- Email: [email protected]
Detection of three single nucleotide polymorphisms in the gene encoding mannose-binding lectin in a single pyrosequencing reaction
Journal of Immunological Methods 309 (2006) 108 – 114 www.elsevier.com/locate/jim
Research paper
Detection of three single nucleotide polymorphisms in the gene encoding mannose-binding lectin in a single pyrosequencing reaction Anja Roos a,*, Patrick Dieltjes b, Rolf H.A.M. Vossen b, Mohamed R. Daha a, Peter de Knijff b a
b
Department of Nephrology, Leiden University Medical Center, Postbox 9600, 2300 RC Leiden, The Netherlands Department of Human and Clinical Genetics, Leiden University Medical Center, Postbox 9600, 2300 RC Leiden, The Netherlands Received 22 September 2005; received in revised form 14 November 2005; accepted 23 November 2005 Available online 27 December 2005
Abstract Mannose-binding lectin (MBL) is a key molecule of innate immunity. Binding of MBL to carbohydrates present on pathogens activates the lectin pathway of complement activation, resulting into opsonization and anti-microbial protection. Three frequently occurring single nucleotide polymorphisms (SNPs) are described in the coding region of the MBL2 gene that are associated with abnormal polymerization of the MBL molecule, decreased serum concentrations of high molecular weight MBL, and strongly impaired function. Clinical studies have shown that these MBL SNPs are associated with increased susceptibility to infections, especially in immune-compromised persons, as well as with accelerated progression of chronic diseases. The present study describes a novel method to detect the three major MBL SNPs by pyrosequencing. The close proximity of these SNPs allows their detection in one single pyrosequencing reaction, resulting in clearly distinguishable patterns for each allele combination described until now. This method can be used for the easy and reliable detection of MBL SNPs to identify the basis of functional MBL deficiency in clinical diagnostics and research. D 2005 Elsevier B.V. All rights reserved. Keywords: Mannose-binding lectin; Pyrosequencing; Innate immunity; Complement deficiency; Single nucleotide polymorphism; Lectin pathway
1. Introduction Mannose-binding lectin (MBL)1 is a major initiator of the lectin pathway of the complement system. Three Abbreviations: c, coding DNA sequence; MBL, mannose-binding lectin; MASP, MBL-associated serine protease; p, protein sequence; SNP, single nucleotide polymorphism; RFLP, restriction fragment length polymorphism; SSP, sequence-specific priming. * Corresponding author. Tel.: +31 71 526 2010/3964; fax: +31 71 526 6868. E-mail address: [email protected] (A. Roos). 1 The nomenclature of MBL exon 1 SNPs in the present study is based on nucleotide counting using the coding (c.) sequence, where nucleotide 1 is A of the ATG translation initiation codon. Protein sequences are also indicated (p. is protein). 0022-1759/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jim.2005.11.017
pathways of complement activation have been identified until now, the classical pathway, the alternative pathway, and the lectin pathway (Walport, 2001a,b). Complement activation is a key mechanism of innate immunity against a broad range of pathogens, including viruses, bacteria and yeast species, leading to opsonization, inflammation, activation of acquired immunity, and finally to elimination of the target. Genetic deficiencies of complement components have been identified at almost every level of the complement system and have underscored the role of complement in host defence (Roos et al., 2003b). MBL is a C-type lectin that binds via its carbohydrate recognition domains to carbohydrate patterns typically present on microbial surfaces, containing sac-
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
charide residues such as d-mannose, l-fucose, N-acetyl glucosamine and N-acetyl mannosamine. The molecule consists of up to six homotrimeric structures that are organized into higher order multimers via covalent and non-covalent interactions between the collagenous tail domains of the polypeptide chains. Binding of MBL to a carbohydrate ligand leads to activation of the MBLassociated serine proteases (MASPs), resulting in cleavage of C4 and C2 by activated MASP-2 and formation of the C3 convertase C4b2a (Petersen et al., 2001b). Among the complement deficiencies identified to date, deficiencies of MBL are most common in the human population. A number of single nucleotide polymorphisms (SNPs) have been identified in both untranslated and coding regions of the MBL2 gene (NM_000242) that are associated with variable MBL production and function in vivo. Three SNPs in the promoter region and the 5’ untranslated region of the MBL2 gene (designated as X/Y, L/H and P/Q alleles, respectively) have been described that affect the level of expression of MBL (Madsen et al., 1995, 1998). Furthermore, three SNPs are described in exon 1 of the MBL2 gene, encoding the collagenous regions of the molecule, which are associated with structural defects of the MBL molecule (Sumiya et al., 1991; Lipscombe et al., 1992; Madsen et al., 1994). These polymorphisms, present at codon 52 (MBL2:c.154C N T; p.52Arg N Cys), codon 54 (MBL2: c.161G N A; p.54Gly N Asp) and codon 57 (MBL2:c. 170G N A; p.57Gly N Glu), have generally been designated as alleles D, B, and C, respectively, whereas the wildtype allele for each position was designated as A (Garred et al., 1996). The different SNPs in the promoter and in exon 1 of the MBL gene are in strong linkage disequilibrium. Based on these six SNPs, seven different haplotypes, the so-called bsecretor haplotypesQ (Bernig et al., 2004) have been identified in population studies (Madsen et al., 1998). Additional infrequent haplotypes were described recently (Boldt and Petzl-Erler, 2002; Bernig et al., 2004), but until now, none of the reported haplotypes showed more than one exon 1 variant allele (c.154T, c.161A or c.170A) in cis position in the MBL2 gene. The joint frequency of the exon 1 variant alleles can be above 40% in the human population, dependent on the ethnicity. The c.161A variant is common in the Caucasian population but does not occur in Africans, whereas the c.170A variant is uncommon in Caucasians but shows a high frequency in Africans (Garred et al., 1996). The variant alleles in exon 1 of the MBL2 gene confer structural alterations in the molecule, resulting in impaired polymerization and strongly impaired function. Furthermore, the variant alleles are associated with re-
