DETECTION OF PSP94 AND ITS SPECIFIC BINDING SITES IN THE PROSTATE ADENOCARCINOMA CELL LINE LNCaP

0022-5347/98/1606-2240$03.00/0 THE JOLWAL OF UROLOGY Copyright 0 1998 by AMERICA?? UROLOCICAL ASSOCLATION, IYC.

Vol. 160, 2240-2244, December 1998 Printed in U S A .

DETECTION OF PSP94 AND ITS SPECIFIC BINDING SITES IN THE PROSTATE ADENOCARCINOMA CELL LINE LNCaP JING-PING YANG,* MALCOLM A. FINKELMAN

AND

MICHAEL W. CLARKE

From the Department of Microbiology and Immunology, University of Western Ontario, and Procyort Biopharnla, b l c . , Lorldon, Ontario, Canada

ABSTRACT

Purpose: To evaluate the expression of prostate secretory protein of 94 amino acids (PSP94) and PSP94 binding proteins in the LNCaP cell line. Materials and Methods: The reverse-transcription polymerase chain reaction (RT-PCR) and Southern blot hybridization were employed to assay the expression of PSP94. Immunoprecipitation with specific polyclonal antibodies was used t o detect PSP94 secreted by the LNCaP cells. The binding proteins were assayed by equilibrium binding assays. Results: PSP94 was expressed and secreted in the LNCaP cells. AS well as, LNCaP cells expressed surface membrane proteins capable of binding PSP94 in a specific and saturable manner. Exposure of LNCaP cells to exogenous PSP94 resulted in the up-regulation of PSP94 binding sites, indicating functional interactions for PSP94 and its receptor in this cell line. Conclusion: The expression of PSP94 and its receptors may be partially regulated by an autocrine pathway in the LNCaP cell line. KEY WORDS:PSP94, PSP94 receptor, LNCap cells, prostate, autocrine

Carcinoma of the prostate now constitutes a major and escalating international health problem. In many developed countries, prostate cancer is the most commonly diagnosed malignancy in men, and seems poised to overtake lung cancer as the major cause of cancer mortality.' The etiology of prostate cancer is essentially not understood. It is becoming clear, however, that major determinants of the malignant or hyperplastic phenotype are various growth-stimulatory or inhibitory factors and their receptors, whose inappropriate expression or loss disrupts normal regulation of cell proliferation and differentiation.2 The eventual definition of autocrine, paracrine and endocrine pathways of growth regulation in the human prostate will facilitate the design of new preventive, diagnostic, and therapeutic strategies. Prostate secretory protein of 94 amino acids (PSP94) has been reported under name of P-inhibin, prostatic inhibin peptide (PIP) and P-microseminoprotein (P-MSP). It is a small cysteine-rich protein and constitutes one of the three predominant proteins found in human seminal fluid.3 The complete amino acid sequence of this protein has already been determined.4-6 Further, the cDNA and gene for PSP94 have been cloned and ~haracterized.~.a Immunochemical and in situ hybridization techniques have shown that PSP94 is located predominantly in prostatic epithelial cells. It is also present, however, in a variety of other secretory epithelia.9-13 Although the molecular structure and tissue distribution is known, very little data on the regulation and physiological function of PSP94 have been reported. Several observations point to a possible in vitro model for the study of PSP94 function. PSP94 has been shown t o be expressed in the prostate adenocarcinoma cell line, LNCaP.14 As well, an inhibitory effect of exogenous PSP94 on tumor cell growth has been observed both in vitro and in vivo.lS.lfiThese data suggested PSP94 could be a negative regulator for prostate carcinoma growth via interaction with cognate receptors on tumor cells.

