , and were used to score positive DEIA tests. Samples were tested in duplicate with the same conditions and the data are the mean of the OD values.

3. Results

3.1. Clinical specimens Stool samples from 32 patients with CD, from 27 patients with UC, from 30 healthy individuals, and from 11 (nine with other intestinal diseases and two with colon cancer) were submitted for both M. paratuberculosis culture and IS900 PCR-DEIA detection. Acid-fast bacilli were identified microscopically in 14 of the long term cultures, originating from 100 patients’ fecal samples. Eight cultures were from CD feces, five from UC feces and one from colon cancer feces (Table 1).

3.2. Electrophoretic versus colorimetric ( DEIA) detection of PCR products The PCR amplification products from 32 CD patients’, 27 UC patients’ and 41 healthy individuals’ specimens were analyzed by gel electrophoresis as well as by the DEIA procedure. One hundred stool samples from patients previously tested by culture were analyzed by the IS900 PCR-DEIA approach in a blinded fashion. Of the 32 stool samples from patients with CD, 15 (46.8%) and nine

Table 1 Detection of Mycobacterium paratuberculosis in stool samples of patients with inflammatory bowel diseases. Characteristics of patients in each group and summary of culture and PCR results

Age range (years) Gender (M / F) Culture (6) IS900 PCR-DEIA (6) Total no. of patients

Crohn’s disease

Ulcerative colitis

Controls

18–66 13 / 19 8 / 24 15 / 17 32

26–77 13 / 14 5 / 22 9 / 18 27

20–70 20 / 21 1 / 40 1 / 40 41

110

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

(33.3%) of the 27 from patients with UC, had M. paratuberculosis DNA (Table 1). Among the 41 negative control samples, one from a patient with colon cancer was positive (Table 1). All samples positive by DEIA were also positive by gel electrophoresis, but not vice versa. In fact in five cases of CD, while the gel electrophoresis gave negative results, the DEIA test was positive. The intensity of the color reaction obtained by DEIA was significantly higher for positive samples than their negative counterparts. The colorimetric signal distribution among the samples showed high values for the 25 PCR positive samples, ranged from 0.32 to 1.5 A 450 , while the signals for the 75 negative samples ranged between 0.02 to 0.08 A 450 (Fig. 1). The color reaction was sufficiently distinct to enable visual differentiation between positive and negative results. All PCR negative control reactions were negative whereas M. paratuberculosis positive controls were positive. Moreover no amplification products were detected with DNA from the other Mycobacterium species.

3.3. Sensitivity, specificity and detection limits of PCR-DEIA assay To determine the sensitivity of the combined PCRDEIA assay, 100 mg of feces (culture and PCRnegative specimen of the control group) were spiked with 10-fold serial dilutions from a culture of M. paratuberculosis (ATCC 19698) in sterile PBS pH 7.2 corresponding to 10 8 to 1 bacteria suspension in which the number of bacilli per ml had been determined by microscopic counting according to Sheppard and McRae (1968). The stool samples were subjected to DNA extraction and PCR assay as described above. After 35 cycles of PCR amplification, visual observation of an ethidium bromidestained gel agarose revealed a positive signal up to 10 3 bacilli per 100 mg of feces. In the DEIA assay, however, 10 2 bacilli / 100 mg feces still gave OD values higher than the cutoff values calculated in each experiment. It is known that accurate counting of mycobacteria is often difficult, and it is possible that fewer than 10 2 bacilli might be detected. The detection limits correspond to the highest dilution (lowest amount of DNA or mycobacteria) giving a positive result in the experiments. Discordant results

Fig. 1. Detection by DEIA of PCR-amplified products of Mycobacterium paratuberculosis DNA from fecal samples. Dashed line, cutoff for PCR-DEIA positivity; d, mean values of duplicate samples.