109
duced serum concentrations of high molecular weight MBL (Super et al., 1992; Garred et al., 2003a; Larsen et al., 2004; Roos et al., 2004). A number of studies have shown that these SNPs have important clinical consequences, leading to increased susceptibility for infection, mainly in children, in immune-compromised patients and in patients with other underlying diseases (Eisen and Minchinton, 2003). Therefore, the assessment of MBL variant alleles is of considerable clinical interest. Several methods have been described for MBL exon 1 genotyping. Detection of c.161G N A and c.170G N A SNPs has been mostly performed by PCR, followed by restriction fragment length polymorphism (RFLP) whereas detection of the c.154C N T SNP involves RFLP based on site-directed mutagenesis–PCR products. This technique was originally described by Garred and colleagues (Garred et al., 1996; Madsen et al., 1998). Several other groups have used comparable assays. More recently, novel assays have been described for detection of these MBL2 exon 1 SNPs, such as a method using generation of DNA heteroduplexes by a universal heteroduplex generator (Jack et al., 1997), an assay based on denaturing gradient gel electrophoresis (Gabolde et al., 1999), sequence-specific priming (SSP) (Steffensen et al., 2000; Garred et al., 2003b), a combination of PCRSSP and sequence-specific oligonucleotide probes (Crosdale et al., 2000; Boldt and Petzl-Erler, 2002), an oligonucleotide ligation assay (Roos et al., 2003a), realtime PCR with fluorescent hybridization probes (Steffensen et al., 2003), a TaqManR assay using minorgroove binder probes (Van Hoeyveld et al., 2004), and multiplex PCR (SkalnVkova´ et al., 2004). These techniques have important differences in reliability and timeand cost-effectiveness. Several of these techniques use multiple PCR reactions and gel electrophoresis procedures, which makes the procedure more laborious. Furthermore, in several assays there were difficulties distinguishing the alleles due to their close proximity. In the present manuscript we describe a novel method that can be used for detection of MBL2 exon 1 SNPs, requiring one PCR reaction followed by a single pyrosequencing reaction. This pyrosequencing technique (reviewed in (Ronaghi, 2001)) permits the detection of the three structural alleles of MBL in a rapid and highly reliable manner. 2. Materials and methods 2.1. DNA isolation Genomic DNA was purified from 100 Al peripheral blood using the QIAamp DNA Blood mini kit from
110
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
Qiagen following the instructions of the manufacturer. The DNA was collected in a total volume of 200 Al, and 1 Al (about 20 ng) was used for amplification of the first exon of the MBL2 gene by PCR.
2.2. Polymerase chain reaction A 30 Al PCR reaction was performed, using 0.25 mM dNTP (from Pharmacia Biotech), 0.8 U Amplitaq (from Perkin Elmer, Wellesley, MA), and 9 pmol of
Fig. 1. MBL genotyping by pyrosequencing. Part of exon 1 of the MBL2 gene is amplified from genomic DNA by PCR using one biotinylated primer. A box indicates the position of three MBL2 SNPs. The biotinylated PCR strand is isolated using streptavidin-coated beads. The pyrosequencing primer anneals to the sense strand, close to the area of three SNPs. The position of SNPs (D, B, and C alleles according to (Garred et al., 1996)) is indicated. Please note the direction of the pyrosequencing reaction as indicated by an arrow. The pyrosequencing reaction is performed by sequential injection of nucleotides as indicated. Incorporation of each nucleotide, by DNA polymerase, generates a light signal, involving the enzymes ATP sulfurylase and luciferase. The height of the signal represents the number of incorporated nucleotides (Ronaghi, 2001). Please note that single addition of the C nucleotide results in incorporation of three C nucleotides in the wildtype (A/A) sample, whereas in the sample with the c.170AA genotype (C/C), C is not incorporated since the sequence of that sample starts with an A nucleotide. Residual dNTP are rapidly degraded by apyrase, followed by addition of the next nucleotide. The expected pattern and the resulting pyrogram are shown for two different MBL genotypes, i.e., c.170GG (A/A) and c.170AA (C/C) homozygous genotypes.
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
111
Fig. 2. Overview of MBL pyrosequencing results. Human donors with different MBL genotypes were analyzed for exon 1 SNPs (MBL2: c.154C N T; c.161G N A; c.170G N A). Nomenclature in brackets is according to Garred et al. (1996). For each known genotype, a pyrogram is shown, together with a graph of expected results.
112
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
both PCR primers in PCR buffer (GeneAmpR PCR Buffer II (from Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands) supplemented with 2.5 mM MgCl2 and 0.25 mg/ml bovine serum albumin). The PCR forward primer was 5V-Biotin-CCTTCCCTGAGTTTTCTCAC-3V and the reverse primer was 5VAACAGCCCAACACGTACCTG-3V (both from Eurogentec, Seraing, Belgium). The PCR reaction was performed in a Peltier Thermal Cycler (PTC200, from MJ Research, Waltham, MA) using the following program: denaturation for 2 min at 95 8C, followed by 40 cycles of 20 s at 95 8C, 30 s at 60 8C, and 40 s at 72 8C and a final elongation period for 7 min at 72 8C. Evaluation of the PCR products by agarose electrophoresis showed one specific band of the expected molecular weight (240 bp). This PCR product was used for pyrosequencing. 