In this paper, we present data showing the existence of both PSP94 and its binding sites on the LNCaP cells, suggesting the presence of a n autocrine regulatory loop involving PSP94 in this line. MATERIALS AND METHODS

Materials a n d cell culture. Prostate adenocarcinoma cell line LNCaP. FGC was purchased from the American Cell Type Collection. RPMI 1640 medium and fetal bovine serum (FBS) were purchased from Gibco BRL. Cells were routinely maintained in RPMI 1640 medium, containing 10% FBS, 1% penicillin and streptomycin, and subcultured every 5-7 days. Membrane tubes (mol wt cutoff 3,500-8,000) were obtained from Spectrum Medical Industries Inc. Protein A-sephrose CL-4b and protein molecular weight standards were from Bio-Rad. T r a n ~ ~ ~ S - l a b e lmethioninekysteine led and DMEM methionine-free medium were from ICN Radiochemical. FBS (100 ml.) was further dialysed against 20 mM HEPES buffer, containing 0.9% NaC1, pH 7.0, at 4C, with three changes of the buffer, over a period of 24 hours. The dialysed serum was filter sterilized and then heated inactivated at 56C for 30 min. The treated serum was used in the labelling process. RT-PCR a n d Southern blot hybridization assay for messenger RNA of PSP94. The presence of PSP94 mRNA in LNCaP cells was investigated using RT-PCR combining hybridization analysis. Cells, grown to 80% confluence in the cell culture dishes (56 cm.', Nunc), were lysed directly in the dishes in 6 ml. TRIzol reagent (Gibco BRL). Total RNA was extracted from LNCaP cells according to the manufacture's protocol. Absorbence at 260 and 280 nm. was measured for calculating the concentration and quality of extracted total RNA. Integrity was assessed by electrophoresis on formaldehyde-denaturing agarose gel. Approximately 1.5 pg. total RNA was used for each RT-PCR reaction. Two oligonucleotide primers for directing the RT-PCR reaction were synAccepted for publication June 29, 1998. thesized by Procyon Biopharma Inc. London, Canada. * Requests for reprints: Department of Microbiology and Immunology, University of Western Ontario, London, Ontario, Canada Primer-A (TTACTGATAGGCTAGGCTAC)is complementary to a sequence near the poly-A tail of the sense strand of N6A 5C1. Supported by Procyon Biopharma Inc.. London, Canada, and the PSP94 D N A . Primer-B (TGCTTATCACAATGTT)is the first Natural Sciences and Engineering Research Council of Canada. 20 nucleotides of PSP94 cDNA sequence. First strand cDNA 2240