obtained with lower amounts of DNA or mycobacteria were considered as not valid. Moreover, to assess the efficiency of DNA extraction and to verify the absence of inhibitors, fecal samples spiked with 10-fold serial dilutions of a purified M. paratuberculosis chromosomial DNA extracted as before from the bacterial culture were subjected to PCR. M. paratuberculosis DNA concentration was determined by comparison with standard DNA solutions of known concentration on an ethidium bromide stained agarose-gel and by optical density analysis at OD 260 nm; 5 fg DNA was considered as equivalent to one M. paratuberculosis genome (Sanderson et al.,

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

1992). The PCR was then performed over a range of 1 ng to 10 fg to calculate the detection limit imposed by the DNA quantity. The DNA probe of DEIA in conjunction with IS900 PCR amplification technique detected as little as 10 fg of the M. paratuberculosis DNA, equivalent to two mycobacterial genomes. In this case the result of the DEIA was very low (0.350 A 450 ) (Fig. 1). The specificity of the designed single stranded oligonucleotide probe had been previously tested by others (Vary et al., 1990) and was further confirmed in our experiments. There was no signal observed when the amplification products were analyzed on agarose-gel electrophoresis and the results of the DEIA test confirmed that the probe had only identified M. paratuberculosis DNA from among the different mycobacterial species we have tested (M. tuberculosis /M. bovis, M. africanum, M. avium /M. intracellulare) (data not shown). The negative control sample (PCR mixture reaction constituents and water instead of genomic DNA) was performed along with the samples containing DNA and there were no signals when the amplification products were electrophorized on gel agarose and the OD values of the DEIA test were lower than cutoff values. DNA extraction, PCR amplification and DEIA test were carried out in duplicate, and a reaction was recorded as positive or negative only if both results agreed. In equivocal cases the PCR was repeated; if still equivocal, the DNA extraction, PCR and DEIA test were repeated on aliquots of the original sample. Once the samples were classified as positive or negative by PCR-DEIA test, the results were compared with those of culture.

3.4. Precautions to prevent contamination To prevent ‘carry-over’ contamination and to avoid false-positive results the following standard recommendations were carried out and extensive precautions in PCR work were taken. Uracil-Nglycosilase (UNG) enzyme was used to excise uracil from any contaminating dU-containing PCR products from previous amplification reactions (Longo et al., 1990). DNA extraction, PCR mixture preparation, and post-PCR analysis were carried out in separate rooms with dedicated equipment for each area. The rooms were irradiated daily with UV light. The

111

extraction step was carried out under a hood cleaned with 10% hypochloride. The preparation of the stocks of the individual components of the PCR mixtures was carried out in a class II type A laminar flow cabinet (GELAIRE, BSB-4A, Flow Laboratories VA, USA) by using filter-protected tips (RAININ Instruments, Woburn, MA, USA). Furthermore, positive-displacement pipettors (GILSON, Villiersle-Bel, France) were used when pipetting DNA. The precautions included also ultraviolet irradiation of PCR buffer for 3 min at 312 nm before the primers and DNA were added and, after utilization, pipettes, surfaces and other apparatus were cleaned with 10% hypochlorite solution.

4. Discussion This study demonstrates the detection of M. paratuberculosis by IS900-based PCR in fecal samples of patients with IBD. Although M. paratuberculosis has been detected by PCR from resection and biopsy specimens of the large intestine from patients with CD and UC (Moss et al., 1991; Dell’Isola et al., 1994) to the best of our knowledge, this is the first time the organism has been detected in human fecal samples. The presence of M. paratuberculosis in feces is in agreement with the intracellular nature of the organism which survives within macrophages of the intestinal mucosa, where M. paratuberculosis does multiply. On the other hand, the isolation of M. paratuberculosis from feces of ruminants affected by Johne’s disease has been already demonstrated (van der Giessen et al., 1992). In this case M. paratuberculosis multiplies within the macrophages of the gastrointestinal tract and the associated lymphoid tissue in the ruminants with Johne’s disease that excrete increasing quantities of bacilli in correlation with the acute phase of the disease (Cocito et al., 1994). The observation that sequences hybridizing with M. paratuberculosis DNA probes detected in DNA extracted from feces of diseased patients rather than from non-IBD controls makes it unlikely that they may represent DNA from bacterial contaminants in the intestinal lumen. Finally, although one cannot preclude the possibility that DNA detected in the feces could have originated from dead bacteria

