Detection of Toxoplasma gondii oocysts and surrogate microspheres in water using ultrafiltration and capsule filtration

water research 44 (2010) 893–903

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/watres

Detection of Toxoplasma gondii oocysts and surrogate microspheres in water using ultrafiltration and capsule filtration Karen Shapiro a,*, Jonna A.K. Mazet b, Alexander Schriewer c, Stefan Wuertz c, Heather Fritz a, Woutrina A. Miller a, John Largier d, Patricia A. Conrad a a

Department of Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California, Davis, CA 95616, USA b Wildlife Health Center, School of Veterinary Medicine, University of California, Davis, CA 95616, USA c Department of Civil and Environmental Engineering, University of California, Davis, CA 95616, USA d Department of Environmental Science and Policy, University of California, Davis, CA 95616, USA

article info

abstract

Article history:

While reports on waterborne infections with Toxoplasma gondii are emerging worldwide,

Received 17 June 2009

detection of this zoonotic parasite in water remains challenging. Lack of standardized and

Received in revised form

quantitative methods for detection of T. gondii oocysts in water also limits research on the

20 September 2009

transport and fate of this pathogen through aquatic habitats. Here, we compare the ability

Accepted 28 September 2009

of hollow-fiber ultrafiltration and capsule filtration to concentrate oocysts in spiked tap

Available online 1 October 2009

water, fresh surface water, and seawater samples. Detection of T. gondii oocysts in concentrated samples was achieved using molecular methods, as well as visually via

Keywords:

epifluorescent microscopy. In addition to oocysts, water samples were spiked with T. gondii

Toxoplasma gondii

surrogate microspheres, and detection of microspheres was performed using flow

Surrogate

cytometry and epifluorescent microscopy. Results demonstrate that both water concen-

Microsphere

tration methods followed by microscopy allowed for quantitative detection of T. gondii

Water

oocysts and surrogate microspheres. For T. gondii oocysts, microscopy was more sensitive

Detection

than TaqMan and conventional PCR, and allowed for detection of oocysts in all water

Ultrafiltration

samples tested. Compared with flow cytometry, microscopy was also a more cost-efficient and precise method for detection of fluorescent surrogate microspheres in tap, fresh and seawater samples. This study describes a novel approach for quantitative detection of T. gondii oocysts in drinking and environmental water samples. The techniques described for concentrating and detecting surrogate microspheres have broad application for evaluating the transport and fate of oocysts, as well as the efficiency of water treatment methods for removal of T. gondii from water supplies. ª 2009 Elsevier Ltd. All rights reserved.

* Corresponding author. Department of Pathology, Microbiology and Immunology, One Shields Avenue, School of Veterinary Medicine, University of California, Davis, CA 95616, USA. Tel.: þ1 (530) 754 6144; fax: þ1 (530) 752 3349. E-mail address: [email protected] (K. Shapiro). 0043-1354/$ – see front matter ª 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.watres.2009.09.061

894

1.