2.3. Pyrosequencing A single pyrosequencing reaction contained 20 Al of PCR product, 120 Ag streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin (10 Ag/Al), Dynal Biotech, Hamburg, Germany) and 25 Al of binding buffer (10 mM Tris–HCl, 2M NaCl, 1 mM EDTA, 0.1% Tween 20, pH 7.6). The mixture was incubated at 65 8C for 15 min at 1000 rpm. Subsequently, immobilized DNA was transferred using a PSQ 96 magnetic sample prep tool (from Biotechnology and Life Sciences, Maarssen, the Netherlands) into wells containing 50 Al 0.5 M NaOH for one minute, followed by transfer into 100 Al Annealing buffer (20 mM Tris– acetate and 5 mM magnesium acetate) for one minute and transfer into 40 Al Annealing buffer containing 20 pmol sequencing primer (5V-CGTACCTGGTTCCCCCTTTTCT-3V, from Isogen Bioscience BV). This mixture is incubated for 3 min at 95 8C followed by cooling down to room temperature for at least 5 min. The sample plate was placed in the Pyrosequencer (PSQ Luc96, from Pyrosequencing BV, Uppsala, Sweden) and the reagent cartridge was filled with reagents from the Luc96 TM SNP reagent kit (from Biotechnology and Life Sciences). Enzymes (DNA polymerase, ATP sulfurylase, luciferase and apyrase), luciferine and adenosine-5-phosphosulphate (APS) were added to each well. Sequential addition of NTPs was used in the following order: CTCTGTGTCATCACAGC. The reaction was performed at 28 8C. 3. Results The close proximity of three functionally important SNPs in exon 1 of the MBL2 gene allows their detec-
tion in one single pyrosequencing reaction. A biotinylated PCR product was generated, and single strands of sense DNA were isolated using streptavidin-conjugated beads. The sequence of NTP addition in the pyrosequencing reaction was designed in such a way that the three SNPs at codon 52, 54 and 57 of the MBL2 gene could be unequivocally distinguished. The complete reaction was finished in 30 min for 96 samples. A schematic representation of the procedure is provided in Fig. 1. This procedure resulted in pyrograms with unique and easily identified patterns (Fig. 2) for each allele combination of the three MBL SNPs that have been described to date. Recently two coding SNPs have been described in codon 39 (MBL2:c.116G N A; p.39Ser N Asn) and in codon 40 (MBL2:c.118T N G; p.40 Ser N Ala) of the MBL2 gene, which were present in DNA from two African children with sickle cell disease ((Neonato et al., 1999)). We also developed a pyrosequencing method to detect these SNPs (the pyrosequencing primer was CATCTTTGCCTGGGA; the nucleotide addition sequence was AGCAGTGATGCTGAGACGCTA). Until now, we have detected only wildtype sequences at these positions (not shown). The functional consequences of codon 39 and 40 SNPs are unknown. 4. Discussion The method described in the present manuscript permits the rapid and reliable detection of MBL2 exon 1 SNPs that are known to have important consequences for MBL-mediated activation of the lectin pathway of complement. In serum from homozygous or compound heterozygous carriers of variant alleles, MBL-mediated complement activation is undetectable, whereas heterozygous carriers show a variable impairment of MBL function, which is more pronounced in carriers of the c.161GA and c.170GA genotypes than in carriers of the c.154CT genotype (Roos et al., 2004; Minchinton et al., 2002). In Caucasians, the combined allele frequency of these three variant alleles is around 20% (Garred et al., 1996). Next to MBL2 exon 1 variant alleles detected in the present manuscript, which affect MBL structure and function, SNPs in the MBL2 promoter region affect MBL gene expression. Among these, the X/Y SNP (C/G polymorphism at position-221 of the promoter; X allele frequency is 24%) has a profound influence on MBL serum concentration (Madsen et al., 1995). Allele X, which is associated with low MBL serum levels, has only been detected in wildtype MBL2 exon 1 haplo-
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
types (A haplotype; 30% X, 70% Y in Caucasians), and not in MBL2 exon 1 variant haplotypes (B, C, or D haplotypes; 100% Y). Homozygous carriers of X alleles may suffer from MBL deficiency based on low MBL protein expression. Furthermore, heterozygous carriers of MBL2 exon 1 variant haplotypes show a more profound MBL deficiency when they have an X allele on their wildtype haplotype (Garred et al., 2003a). The presence of the X/Y SNP can be easily detected using PCR-SSP (Mullighan et al., 2000; Steffensen et al., 2000; Garred et al., 2003b; Bouwman et al., 2005), which could provide additional genetic information about the MBL status of an individual. Since the promoter polymorphisms affect quantitative MBL expression but not MBL structure or function, such information can also be obtained by assessment of MBL serum concentration in addition to MBL exon 1 genotyping (Garred et al., 2003a). In view of the reported associations between MBL deficiency and a number of disease entities, detection of MBL gene polymorphisms can be of clinical relevance, especially in immune-compromised persons. In this respect, we have recently demonstrated, using the above-described methodology, that the presence of MBL variant alleles in a donor liver is a major and gene dose-dependent risk factor for severe infections after liver transplantation, irrespective of the MBL genotype of the recipient (Bouwman et al., 2005). Therefore, we propose that assessment of the MBL status may support the clinical management of patients, leading to identification of patients at risk that may require additional anti-microbial protection. Such a genetic approach can be combined with assessment of MBL serum levels (Garred et al., 2003a; Roos et al., 2004) and/or functional analysis of the MBL pathway in serum, using recently described methodology (Roos et al., 2003a; Petersen et al., 2001a). Acknowledgments The authors thank the Dutch Kidney Foundation (C03-6014) and the European Union (QLG1-CT2001-01039) for financial support of our studies. Several investigators kindly provided human DNA used in the present study, which was obtained under informed consent from healthy human subjects and from patients with various clinical conditions. Dr. Marc Seelen (Groningen, the Netherlands), Dr. Pieter S. Hiemstra, Manon E. Wildenberg, Lee H. Bouwman and Marie¨tte Lenselink (all from Leiden, the Netherlands) and Dr. Peter Garred (Copenhagen, Denmark) are acknowledged for their valuable contributions to these studies.