112

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

released into the intestinal lumen following macrophage lysis as a result of the immune response to the infection, this would mean that mycobacteria, although not viable, are present only in feces from diseased patients. The innovations we have introduced in the detection of M. paratuberculosis DNA include: (i) the use of feces as clinical samples; (ii) a simple DNA extraction method; and (iii) a solid phase nonradiometric detection of amplification products. Previously, M. paratuberculosis DNA has been detected in resection and biopsy specimens of large intestine from patients affected by CD and UC (Sanderson et al., 1992; Dell’Isola et al., 1994). Normally, feces are considered not suitable for the performance of PCR reaction due to the presence of high concentration of inhibitors such as bile salts, bilirubin, urobilinogens, polysaccharides, and large amounts of irrelevant DNA (Wilde et al., 1990; Jiang et al., 1992). Moreover, PCR detection of bacteria in fecal specimens from humans or animals has been considered relatively laborious and insensitive. In the present study, we have used a simple procedure that removes PCR inhibitors while efficiently releases M. paratuberculosis DNA from stool specimens for subsequent amplification. This method is based on the nucleic acid-binding properties of a matrix in the presence of guanidinium thiocyanate (GuSCN), that had previously been demonstrated as an agent with strong nuclease-inactivating properties (Boom et al., 1990). Moreover, the purification of nucleic acids through binding to silica particles in the presence of chaotropic agents and the subsequent elution in lowionic strength buffer is a widely known procedure (Boom et al., 1990). In order to overcome the possible inhibition of the PCR amplification by feces, CTAB, a cationic detergent, was added to the lysing buffer. This detergent, used for the precipitation / purification of DNA by both the disruption of cell membranes and the denaturation of proteins (Saluz and Jost, 1989), removes effectively PCRinhibiting factors from stool (Gumerlock et al., 1990; Mapstone et al., 1993). Our detection of IS900 DNA of M. paratuberculosis in stool samples from patients with IBD, though not conclusive, is in agreement with other studies (Dell’Isola et al., 1994; Moss et al., 1991; Quirke et al., 1991; Sanderson et al., 1992) where the etiological role for a mycobacterium had been

confirmed. However, it should be ascertained whether M. paratuberculosis alone is sufficient or are other stimuli needed (e.g. immunological and environmental) to determine CD and UC. The presence of M. paratuberculosis in the stool of a patient with colon cancer might be due to a previously unsuspected alimentary prevalence in humans (Sanderson et al., 1992). Alternatively, we could consider the colon cancer as a compliance of previous IBD. The detection of PCR-positive result among culture negative samples is due to the fact that as the PCR technique is much more sensitive than culture, the result might reflect a substantial false negative rate associated with fecal culture. In fact, the data reported in this work suggest that the simple PCR reaction followed by a probe hybridization in an ELISA-like detection system described is slightly more sensitive than culture to detect M. paratuberculosis in clinical samples. In our hands, PCR test had a sensitivity greater than that obtained by standard culture techniques and was much more rapid, taking only hours in comparison with 8–12 weeks for culture. Furthermore, a combination of direct screening with PCR and DNA detection by a probe hybridization in a colorimetric system offers the opportunity to identify M. paratuberculosis in the clinical samples within a very short time and without sophisticated technology. The detection of amplicon by hybridization being rapid, easy, and not requiring the use of radioisotopes, the assay can be adapted to a large variety of clinical samples and is feasible in the clinical microbiology laboratory. In our study we chose the repetitive insertion sequence IS900 of M. paratuberculosis instead of the 16S rRNA as target because PCR performed with primers designed to amplify a sequence from IS900 of M. paratuberculosis is 10–100 times more sensitive than that observed with primers targeting the singlecopy of 16S rRNA gene (Dumonceau et al., 1996). Moreover, IS900-PCR is capable of distinguishing M. paratuberculosis from even the very closely related common environmental organisms of the M. avium complex (Sanderson et al., 1992; Vary et al., 1990). Our results confirm that IS900 DNA can be detected with high sensitivity and specificity by PCR and a simple ELISA-like detection method from feces of patients with CD and UC; it represents a source of highly specific DNA sequences that may be used both as a target and a DNA probe coated in