224 1

PSP94 AND PSP94 RECEPTORS IN LNCaP CELLS

synthesis was directed with 100 pmol Primer-A, Expand transcriptase (Boehringer Mannheim) in a 50 mM tris-HC1 buffer, pH 8.3, containing 1.5 mM MgCl,, 71 mM KCl, 10 mM DTT, 0.5 mM dNTP mix, and incubated at 42C for 60 minutes. The reaction mixture was heated at 95C for 2 minutes and cooled immediately on ice. The PCR reaction was performed in l x PCR reaction buffer, with 0.2 mM dNTP, 0.75 mM MgCl,, 100 pmol each primer and 2.5 units of Taq DNA polymerase (Pharmacia Biotech). The cycle was 94C 45 seconds, 65C 30 seconds, 72C 1 minute for 25 cycles. The amplification products were then electrophoresed on 1.5% agarose gels, photographed under UV illumination, and electrotransferred onto PVDF membrane. For Southern hybridization experiments, human PSP94 cDNA was labelled with DIG following the procedure in the DIG-labelling Kit (Boehringer Mannheim) and used as a probe. Hybridization procedures followed according to the manufacturer's instructions. Briefly, the blots were prehybridized for 1hour at 42C and then hyridized with labelled probe overnight a t 42C. Blots were washed twice in 2 X SSC and 0.1% SDS a t room temperature for 15 minutes and once in 0.1 X SSC and 0.1% SDS at 65C for 15 minutes, quantified with a phosphorImager, and exposed to X-ray film. Immunoprecipitation assay for PSP94 secretion. The immunoprecipitation assay followed a procedure described prev i ~ u s l with y ~ ~minor modifications. For 3"S-methionine labelling, subcultured cells were grown for 2-3 days, maintained in methionine free-medium containing 2% dialysed FBS for 30 minutes at 37C. 35S-labelled methionine was added at final concentration of 85 pci 35S-methionine/ml. medium and incubated for a n additional 12 hours. Conditioned media, containing protein secreted by about 1 x lo6 cells, was used for immunoprecipitation with rabbit anti-PSF'94 serum. Five microliters of rabbit polyclonal anti-PSP94 antiserum, which could precipitate 35S-PSP94 from up to 250 p1. total cell lysate, were mixed with 30 p1. of protein A-sepharose (suspended in HEPES-saline, pH 7.0, with 1 : l ratio) and incubated at room temperature for 30 minutes. After incubation and centrifugation, protein A-sepharose pellets were rinsed with HEPES-saline three times and then mixed with conditioned or control media respectively, followed by incubation at 4C overnight. ARer washing once with 1ml. of 1 M NaCl, 1%nonidet P-40, twice with 1 ml. 20 mM HEPES, pH 7.2, containing 0.15 M NaC1,0.5% deoxycholate, 1% nonidet P-40, 0.1% SDS, and 2 mM orthovanadate, the immunoprecipitate was dissolved in SDS-sample buffer and boiling for 4 minutes. The supernatant was electrophoresed on 15% SDS-polyacrylamide gels followed by treatment with autoradiography-enhancer,Fluoro-Hance, before fluorograPhY. Cloning of PSP94 cDNA. A PCR-based cDNA cloning strategy was followed to clone the human PSP94 cDNA.18 Total RNA from surgical specimens of normal human prostate tissue was extracted and used as the template for the first strand cDNA synthesis. Sense and antisense primers were designed according to the cDNA sequence7 in the non-coding regions of PSP94 that generated full-length PSP94 cDNA. After first strand synthesis, standard PCR was performed. 0.5 pl. of the PCR product was directly cloned in a TA vector (Invitrogen) using T4 DNA ligase a t 14C overnight. Ligation products were transformed into E. coli host strain, INV cxF1 (Invitrogen). Plasmid DNA of randomly selected recombinant clones was isolated by a miniprep procedure. Inserts were screened by restriction enzyme digestion. Plasmid DNA from positive colonies was then purified by a Qiagen kit from a 40 ml. culture at midi-prep scale. Recombinant techniques such as restriction enzyme digestion, ligation, transformation, screening and analysis of the recombinant clones were performed according to standard procedure.lS DNA sequencing was performed using an automated DNA sequence apparatus. Homology alignments of DNA sequences were performed

using the GCG Sequence Analysis Package to confirm the identity of PSP94 cDNA clones. Binding of PSP94 to the LNCaP cells. An equilibrium binding assay was performed with crude preparations of cell membranes according to a method described previously.20 Briefly, purified PSP94 was biotinylated with NHS-biotin and used as trace-ligand in the equilibrium assay. The cells were lysed by nitrogen cavitation and a crude cell membrane fraction was obtained by differential centrifugation.21 Membrane was dissolved in 50 mM HEPES buffer, pH 7.5, containing 100 mM NaCl and 2%BSA. The cell suspension was incubated with biotinylated-PSP94 in Eppendorf tubes at 4C for 60 minutes. The final reaction volume was 110 p1. For the determination of non-specific binding, 1000-fold molar excess unlabelled PSP94 was added in parallel tubes. Following incubation, the tubes were centrifuged at 15,000 g for 30 minutes, and the supernatant was aspirated. The remaining pellet was washed twice with cold PBS. After the final wash, the cell pellet was then dissolved in SDS-PAGE sample buffer. Samples were separated on 10% acrylamide gels and blotted onto PVDF membranes and visualized following the procedures described elsewhere.22 Densitometry analysis of the stained bands was performed from scanned gel images using Sigmagel software. The density is expressed as arbitrary absorbency units (AU). Levels of PSP94 binding sites after exposure to exogenous PSP94. Cells (1 X lo5) were plated in 6-well plates and incubated with RPMI, containing 10% FCS. After 48 hours, cells were incubated in serum-free medium (AMI-V, Gibco BRL) for 10 hours, and then treated with PSP94 for 14 hours. No apoptosis was observed on LNCaP cells within the periods of PSP94 treatment. The density of specific binding sites on LNCaP cells was assayed following the procedure described above. RESULTS