113
References Bernig, T., Taylor, J.G., Foster, C.B., Staats, B., Yeager, M., Chanock, S.J., 2004. Sequence analysis of the mannose-binding lectin (MBL2) gene reveals a high degree of heterozygosity with evidence of selection. Genes Immun. 5, 461. Boldt, A.B., Petzl-Erler, M.L., 2002. A new strategy for mannosebinding lectin gene haplotyping. Hum. Mutat. 19, 296. Bouwman, L.H., Roos, A., Terpstra, O.T., De Knijff, P., van Hoek, B., Verspaget, H.W., Berger, S.P., Daha, M.R., Fro¨lig, M., van der Slik, A.R., Doxiadis, I.I., Roep, B.O., Schaapherder, A.F.M., 2005. Mannose binding lectin gene polymorphisms confer a major risk for severe infections after liver transplantation. Gastroenterology 129, 408. Crosdale, D.J., Ollier, W.E.R., Thomson, W., Dyer, P.A., Jensenius, J., Johnson, R.W.G., Poulton, K.V., 2000. Mannose binding lectin (MBL) genotype distributions with relation to serum levels in UK Caucasoids. Eur. J. Immunogenet. 27, 111. Eisen, D.P., Minchinton, R.M., 2003. Impact of mannose-binding lectin on susceptibility to infectious diseases. Clin. Infect. Dis. 37, 1496. Gabolde, M., Muralitharan, S., Besmond, C., 1999. Genotyping of the three major allelic variants of the human mannose-binding lectin gene by denaturing gradient gel electrophoresis. Hum. Mutat. 14, 80. Garred, P., Madsen, H.O., Svejgaard, A., 1996. Genetics of human mannan-binding protein. In: Ezekowitz, R.A.B., Sastry, K.N., Reid, K.B.M. (Eds.), Collectins and Innate Immunity. SpringerVerlag, Heidelberg, p. 139. Garred, P., Larsen, F., Madsen, H.O., Koch, C., 2003a. Mannosebinding lectin deficiency— revisited. Mol. Immunol. 40, 73. Garred, P., Strøm, J.J., Quist, L., Taaning, E., Madsen, H.O., 2003b. Association of mannose-binding lectin polymorphisms with sepsis and fatal outcome, in patients with systemic inflammatory response syndrome. J. Infect. Dis. 188, 1394. Jack, D., Bidwell, J., Turner, M., Wood, N., 1997. Simultaneous genotyping for all three known structural mutations in the human mannose-binding lectin gene. Hum. Mutat. 9, 41. Larsen, F., Madsen, H.O., Sim, R.B., Koch, C., Garred, P., 2004. Disease-associated mutations in human mannose-binding lectin compromise oligomerisation and activity of the final protein. J. Biol. Chem. 279, 21302. Lipscombe, R.J., Sumiya, M., Hill, A.V., Lau, Y.L., Levinsky, R.J., Summerfield, J.A., Turner, M.W., 1992. High frequencies in African and non-African populations of independent mutations in the mannose binding protein gene. Hum. Mol. Genet. 1, 709. Madsen, H.O., Garred, P., Kurtzhals, J.A.L., Lamm, L.U., Ryder, L.P., Thiel, S., Svejgaard, A., 1994. A new frequent allele is the missing link in the structural polymorphism of the human mannan-binding protein. Immunogenetics 40, 37. Madsen, H.O., Garred, P., Thiel, S., Kurtzhals, J.A., Lamm, L.U., Ryder, L.P., Svejgaard, A., 1995. Interplay between promoter and structural gene variants control basal serum level of mannanbinding protein. J. Immunol. 155, 3013. Madsen, H.O., Satz, M.L., Hogh, B., Svejgaard, A., Garred, P., 1998. Different molecular events result in low protein levels of mannanbinding lectin in populations from southeast Africa and South America. J. Immunol. 161, 3169. Minchinton, R.M., Dean, M.M., Clark, T.R., Heatley, S., Mullighan, C.G., 2002. Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population. Scand. J. Immunol. 56, 630.
114
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
Mullighan, C.G., Marshall, S.E., Welsh, K.I., 2000. Mannose binding lectin polymorphisms are associated with early age of disease onset and autoimmunity in common variable immunodeficiency. Scand. J. Immunol. 51, 111. Neonato, M.G., Lu, C.Y., Guilloud-Bataille, M., Lapoume´roulie, C., Nabeel-Jassim, H., Dabit, D., Girot, R., Krishnamoorthy, R., Feingold, J., Besmond, C., Elion, J., 1999. Genetic polymorphism of the mannose-binding protein gene in children with sickle cell disease: identification of three new variant alleles and relationship to infections. Eur. J. Hum. Genet. 7, 679. Petersen, S.V., Thiel, S., Jensen, L., Steffensen, R., Jensenius, J.C., 2001. An assay for the mannan-binding lectin pathway of complement activation. J. Immunol. Methods 257, 107. Petersen, S.V., Thiel, S., Jensenius, J.C., 2001. The mannan-binding lectin pathway of complement activation: biology and disease association. Mol. Immunol. 38, 133. Ronaghi, M., 2001. Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3. Roos, A., Bouwman, L.H., Munoz, J., Zuiverloon, T., Faber-Krol, M.C., Fallaux-van den Houten, F.C., Klar-Mohamad, N., Hack, C.E., Tilanus, M.G., Daha, M.R., 2003a. Functional characterization of the lectin pathway of complement in human serum. Mol. Immunol. 39, 655. Roos, A., Trouw, L.A., Ioan-Facsinay, A., Daha, M.R., Verbeek, J.S., 2003b. Complement system and Fc receptors: genetics. In: Cooper, D. (Ed.), Nature Encyclopedia of the Human Genome. Nature Publishing Group, London, p. 914. Roos, A., Garred, P., Wildenberg, M.E., Lynch, N.J., Munoz, J., Zuiverloon, T., Bouwman, L.H., Schlagwein, N., Fallaux-van den Houten, F.C., Faber-Krol, M.C., Madsen, H.O., Schwaeble, W.J., Matsushita, M., Fujita, T., Daha, M.R., 2004. Antibody-
mediated activation of the classical pathway of complement may compensate for mannose-binding lectin deficiency. Eur. J. Immunol. 34, 2589. Skalnı´kova´, H., Freiberger, T., Chumchalova´, J., Grombirı´kova´, H., Sediva´, A., 2004. Cost-effective genotyping of human MBL2 gene mutations using multiplex PCR. J. Immunol. Methods 295, 139. Steffensen, R., Thiel, S., Varming, K., Jersild, C., Jensenius, J.C., 2000. Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J. Immunol. Methods 241, 33. Steffensen, R., Hoffmann, K., Varming, K., 2003. Rapid genotyping of MBL2 gene mutations using real-time PCR with fluorescent hybridisation probes. J. Immunol. Methods 278, 191. Sumiya, M., Super, M., Tabona, P., Levinsky, R.J., Arai, T., Turner, M.W., Summerfield, J.A., 1991. Molecular basis of opsonic defect in immunodeficient children. Lancet 337, 1569. Super, M., Gillies, S.D., Foley, S., Sastry, K., Schweinle, J.E., Silverman, V.J., Ezekowitz, R.A.B., 1992. Distinct and overlapping functions of allelic forms of human mannose binding protein. Nat. Genet. 2, 50. Van Hoeyveld, E., Houtmeyers, F., Massonet, C., Moens, L., Van Ranst, M., Blanckaert, N., Bossuyt, X., 2004. Detection of single nucleotide polymorphisms in the mannose-binding lectin gene using minor groove binder-DNA probes. J. Immunol. Methods 287, 227. Walport, M.J., 2001. Complement. First of two parts. N. Engl. J. Med. 344, 1058. Walport, M.J., 2001. Complement. Second of two parts. N. Engl. J. Med. 344, 1140.