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

the microwell plate for specific detection of PCR products. The wide range among the ODs of the positive controls (mycobacterial complemental sequence of IS900), the PCR positive samples (feces spiked by M. paratuberculosis bacteria and DNA) and stool samples observed in the DEIA test reflect the broad variation of bacterial IS900 DNA loads in the different samples. The ODs are related to the initial amount of genome equivalent of the M. paratuberculosis IS900 DNA in a colorimetric system, in which the PCR products are captured by a biotinylated probe coated in the microwell. Normally, there is a marked variation in OD values when the amplification products from clinical samples are analyzed by the colorimetric method. In addition, DEIA results might be affected by either a few inhibitors present in the fecal samples or the efficiency of the extraction protocol used in the study. Although the results of the present study do not conclusively assess the specific relationship between M. paratuberculosis and IBD, they demonstrate the feasibility of revealing the presence of the mycobacteria with a simple, non-invasive and rapid test performed on the stool samples without the necessity of biopsies or surgical tissues. PCR technique, by providing investigators with a means of studying the epidemiological investigation, might help to determine the true incidence of M. paratuberculosis infections and, consequently, its possible association with IBD. Finally, according to other authors (Picciotto et al., 1988; Schultz et al., 1987; Warren et al., 1986), on the basis of etiologically ascertained cases of IBD, an antimycobacterial chemotherapy (alone or along with combination) might be carried out.

Acknowledgements The research described was in part supported by Ministero dell’Universita` e della Ricerca Scientifica (MURST), QUOTA 60%, Italy.

References Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., van der Noordaa, J., 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495–503.