Expression of PSP94 by LNCaP cells in mRNA and protein levels. RT-PCR was used to examine the expression of PSP94 mRNA. 1.5 pg. total RNA extracted from LNCaP cells was used as template for the first strand cDNA synthesis. Following this step, PCR amplification was performed using sense and antisense primers flanking full-length PSP94 cDNA. The PCR products were separated on 1.58 agarose gel and visualized with Ethium Bromide staining (fig. 1, panel A ) .The size of the PCR product from LNCaP cells is the same as that from PSP94 cDNA (480 bp), and no corresponding band was observed on the negative control reaction (no reverse transcription step). To confirm the identity of the PCR product, hybridization was employed with DIG-labelled fulllength human PSP94 cDNA as the probe. The results of hybridization showed specific hybridization a t the expected size position (Fig. 1, panel B).To examine the secretion of PSP94, the cells were metabolically labelled with :3"Smethionine followed by immunoprecipitation with specific antibody against human PSP94. The data showed that PSP94 was actively synthesized and secreted by the LNCaP cells (fig. 2). Purified PSP94 completely inhibited immunoprecipitation of ""S-PSP94 (data not shown). Zdentzfication of binding sites to PSP94 on the LNCaP cells. When varying amounts of biotinylated-PSP94 were incubated with a constant concentration of preparation of LNCaP cell membranes at 4C for 60 minutes, the binding reached a maximum at a ligand concentration of 40 ng., indicating saturation of the binding sites (fig. 3, A ) .Two types of PSP94 binding sites, each with a distinct affinity (I(d)and density (B,,,,) value, were indicated by Scatchard analysis. These values were K,,l = 0.70 nM, B,,, 1 = 268 fmol/mg. protein and I(d2 = 5.1 nM, B,,,,2 = 810 fmol/mg. protein, respectively. These values are comparable to those obtained previously with a whole-cell binding assay.20 Specificity was dem-

PSP94 AND PSP94 RECEPTORS IN LNCaP CELLS

2242

A

B 2' 3' 4'

1234

total binding. s w c binding . non-specmc bmdlng

A

lo

1

, , --

/

A,

Y -

/

0 X

n

m /

/

/'

9 . d

m ,/r

0

80

LL

2

I

I

I

I

0 400 800 bound ( f m o h g protein )

160 240 Biotin-PSP94 (ng)

320

B

'",

loo]

80

FIG. 1. RT-PCR and hybridization assay for expression of PSP94 mRNA in LNCaP cells. Total RNA, isolated from human prostate tissue and cultured LNCaP cells, was used as template for first cDNA strand synthesis. Primers used in first strand synthesis and following PCR procedure were designed to cover full-lengthof PSP94 cDNA according to reported sequence. Left Panel; ethidium bromide staining of RT-PCR product separated on 1.5% agarose gel. Lane 1; DNA 100 bp ladder. Lane 2; human prostate tissue. Lane 3; LNCaP cells. Lane 4; LNCaP cells omitting RT step as negative control. Size of RT-PCR product from LNCaP cells is same as from rostate tissue. Right panel; hybridization of PCR product with DI4-PSP94 cDNA probe after transferred to PVDF membrane, Lane 2 , Lane 3' and Lane 4' corresponding to samples of lane of 2 , 3 , and 4, respectively.

\

b

\

60

0

1

\ \ b '.