Research paper
Detection of three single nucleotide polymorphisms in the gene encoding mannose-binding lectin in a single pyrosequencing reaction Anja Roos a,*, Patrick Dieltjes b, Rolf H.A.M. Vossen b, Mohamed R. Daha a, Peter de Knijff b a
b
Department of Nephrology, Leiden University Medical Center, Postbox 9600, 2300 RC Leiden, The Netherlands Department of Human and Clinical Genetics, Leiden University Medical Center, Postbox 9600, 2300 RC Leiden, The Netherlands Received 22 September 2005; received in revised form 14 November 2005; accepted 23 November 2005 Available online 27 December 2005
Abstract Mannose-binding lectin (MBL) is a key molecule of innate immunity. Binding of MBL to carbohydrates present on pathogens activates the lectin pathway of complement activation, resulting into opsonization and anti-microbial protection. Three frequently occurring single nucleotide polymorphisms (SNPs) are described in the coding region of the MBL2 gene that are associated with abnormal polymerization of the MBL molecule, decreased serum concentrations of high molecular weight MBL, and strongly impaired function. Clinical studies have shown that these MBL SNPs are associated with increased susceptibility to infections, especially in immune-compromised persons, as well as with accelerated progression of chronic diseases. The present study describes a novel method to detect the three major MBL SNPs by pyrosequencing. The close proximity of these SNPs allows their detection in one single pyrosequencing reaction, resulting in clearly distinguishable patterns for each allele combination described until now. This method can be used for the easy and reliable detection of MBL SNPs to identify the basis of functional MBL deficiency in clinical diagnostics and research. D 2005 Elsevier B.V. All rights reserved. Keywords: Mannose-binding lectin; Pyrosequencing; Innate immunity; Complement deficiency; Single nucleotide polymorphism; Lectin pathway
1. Introduction Mannose-binding lectin (MBL)1 is a major initiator of the lectin pathway of the complement system. Three Abbreviations: c, coding DNA sequence; MBL, mannose-binding lectin; MASP, MBL-associated serine protease; p, protein sequence; SNP, single nucleotide polymorphism; RFLP, restriction fragment length polymorphism; SSP, sequence-specific priming. * Corresponding author. Tel.: +31 71 526 2010/3964; fax: +31 71 526 6868. E-mail address: [email protected] (A. Roos). 1 The nomenclature of MBL exon 1 SNPs in the present study is based on nucleotide counting using the coding (c.) sequence, where nucleotide 1 is A of the ATG translation initiation codon. Protein sequences are also indicated (p. is protein). 0022-1759/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jim.2005.11.017
pathways of complement activation have been identified until now, the classical pathway, the alternative pathway, and the lectin pathway (Walport, 2001a,b). Complement activation is a key mechanism of innate immunity against a broad range of pathogens, including viruses, bacteria and yeast species, leading to opsonization, inflammation, activation of acquired immunity, and finally to elimination of the target. Genetic deficiencies of complement components have been identified at almost every level of the complement system and have underscored the role of complement in host defence (Roos et al., 2003b). MBL is a C-type lectin that binds via its carbohydrate recognition domains to carbohydrate patterns typically present on microbial surfaces, containing sac-
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
charide residues such as d-mannose, l-fucose, N-acetyl glucosamine and N-acetyl mannosamine. The molecule consists of up to six homotrimeric structures that are organized into higher order multimers via covalent and non-covalent interactions between the collagenous tail domains of the polypeptide chains. Binding of MBL to a carbohydrate ligand leads to activation of the MBLassociated serine proteases (MASPs), resulting in cleavage of C4 and C2 by activated MASP-2 and formation of the C3 convertase C4b2a (Petersen et al., 2001b). Among the complement deficiencies identified to date, deficiencies of MBL are most common in the human population. A number of single nucleotide polymorphisms (SNPs) have been identified in both untranslated and coding regions of the MBL2 gene (NM_000242) that are associated with variable MBL production and function in vivo. Three SNPs in the promoter region and the 5’ untranslated region of the MBL2 gene (designated as X/Y, L/H and P/Q alleles, respectively) have been described that affect the level of expression of MBL (Madsen et al., 1995, 1998). Furthermore, three SNPs are described in exon 1 of the MBL2 gene, encoding the collagenous regions of the molecule, which are associated with structural defects of the MBL molecule (Sumiya et al., 1991; Lipscombe et al., 1992; Madsen et al., 1994). These polymorphisms, present at codon 52 (MBL2:c.154C N T; p.52Arg N Cys), codon 54 (MBL2: c.161G N A; p.54Gly N Asp) and codon 57 (MBL2:c. 170G N A; p.57Gly N Glu), have generally been designated as alleles D, B, and C, respectively, whereas the wildtype allele for each position was designated as A (Garred et al., 1996). The different SNPs in the promoter and in exon 1 of the MBL gene are in strong linkage disequilibrium. Based on these six SNPs, seven different haplotypes, the so-called bsecretor haplotypesQ (Bernig et al., 2004) have been identified in population studies (Madsen et al., 1998). Additional infrequent haplotypes were described recently (Boldt and Petzl-Erler, 2002; Bernig et al., 2004), but until now, none of the reported haplotypes showed more than one exon 1 variant allele (c.154T, c.161A or c.170A) in cis position in the MBL2 gene. The joint frequency of the exon 1 variant alleles can be above 40% in the human population, dependent on the ethnicity. The c.161A variant is common in the Caucasian population but does not occur in Africans, whereas the c.170A variant is uncommon in Caucasians but shows a high frequency in Africans (Garred et al., 1996). The variant alleles in exon 1 of the MBL2 gene confer structural alterations in the molecule, resulting in impaired polymerization and strongly impaired function. Furthermore, the variant alleles are associated with re-