113

Burnham, W.R., LennardJones, J.E., Stanford, J.L., Bird, R.G., 1978. Mycobacteria as a possible cause of inflammatory bowel disease. Lancet 1, 693–696. Chiodini, R.J., van Kruningen, H.J., Merkal, R.S., 1984. Ruminant paratuberculosis (Johne’s disease). The current status and future prospects. Cornell Vet. 74, 218–262. Chiodini, R.J., Van Kruiningen, H.J., Thayer, W.R., Coutu, J.A., 1986. Spheroplastic phase of mycobacteria isolated from patients with Crohn’s disease. J. Clin. Microbiol. 24, 357–363. Cocito, C., Gilot, P., Coene, M., De Kesel, M., Poupart, P., Vannuffel, P., 1994. Paratuberculosis. Clin. Microbiol. Rev. 7, 328–345. Collins, C.H., Grange, J.M., Yates, M.D., 1985. Organization and practice in tuberculosis bacteriology. Butterworth, London. Crohn, B., Ginzberg, L., Oppenheimer, G.D., 1932. Regional ileitis, a pathological and clinical entity. J. Am. Med. Assoc. 99, 1323–1329. Dalziel, T.K., 1913. Chronic interstitial enteritis. Br. Med. J. 2, 1068–1070. Dell’Isola, B., Poyart, C., Goulet, O., Mougenot, F.J., SadounJourno, E., Brousse, N., Schmitz, J., Ricour, C., Berche, P., 1994. Detection of Mycobacterium paratuberculosis by polymerase chain reaction in children with Crohn’s disease. J. Infect. Dis. 169, 449–451. Del Prete, R., Mosca, A., D’Alagni, M., Sabato, R., Picca, V., Miragliotta, G., 1997. Detection of Mycobacterium tuberculosis DNA in blood of patients with acute pulmonary tuberculosis by polymerase chain reaction and non-isotopic hybridisation assay. J. Med. Microbiol. 46, 495–500. Dumonceau, J.M., Van Gossum, A., Adler, M., Fonteyne, P.A., Van Vooren, J.P., Deviere, J., Portaels, F., 1996. No Mycobacterium paratuberculosis found in Crohn’s disease using the polymerase chain reaction. Dig. Dis. Sci. 41, 421–426. Gitnick, G., Collins, J., Beaman, B., Brooks, D., Arthur, M., Imaeda, T., Palieschesky, M., 1989. Preliminary report on isolation of Mycobacteria from patients with Crohn’s disease. Dig. Dis. Sci. 6, 925–932. Green, E.P., Tizard, M.L.V., Moss, M.T., Thompson, J., Winterbourne, D.J., McFadden, J.J., Hermon-Taylor, J., 1989. Sequence and characteristics of IS900, an insertion element identified in a human Crohn’s disease isolate of Mycobacterium paratuberculosis. Nucl. Acids Res. 17, 9063–9073. Gumerlock, P.H., Tang, Y.J., Meyers, F.J., Silvia, J., 1990. Use of the polymerase chain reaction for the specific and direct detection of Clostridium difficile in human feces. Rev. Infect. Dis. 13, 1053–1060. Hampson, S.J., McFadden, J.J., Hermon-Taylor, J., 1988. Mycobacteria and Crohn’s disease. Gut 29, 1017–1019. Jiang, X., Wang, J., Graham, D.Y., Estes, M.K., 1992. Detection of Norwalk virus in stool by polymerase chain reaction. J. Clin. Microbiol. 30, 2529–2534. Longo, M.C., Berninger, M.S., Hartley, J.L., 1990. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93, 125–128. Mapstone, N.P., Lynch, D.A.F., Lewis, F.A., Axon, A.T.R., Tompkins, D.S., Dixon, M.F., Quirke, P., 1993. PCR identification of Helicobacter pylori in faeces from gastritis patients. Lancet 341, 447. Mazza, C., Mantero, G., Primi, D., 1991. DNA enzyme immuno-

114

R. Del Prete et al. / Journal of Microbiological Methods 33 (1998) 105 – 114

assay: a rapid and convenient colorimetric method for diagnosis of cystic fibrosis. Mol. Cell. Probes 5, 459–466. McFadden, J.J., Butcher, P.D., Chiodini, R., Hermon-Taylor, J., 1987. Crohn’s disease-isolated mycobacteria are identical to Mycobacterium paratuberculosis, as determined by DNA probes that distinguish between mycobacterial species. J. Clin. Microbiol. 25, 796–801. Morgan, K.L., 1987. Johne’s and Crohn’s. Chronic inflammatory bowel diseases of infectious aetiology? Lancet 2, 1017–1018. Moss, M.T., Green, E.P., Tizard, M.L., Malik, Z.P., HermonTaylor, J., 1991. Specific detection of Mycobacterium paratuberculosis by DNA hybridization with a fragment of the insertion element IS900. Gut 32, 395–398. Picciotto, A., Gesu, G.P., Schito, G.C., Testa, R., Varagona, G., Celle, G., 1988. Antimycobacterial chemotherapy in two cases of inflammatory bowel disease. Lancet 2, 536–537. Quirke, P., Dockey, D., Taylor, G.R., Lewis, F.A., Hawkey, P., Graham, D., 1991. Detection of Mycobacterium paratuberculosis in inflammatory bowel disease. Gut 32, A572. Rosemberg, W.M.C., Bell, J.I., Jewell, D.P., 1991. Mycobacterium paratuberculosis DNA cannot be detected in Crohn’s disease tissues. Gastroenterology 100, A611. Saluz, H., Jost, J.P., 1989. A simple high-resolution procedure to study DNA methylation and in vivo DNA-protein interactions on a single-copy gene level in higher eukaryotes. Proc. Natl. Acad. Sci. USA 86, 2602–2606. Salyers, A.A., Pajeau, M., McCarthy, R.E., 1988. Importance of mucopolysaccharides as substrates for Bacteroides thetaiotaomicron growing in intestinal tracts of exgermfree mice. Appl. Environ. Microbiol. 54, 1970–1976. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory, Cold Spring Harbour, NY. Sanderson, J.D., Moss, M.T., Tizard, M.L.V., Hermon-Taylor, J., 1992. Mycobacterium paratuberculosis DNA in Crohn’s disease tissue. Gut 33, 890–896. Sanderson, J.D., Hermon-Taylor, J., 1992. Mycobacterial diseases of the gut: some impact from molecular biology. Gut 33, 145–147. Schultz, M.G., Reider, H.L., Hersh, T., Riepe, S., 1987. Remission of Crohn’s disease with antimycobacterial chemotherapy. Lancet 2, 1391. Sheppard, C.C., McRae, D.H., 1968. A method for counting acid-fast bacteria. Int. J. Lepr. 36, 78–82. Suenaga, K., Yokoyama, Y., Okazaki, K., Yamamoto, Y., 1995. Mycobacteria in the intestine of Japanese patients with inflammatory bowel disease. Am. J. Gastroenterol. 90, 76–80.