0

1

2

3

4

5

Y

6

7

unlabelled PSP94 (log, [ ng ] )

FIG. 3. A, saturation assay for binding sites for PSP94 to LNCaP cell membrane. Inset shows the result of Scatchard analysis. B , competitive inhibition assay for binding sites of PSP94 to the LNCaP cell membrane. posure to exogenous PSP94. After LNCaP cells were incubated in the presence of exogenous PSP94 (0.01 ng.-2.0 pg.1 lo6 cells), the number of PSP94 binding sites increased in a dose-dependent manner (fig. 4). DISCUSSION

4FIG.2. Immuno recipitation assay for secretion of PSP94 in culture medium of L8CaP cells. Subcultured LNCaP cells were metabolically labelled with 35S-methionine,and cell lysates were immunoprecipitated with specific antibody against human PSP94. Precipitation was se arated on 15%acrylamide gels and autoradiography. Lane 1; 10 lysate samples. Lane 2; 20 pl. lysate samples. Arrow shows band of PSP94. Molecular weight is 1.4 KD.

~f

onstrated by competitive inhibition experiments. A constant concentration of cell membranes was incubated with biotinylated-PSP94 (40 ng.) in the presence of increasing concentrations of unlabelled PSF94 at 4C for 60 min. Fig. 3, B illustrates the dose-related inhibition of biotinylated-PSP94 binding to the cell membrane by the unlabelled PSP94. Forty pg. of unlabelled PSP94 inhibited binding of labelled-PSP94 to cell membranes by over 90%. Levels of PSP94 specific binding sites increased after ex-

Evidence has been accumulating that a variety of positive and negative regulators play a n important role in the growth and differentiation of prostate epithelium in a n autocrind paracrine manner.23.24 PSP94 has been hypothesized to have a physiological role as a n autocrindparacrine inhibitor of prostatic epithelial proliferation.15 If a n autocrine regulatory role exists, the regulatory circuit must have a mechanism that allows PSP94 to act as a n effector molecule. Such a regulatory circuit should include both PSP94 and its specific receptors in the prostatic epithelial cells. The human metastic prostatic adenocarcinoma cell line, LNCaP, is relatively well-differentiated and resembles, more closely, the normal prostatic epithelial cells. Accordingly, it is widely used in prostate cancer research. The demonstration of a potential autocrine circuit involving PSP94 in LNCaP cells would provide a useful model for the study of PSP94 function. In our studies, the secretion of PSP94 and the active expression of PSP94 mRNA in LNCaP cells were observed. In addition, specific binding sites were demonstrated by equilibrium binding assay on the crude membrane preparations of LNCaP cells. The observations that PSP94 is synthesized in, and secreted from, LNCaP cells and that binding sites specific for PSP94 are present, partially fulfil the molecular requirements for a PSP94-based autocrine regulatory pathway in this cell line. Further experiments also showed that following exposure to exogenous PSP94 for 14 hours, the

PSP94 AND PSP94 RECEPTORS IN LNCaP CELLS

/

0

1

2

3

4

5

log,, exogenous PSP94(ng)

.. Up-regulation of PSP94 binding sites on LNCaP cells by exogenous PSP94. Density of PSP94 binding sites on LNCaP cells increased linearly after exposure to varying concentrations of exogenous PSP94 for 14 hours.