109
duced serum concentrations of high molecular weight MBL (Super et al., 1992; Garred et al., 2003a; Larsen et al., 2004; Roos et al., 2004). A number of studies have shown that these SNPs have important clinical consequences, leading to increased susceptibility for infection, mainly in children, in immune-compromised patients and in patients with other underlying diseases (Eisen and Minchinton, 2003). Therefore, the assessment of MBL variant alleles is of considerable clinical interest. Several methods have been described for MBL exon 1 genotyping. Detection of c.161G N A and c.170G N A SNPs has been mostly performed by PCR, followed by restriction fragment length polymorphism (RFLP) whereas detection of the c.154C N T SNP involves RFLP based on site-directed mutagenesis–PCR products. This technique was originally described by Garred and colleagues (Garred et al., 1996; Madsen et al., 1998). Several other groups have used comparable assays. More recently, novel assays have been described for detection of these MBL2 exon 1 SNPs, such as a method using generation of DNA heteroduplexes by a universal heteroduplex generator (Jack et al., 1997), an assay based on denaturing gradient gel electrophoresis (Gabolde et al., 1999), sequence-specific priming (SSP) (Steffensen et al., 2000; Garred et al., 2003b), a combination of PCRSSP and sequence-specific oligonucleotide probes (Crosdale et al., 2000; Boldt and Petzl-Erler, 2002), an oligonucleotide ligation assay (Roos et al., 2003a), realtime PCR with fluorescent hybridization probes (Steffensen et al., 2003), a TaqManR assay using minorgroove binder probes (Van Hoeyveld et al., 2004), and multiplex PCR (SkalnVkova´ et al., 2004). These techniques have important differences in reliability and timeand cost-effectiveness. Several of these techniques use multiple PCR reactions and gel electrophoresis procedures, which makes the procedure more laborious. Furthermore, in several assays there were difficulties distinguishing the alleles due to their close proximity. In the present manuscript we describe a novel method that can be used for detection of MBL2 exon 1 SNPs, requiring one PCR reaction followed by a single pyrosequencing reaction. This pyrosequencing technique (reviewed in (Ronaghi, 2001)) permits the detection of the three structural alleles of MBL in a rapid and highly reliable manner. 2. Materials and methods 2.1. DNA isolation Genomic DNA was purified from 100 Al peripheral blood using the QIAamp DNA Blood mini kit from
110
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
Qiagen following the instructions of the manufacturer. The DNA was collected in a total volume of 200 Al, and 1 Al (about 20 ng) was used for amplification of the first exon of the MBL2 gene by PCR.
2.2. Polymerase chain reaction A 30 Al PCR reaction was performed, using 0.25 mM dNTP (from Pharmacia Biotech), 0.8 U Amplitaq (from Perkin Elmer, Wellesley, MA), and 9 pmol of
Fig. 1. MBL genotyping by pyrosequencing. Part of exon 1 of the MBL2 gene is amplified from genomic DNA by PCR using one biotinylated primer. A box indicates the position of three MBL2 SNPs. The biotinylated PCR strand is isolated using streptavidin-coated beads. The pyrosequencing primer anneals to the sense strand, close to the area of three SNPs. The position of SNPs (D, B, and C alleles according to (Garred et al., 1996)) is indicated. Please note the direction of the pyrosequencing reaction as indicated by an arrow. The pyrosequencing reaction is performed by sequential injection of nucleotides as indicated. Incorporation of each nucleotide, by DNA polymerase, generates a light signal, involving the enzymes ATP sulfurylase and luciferase. The height of the signal represents the number of incorporated nucleotides (Ronaghi, 2001). Please note that single addition of the C nucleotide results in incorporation of three C nucleotides in the wildtype (A/A) sample, whereas in the sample with the c.170AA genotype (C/C), C is not incorporated since the sequence of that sample starts with an A nucleotide. Residual dNTP are rapidly degraded by apyrase, followed by addition of the next nucleotide. The expected pattern and the resulting pyrogram are shown for two different MBL genotypes, i.e., c.170GG (A/A) and c.170AA (C/C) homozygous genotypes.
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
111
Fig. 2. Overview of MBL pyrosequencing results. Human donors with different MBL genotypes were analyzed for exon 1 SNPs (MBL2: c.154C N T; c.161G N A; c.170G N A). Nomenclature in brackets is according to Garred et al. (1996). For each known genotype, a pyrogram is shown, together with a graph of expected results.
112
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
both PCR primers in PCR buffer (GeneAmpR PCR Buffer II (from Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands) supplemented with 2.5 mM MgCl2 and 0.25 mg/ml bovine serum albumin). The PCR forward primer was 5V-Biotin-CCTTCCCTGAGTTTTCTCAC-3V and the reverse primer was 5VAACAGCCCAACACGTACCTG-3V (both from Eurogentec, Seraing, Belgium). The PCR reaction was performed in a Peltier Thermal Cycler (PTC200, from MJ Research, Waltham, MA) using the following program: denaturation for 2 min at 95 8C, followed by 40 cycles of 20 s at 95 8C, 30 s at 60 8C, and 40 s at 72 8C and a final elongation period for 7 min at 72 8C. Evaluation of the PCR products by agarose electrophoresis showed one specific band of the expected molecular weight (240 bp). This PCR product was used for pyrosequencing. 