van der Giessen, J.W.B., Haring, R.M., Vauclare, E., Eger, A., Haagsma, J., van der Zeijst, B.A.M., 1992. Evaluation of the abilities of three diagnostic tests based on the polymerase chain reaction to detect Mycobacterium paratuberculosis in cattle: application in a control program. J. Clin. Microbiol. 30, 1216– 1219. van Soolingen, D., Hermans, P.W.M., De Haas, P.E.W., Soll, D.R., van Embden, J.D.A., 1991. Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis. J. Clin. Microbiol. 29, 2578–2586. Vary, P.H., Andersen, P.R., Green, E., Hermon-Taylor, J., McFadden, J.J., 1990. Use of highly specific DNA probes and the polymerase chain reaction to detect Mycobacterium paratuberculosis in Johne’s disease. J. Clin. Microbiol. 28, 933–937. Vestal, A.L., 1981. Procedures for the isolation and identification of mycobacteria. US Department of Health and Human Services, Center for Diseases Control, Laboratory Improvement Program, Atlanta, GA, USA. Wakefield, A.J., Pittilo, R.M., Sim, R., Cosby, S.L., Stephenson, J.R., Dhillon, A.P., Pounder, R.E., 1993. Evidence of persistent measles virus infection in Crohn’s disease. J. Med. Virol. 39, 345–353. Wakefield, A.J., Fox, J.D., Sawyerr, A.M., Taylor, J.E., Sweenie, C.H., Smith, M., Emery, V.C., Hudson, M., Tedder, R.S., Pounder, R.E., 1992. Detection of Herpesvirus DNA in the large intestine of patients with ulcerative colitis and Crohn’s disease using the nested polymerase chain reaction. J. Med. Virol. 38, 183–190. Wall, S., Kunze, Z.M., Saboor, S., Soufleri, I., Seechurn, P., Chiodini, R., McFadden, J.J., 1993. Identification of spheroplast-like agents isolated from tissues of patients with Crohn’s disease and control tissues by polymerase chain reaction. J. Clin. Microbiol. 31, 1241–1245. Warren, J.B., Rees, H.C., Cox, T.M., 1986. Remission of Crohn’s disease with tuberculous chemotherapy. N. Engl. J. Med. 314, 182. Wilde, J., Eiden, J., Yolken, R., 1990. Removal of inhibitory substances from fecal specimens for detection of group A rotavirus by reverse transcriptase and polymerase chain reaction. J. Clin. Microbiol. 28, 1300–1307. Wu, S.W.P., Pao, C.C., Chan, J., Benedic Yen, T.S., 1991. Lack of mycobacterial DNA in Crohn’s disease tissue. Lancet 337, 174–175.