densities of PSP94 binding sites on the LNCaP cells increased in a dose-dependent manner. Accordingly, PSP94 was shown to functionally interact with its binding sites on LNCaP cells, providing a stimulus that resulted in the upregulation of its binding sites. The existence of binding sites to PSP94 on PC-3 cell line was observed,20 but the no expression of PSP94 was detected in PC-3 cell lines (data not shown). Whether the autocrine regulation loop involved PSP94 is unique to LNCaP cell line and the further regulation mechanism of PSP94 binding protein expression, especially with androgenic regulation, needs to be studied. The relationship between the regulation of PSP94 expression and malignancy of the prostate is not yet clear. Brar et a125 reported variable levels of PSP94 and its mRNA in pathological prostate specimens. Liu et a126 reported that PSP94 expression appeared to be down-regulated in cancerous cells when subtractive cDNA cloning was used to identify phenotype-specific cDNA sequences from both normal and cancerous prostate tissue. Hyakutake et a127 reported that immuno-negativity for PSP94 in transrectal biopsies was highly correlated with poor prognosis. Recently, PSP94 and a 10-MER synthetic analogue have been shown to suppress growth and clonogenic cell survival in an androgenindependent prostate cancer cell line (PC3). This effect was determined to be mediated through the induction of apoptosis.28 The potential roles of PSP94hinding protein regulatory pathway in the development and possible transformation of prostate epithelial cells clearly need to be further studied. Acknowledgment. We thank Dr. John Denstedt, St. Joseph‘s Hospital, London, Ontario, Canada for kindly providing human prostate tissue. REFERENCES

1. Kirby, R., Christmas, T. and Brawer, M.: The molecular basis of prostate cancer. In: Prostate Cancer. Edited by Kirby, R. First edition, London: Mosby, pp. 33-43, 1996. 2. Peehl, D.: Cellular biology of prostatic growth factors. Prostate, 6 74,1996. 3. Abrahamsson, P. and Lilja, H.: Three predominant prostatic proteins. Andrologia, 1: 122, 1990.