2.3. Pyrosequencing A single pyrosequencing reaction contained 20 Al of PCR product, 120 Ag streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin (10 Ag/Al), Dynal Biotech, Hamburg, Germany) and 25 Al of binding buffer (10 mM Tris–HCl, 2M NaCl, 1 mM EDTA, 0.1% Tween 20, pH 7.6). The mixture was incubated at 65 8C for 15 min at 1000 rpm. Subsequently, immobilized DNA was transferred using a PSQ 96 magnetic sample prep tool (from Biotechnology and Life Sciences, Maarssen, the Netherlands) into wells containing 50 Al 0.5 M NaOH for one minute, followed by transfer into 100 Al Annealing buffer (20 mM Tris– acetate and 5 mM magnesium acetate) for one minute and transfer into 40 Al Annealing buffer containing 20 pmol sequencing primer (5V-CGTACCTGGTTCCCCCTTTTCT-3V, from Isogen Bioscience BV). This mixture is incubated for 3 min at 95 8C followed by cooling down to room temperature for at least 5 min. The sample plate was placed in the Pyrosequencer (PSQ Luc96, from Pyrosequencing BV, Uppsala, Sweden) and the reagent cartridge was filled with reagents from the Luc96 TM SNP reagent kit (from Biotechnology and Life Sciences). Enzymes (DNA polymerase, ATP sulfurylase, luciferase and apyrase), luciferine and adenosine-5-phosphosulphate (APS) were added to each well. Sequential addition of NTPs was used in the following order: CTCTGTGTCATCACAGC. The reaction was performed at 28 8C. 3. Results The close proximity of three functionally important SNPs in exon 1 of the MBL2 gene allows their detec-
tion in one single pyrosequencing reaction. A biotinylated PCR product was generated, and single strands of sense DNA were isolated using streptavidin-conjugated beads. The sequence of NTP addition in the pyrosequencing reaction was designed in such a way that the three SNPs at codon 52, 54 and 57 of the MBL2 gene could be unequivocally distinguished. The complete reaction was finished in 30 min for 96 samples. A schematic representation of the procedure is provided in Fig. 1. This procedure resulted in pyrograms with unique and easily identified patterns (Fig. 2) for each allele combination of the three MBL SNPs that have been described to date. Recently two coding SNPs have been described in codon 39 (MBL2:c.116G N A; p.39Ser N Asn) and in codon 40 (MBL2:c.118T N G; p.40 Ser N Ala) of the MBL2 gene, which were present in DNA from two African children with sickle cell disease ((Neonato et al., 1999)). We also developed a pyrosequencing method to detect these SNPs (the pyrosequencing primer was CATCTTTGCCTGGGA; the nucleotide addition sequence was AGCAGTGATGCTGAGACGCTA). Until now, we have detected only wildtype sequences at these positions (not shown). The functional consequences of codon 39 and 40 SNPs are unknown. 4. Discussion The method described in the present manuscript permits the rapid and reliable detection of MBL2 exon 1 SNPs that are known to have important consequences for MBL-mediated activation of the lectin pathway of complement. In serum from homozygous or compound heterozygous carriers of variant alleles, MBL-mediated complement activation is undetectable, whereas heterozygous carriers show a variable impairment of MBL function, which is more pronounced in carriers of the c.161GA and c.170GA genotypes than in carriers of the c.154CT genotype (Roos et al., 2004; Minchinton et al., 2002). In Caucasians, the combined allele frequency of these three variant alleles is around 20% (Garred et al., 1996). Next to MBL2 exon 1 variant alleles detected in the present manuscript, which affect MBL structure and function, SNPs in the MBL2 promoter region affect MBL gene expression. Among these, the X/Y SNP (C/G polymorphism at position-221 of the promoter; X allele frequency is 24%) has a profound influence on MBL serum concentration (Madsen et al., 1995). Allele X, which is associated with low MBL serum levels, has only been detected in wildtype MBL2 exon 1 haplo-
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
types (A haplotype; 30% X, 70% Y in Caucasians), and not in MBL2 exon 1 variant haplotypes (B, C, or D haplotypes; 100% Y). Homozygous carriers of X alleles may suffer from MBL deficiency based on low MBL protein expression. Furthermore, heterozygous carriers of MBL2 exon 1 variant haplotypes show a more profound MBL deficiency when they have an X allele on their wildtype haplotype (Garred et al., 2003a). The presence of the X/Y SNP can be easily detected using PCR-SSP (Mullighan et al., 2000; Steffensen et al., 2000; Garred et al., 2003b; Bouwman et al., 2005), which could provide additional genetic information about the MBL status of an individual. Since the promoter polymorphisms affect quantitative MBL expression but not MBL structure or function, such information can also be obtained by assessment of MBL serum concentration in addition to MBL exon 1 genotyping (Garred et al., 2003a). In view of the reported associations between MBL deficiency and a number of disease entities, detection of MBL gene polymorphisms can be of clinical relevance, especially in immune-compromised persons. In this respect, we have recently demonstrated, using the above-described methodology, that the presence of MBL variant alleles in a donor liver is a major and gene dose-dependent risk factor for severe infections after liver transplantation, irrespective of the MBL genotype of the recipient (Bouwman et al., 2005). Therefore, we propose that assessment of the MBL status may support the clinical management of patients, leading to identification of patients at risk that may require additional anti-microbial protection. Such a genetic approach can be combined with assessment of MBL serum levels (Garred et al., 2003a; Roos et al., 2004) and/or functional analysis of the MBL pathway in serum, using recently described methodology (Roos et al., 2003a; Petersen et al., 2001a). Acknowledgments The authors thank the Dutch Kidney Foundation (C03-6014) and the European Union (QLG1-CT2001-01039) for financial support of our studies. Several investigators kindly provided human DNA used in the present study, which was obtained under informed consent from healthy human subjects and from patients with various clinical conditions. Dr. Marc Seelen (Groningen, the Netherlands), Dr. Pieter S. Hiemstra, Manon E. Wildenberg, Lee H. Bouwman and Marie¨tte Lenselink (all from Leiden, the Netherlands) and Dr. Peter Garred (Copenhagen, Denmark) are acknowledged for their valuable contributions to these studies.