2243

4. Seidah, N., Arbatti, N., Rochemont, J., Sheth, A. and Chretien, M.: Complete amino acid sequence of human seminal plasma Pinhibin. Prediction of post Cln-Arg cleavage as a maturation site. FEBS Lett., 176 349, 1984. 5. Johanseon, J., Sheth. A., Cederlund, E. and Jornvall, H.: Analysis of an inhibin preparation reveals apparent identity between a peptide with inhibin-like activity and a sperm-conting antigen. FEBS Lett., 176 21, 1984. 6. Akiyama, K.. Yoshioka, Y., Schmid, K.. Ofmer, C., Trorler, R.. Tsuda, R. and Hara, M.: The amino acid sequence of human pmicroseminoprotein. Biochim. Biophys. Acta, 829: 288. 1985. 7. Ulvsback, M., Lindstrom, C., Weiber, H., Abrahamsson, P.. Lilja, H. and Lundwall, A,: Molecular cloning of a small prostate protein, known as pmicroseminoprotein, PSP94 or B-inhibin, and demonstration of transcription in non-genital tissues. Biochem. Biophys. Res. Comm., 1&I: 1310, 1989. 8. Green, C., Lui, W. and Kwok, S.: Cloning and nucleotide sequence analysis of the human @-microseminoprotein. Biochem. Biophys. Res. Comm., 161: 1184, 1990. 9. Abrahamsson, P., Lilja, H., Falkmer, S. and Wadstrom, L.: Immunohistochemical distribution of the three predominant secretory proteins in the parenchyma of hyperplastic and neoplastic prostate glands. Prostate, 12: 39, 1988. 10. Sathe, V., Sheth, N., Phadke, M., Sheth, A. and Zaveri, J.: Biosynthesis and localization of inhibin in human prostate. Prostate, 10: 33, 1987. 11. Kharbanda, K., Dhingra, S. and Duraiswami, S.: Secretion of inhibin-like material by rat ventral prostate epithelial cells in culture. Prostate, 18: 59,1991. 12. Weiber, H., Andersson, C., Murne. A., Rannevik. G . , Lindstrom, C., Lilja, H. and Fernlund. P.: @-microseminoproteinis not a prostate-specific protein: its identification in mucous and secretions. Am.J. Pathol., 137: 593, 1990. 13. Ohkubo, I., Tada, T., Ochiai. Y., Ueyama, H.. Eimoto, T. and Sasaki, M.: Human seminal plasma P-microseminoprotein: its purification, characterization and immunohistochemical localization. Int. J. Biochem. Cell Biol., 21: 603, 1995. 14. Hurkadli, K., Lokeshwar, B., Sheth, A. and Block, N.: Detection of prostatic-inhibin-like peptide in the cytoplasm of LNCaP cells, a human prostatic adenocarcinoma cell line. Prostate, 24: 285. 1994. 15. Garde, S., Sheth, A., Porter, A. and Plenta, K.: Effect of prostatic inhibin peptide (PIP) on prostate cancer cell growth in vitro and in vivo. Prostate, 2 2 225, 1993. 16. Lokeshwar, B., Hurkadli, K., Sheth, A. and Block, N.: Human prostatic inhibin suppresses tumour growth and inhibits clonogenic cell survival of a model prostatic adenocarcinoma, the Dunning R3327G rat tumor. Cancer Res., 59.4855, 1993. 17. Lin, M., Garcia-Arenas, R., Chao, Y., Lai. M., Patel, P. and Xia, X.:Regulation of prostatic acid phosphatase expression and secretion by androgen in LNCaP human prostate carcinoma cells. Arch. Biochem. Biophys., 300:384, 1993. 18. Watson. C. and Demmer, J.: Procedure for cDNA cloning. In: DNA Cloning I: A Practical Approach. Edited by Glover, D. and Hames, B. Second Edition, IRL, Press, pp. 113-119, 1995. 19. Sambrook, J., Fritch, E. and Maniatis, T.: Plasmid vectors. In: Molecular Cloning: A Laboratory Manual. Second edition, Cold Spring Harbor Laboratory Press, pp. 1.2-1.105, 1989. 20. Yang, J., Baijal-Gupta, M., Garde. S., Fraser, J., Finkelman, M. and Clarke, M.: Identification of binding proteins for PSP94 in human prostate adenocarcinoma cell lines. Prostate. In press. 21. Brun. G., Moldovan, F., Aubin, P., Ropiquet, F., Cussenot, 0. and Fiet, J.: Identification of endothelin receptors in normal and hyperplastic human prostate tissues. Prostate, 28: 379, 1996. 22. Yang, J. and Cherian, G.: Preventive effect of metallothionein on streptozotocin-induced diabetes in rats. Life Sci., 55.43, 1994. 23. Culig, 2.. Hobisch, A, Cronauer, M., Radmayr, C., Hittmair. A.. Zhang, J., Thurnher, M., Bartsch, G. and Klocker, H.: Regulation of prostatic growth and function by growth factors. Prostate, 28: 392. 1996. 24. Cunha, G.: Growth factors as mediators of androgen action during male urogenital development. Prostate, 6 22, 1996. 25. Brar, A., Mbikay, M., Sirois. F., Fournier, S., Seidah, N. and Chretien, M.:Localization of the human prostatic secretory protein PSP94 and its mRNA in the epithelial cells of the prostate. J. Androl., % 253,1988.

2244

PSP94 AND PSP94 RECEPTORS IN LNCaP CELLS

26. Liu, A., Bradner, R. and Vessella, R.: Decreased expression of prostate secretory protein PSP94 in prostate cancer. Cancer Lett., 7 4 9, 1993. 27. Hyakutake, H., Sakai, H., Yogi, Y., Tsuda, R., Minami, Y., Yushita, Y., b e t a k e , H., Nakazono, I. and Saito, Y.: Betamicroseminoprotein immunoreactivity as a new prognostic in-

dicator of prostate carcinoma. Prostate, 2 4 347, 1993. 28. Ben-Josef, E., Garde, S., Basmr, V., Krishm, A. and Porter, A,: Prostate secretory protein of 94 amino acids and a 10-MER synthetic analogue (R10) suppress growth and clonogenic cell survival in hormone-resistant prostate cancer cell line. Proc. Ann. Meet. Am. SOC.Clin. Oncol., 1 4 A661, 1995.