113
References Bernig, T., Taylor, J.G., Foster, C.B., Staats, B., Yeager, M., Chanock, S.J., 2004. Sequence analysis of the mannose-binding lectin (MBL2) gene reveals a high degree of heterozygosity with evidence of selection. Genes Immun. 5, 461. Boldt, A.B., Petzl-Erler, M.L., 2002. A new strategy for mannosebinding lectin gene haplotyping. Hum. Mutat. 19, 296. Bouwman, L.H., Roos, A., Terpstra, O.T., De Knijff, P., van Hoek, B., Verspaget, H.W., Berger, S.P., Daha, M.R., Fro¨lig, M., van der Slik, A.R., Doxiadis, I.I., Roep, B.O., Schaapherder, A.F.M., 2005. Mannose binding lectin gene polymorphisms confer a major risk for severe infections after liver transplantation. Gastroenterology 129, 408. Crosdale, D.J., Ollier, W.E.R., Thomson, W., Dyer, P.A., Jensenius, J., Johnson, R.W.G., Poulton, K.V., 2000. Mannose binding lectin (MBL) genotype distributions with relation to serum levels in UK Caucasoids. Eur. J. Immunogenet. 27, 111. Eisen, D.P., Minchinton, R.M., 2003. Impact of mannose-binding lectin on susceptibility to infectious diseases. Clin. Infect. Dis. 37, 1496. Gabolde, M., Muralitharan, S., Besmond, C., 1999. Genotyping of the three major allelic variants of the human mannose-binding lectin gene by denaturing gradient gel electrophoresis. Hum. Mutat. 14, 80. Garred, P., Madsen, H.O., Svejgaard, A., 1996. Genetics of human mannan-binding protein. In: Ezekowitz, R.A.B., Sastry, K.N., Reid, K.B.M. (Eds.), Collectins and Innate Immunity. SpringerVerlag, Heidelberg, p. 139. Garred, P., Larsen, F., Madsen, H.O., Koch, C., 2003a. Mannosebinding lectin deficiency— revisited. Mol. Immunol. 40, 73. Garred, P., Strøm, J.J., Quist, L., Taaning, E., Madsen, H.O., 2003b. Association of mannose-binding lectin polymorphisms with sepsis and fatal outcome, in patients with systemic inflammatory response syndrome. J. Infect. Dis. 188, 1394. Jack, D., Bidwell, J., Turner, M., Wood, N., 1997. Simultaneous genotyping for all three known structural mutations in the human mannose-binding lectin gene. Hum. Mutat. 9, 41. Larsen, F., Madsen, H.O., Sim, R.B., Koch, C., Garred, P., 2004. Disease-associated mutations in human mannose-binding lectin compromise oligomerisation and activity of the final protein. J. Biol. Chem. 279, 21302. Lipscombe, R.J., Sumiya, M., Hill, A.V., Lau, Y.L., Levinsky, R.J., Summerfield, J.A., Turner, M.W., 1992. High frequencies in African and non-African populations of independent mutations in the mannose binding protein gene. Hum. Mol. Genet. 1, 709. Madsen, H.O., Garred, P., Kurtzhals, J.A.L., Lamm, L.U., Ryder, L.P., Thiel, S., Svejgaard, A., 1994. A new frequent allele is the missing link in the structural polymorphism of the human mannan-binding protein. Immunogenetics 40, 37. Madsen, H.O., Garred, P., Thiel, S., Kurtzhals, J.A., Lamm, L.U., Ryder, L.P., Svejgaard, A., 1995. Interplay between promoter and structural gene variants control basal serum level of mannanbinding protein. J. Immunol. 155, 3013. Madsen, H.O., Satz, M.L., Hogh, B., Svejgaard, A., Garred, P., 1998. Different molecular events result in low protein levels of mannanbinding lectin in populations from southeast Africa and South America. J. Immunol. 161, 3169. Minchinton, R.M., Dean, M.M., Clark, T.R., Heatley, S., Mullighan, C.G., 2002. Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population. Scand. J. Immunol. 56, 630.
114
A. Roos et al. / Journal of Immunological Methods 309 (2006) 108–114
Mullighan, C.G., Marshall, S.E., Welsh, K.I., 2000. Mannose binding lectin polymorphisms are associated with early age of disease onset and autoimmunity in common variable immunodeficiency. Scand. J. Immunol. 51, 111. Neonato, M.G., Lu, C.Y., Guilloud-Bataille, M., Lapoume´roulie, C., Nabeel-Jassim, H., Dabit, D., Girot, R., Krishnamoorthy, R., Feingold, J., Besmond, C., Elion, J., 1999. Genetic polymorphism of the mannose-binding protein gene in children with sickle cell disease: identification of three new variant alleles and relationship to infections. Eur. J. Hum. Genet. 7, 679. Petersen, S.V., Thiel, S., Jensen, L., Steffensen, R., Jensenius, J.C., 2001. An assay for the mannan-binding lectin pathway of complement activation. J. Immunol. Methods 257, 107. Petersen, S.V., Thiel, S., Jensenius, J.C., 2001. The mannan-binding lectin pathway of complement activation: biology and disease association. Mol. Immunol. 38, 133. Ronaghi, M., 2001. Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3. Roos, A., Bouwman, L.H., Munoz, J., Zuiverloon, T., Faber-Krol, M.C., Fallaux-van den Houten, F.C., Klar-Mohamad, N., Hack, C.E., Tilanus, M.G., Daha, M.R., 2003a. Functional characterization of the lectin pathway of complement in human serum. Mol. Immunol. 39, 655. Roos, A., Trouw, L.A., Ioan-Facsinay, A., Daha, M.R., Verbeek, J.S., 2003b. Complement system and Fc receptors: genetics. In: Cooper, D. (Ed.), Nature Encyclopedia of the Human Genome. Nature Publishing Group, London, p. 914. Roos, A., Garred, P., Wildenberg, M.E., Lynch, N.J., Munoz, J., Zuiverloon, T., Bouwman, L.H., Schlagwein, N., Fallaux-van den Houten, F.C., Faber-Krol, M.C., Madsen, H.O., Schwaeble, W.J., Matsushita, M., Fujita, T., Daha, M.R., 2004. Antibody-
mediated activation of the classical pathway of complement may compensate for mannose-binding lectin deficiency. Eur. J. Immunol. 34, 2589. Skalnı´kova´, H., Freiberger, T., Chumchalova´, J., Grombirı´kova´, H., Sediva´, A., 2004. Cost-effective genotyping of human MBL2 gene mutations using multiplex PCR. J. Immunol. Methods 295, 139. Steffensen, R., Thiel, S., Varming, K., Jersild, C., Jensenius, J.C., 2000. Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J. Immunol. Methods 241, 33. Steffensen, R., Hoffmann, K., Varming, K., 2003. Rapid genotyping of MBL2 gene mutations using real-time PCR with fluorescent hybridisation probes. J. Immunol. Methods 278, 191. Sumiya, M., Super, M., Tabona, P., Levinsky, R.J., Arai, T., Turner, M.W., Summerfield, J.A., 1991. Molecular basis of opsonic defect in immunodeficient children. Lancet 337, 1569. Super, M., Gillies, S.D., Foley, S., Sastry, K., Schweinle, J.E., Silverman, V.J., Ezekowitz, R.A.B., 1992. Distinct and overlapping functions of allelic forms of human mannose binding protein. Nat. Genet. 2, 50. Van Hoeyveld, E., Houtmeyers, F., Massonet, C., Moens, L., Van Ranst, M., Blanckaert, N., Bossuyt, X., 2004. Detection of single nucleotide polymorphisms in the mannose-binding lectin gene using minor groove binder-DNA probes. J. Immunol. Methods 287, 227. Walport, M.J., 2001. Complement. First of two parts. N. Engl. J. Med. 344, 1058. Walport, M.J., 2001. Complement. Second of two parts. N. Engl. J. Med. 344, 1140.