water research 44 (2010) 893–903

Introduction

Waterborne toxoplasmosis is emerging as a significant health concern worldwide. The causative agent, Toxoplasma gondii, is a zoonotic, protozoan parasite. Outbreaks of acute infections with T. gondii have been documented in human populations in Panama, Canada, Brazil, French Guiana, and India (Aramini et al., 1999; Bahia-Oliveira et al., 2003; Benenson et al., 1982; Darde et al., 1998; Palanisamy et al., 2006). The prevalence of T. gondii infection in some communities is higher than 90% as documented in a study in Brazil, where the risk of exposure was associated with drinking unfiltered water (Bahia-Oliveira et al., 2003; Boia et al., 2008). In immunocompetent people, infection with T. gondii is often asymptomatic or results in flulike symptoms. However, infection in immunosuppressed patients can result in fatal disseminated toxoplasmosis from multiplication of the parasite in muscle, lungs, and neural tissue. Primary infection of pregnant women can also lead to abortion and devastating health outcomes due to fetal infection via the placenta (Jones et al., 2003). Waterborne transmission of oocysts to expectant mothers is believed to play an important epidemiological role in congenital disease (Elsheikha, 2008). Severe birth defects, mental retardation, and vision defects are serious sequelae in children born with congenital toxoplasmosis. Less obvious clinical outcomes can also take years to manifest and include ocular disease, learning disabilities, and possibly mental illness, such as schizophrenia (Jones et al., 2003; Mortensen et al., 2007). T. gondii is a highly successful parasite that can infect virtually all warm-blooded animals as intermediate hosts, including humans, wildlife, and domestic animals (Dubey and Jones, 2008). However, only felids are known to serve as definitive hosts for T. gondii, in which the parasite can undergo sexual multiplication in the intestinal epithelium, resulting in fecal shedding of high numbers of oocysts after primary infection (Dubey et al., 1970). Oocysts are the environmentally resistant stage of the parasite and can survive months to years in soil and water under a range of ambient conditions (Kuticic and Wikerhauser, 1996; Lindsay and Dubey, in press; Yilmaz and Hopkins, 1972). Numerous studies have demonstrated that common water treatment methods including chlorination, application of iodine tablets, ozonification, UV irradiation, and radio frequency heating, are ineffective in complete inactivation of T. gondii oocysts (Benenson et al., 1982; Dumetre et al., 2008; Wainwright et al., 2007a,b). In people, waterborne transmission of T. gondii occurs following accidental ingestion of oocysts in contaminated water supplies (Bowie et al., 1997). Severe, systemic toxoplasmosis has been reported in immunocompetent adults following waterborne infection with T. gondii (Carme et al., 2002; Darde et al., 1998). While the importance of waterborne toxoplasmosis is becoming more apparent, tracking the transport mechanisms of T. gondii in aquatic systems and identifying sources of contaminated water remains difficult due to the lack of adequate methods for T. gondii detection in the environment (Dumetre and Darde, 2003). To date, only one report has described successful isolation of T. gondii from water implicated in a waterborne outbreak using bioassays in chickens and pigs (de Moura et al., 2006). While such assays are

generally considered gold standards, they are time consuming, costly, and qualitative rather than quantitative. Following another toxoplasmosis waterborne outbreak in Canada, researchers attempted cartridge filtration based on a United States EPA-approved protocol for concentration of related protozoa followed by bioassay; however, identification of the parasite from reservoir water was not successful (IsaacRenton et al., 1998). The objective of this study was to develop rapid, costeffective, and quantitative methods for the detection of T. gondii oocysts, as well as surrogate microspheres in drinking and environmental waters. Evaluation of detection methods for two types of autofluorescent microspheres with surfacechemical characteristics similar to T. gondii oocysts was undertaken to provide a tool for future studies on the transport and fate of this parasite in aquatic environments (Shapiro et al., 2009). This study compares the ability of two water concentration techniques, hollow-fiber ultrafiltration and capsule filtration, to concentrate oocysts and microspheres spiked into tap and environmental water samples. Subsequent detection of T. gondii oocysts and microspheres in concentrated retentates (ultrafiltration) or eluates (capsule filtration) was performed via molecular methods, flow cytometry, and epifluorescent microscopy.

2.

Materials and methods

2.1.

T. gondii oocyst production

All animal experiments were conducted with the approval and oversight of the Institutional Animal Care and Use Committee at the University of California, Davis, which is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, International. Female SwissWebster mice (Charles River Laboratories, Wilmington, MA) and 10 wk-old kittens (Nutrition and Pet Care Center, Department of Molecular Biosciences, University of California, Davis, California) were used for oocyst production. An indirect fluorescent antibody test (IFAT) was used as described (Dabritz et al., 2007a) to prescreen sera from mice and kittens at a 1:40 dilution to ensure negative status prior to experimental infection with T. gondii. To produce oocysts, two kittens were fed 16 brains of mice inoculated 35 days prior to euthanasia with culture-derived tachyzoites of a Type II isolate of T. gondii (M4 strain provided by S. E. Wright, Moredun Research Institute, Edinburgh, Scotland, UK). Feces from kittens were examined daily by zinc sulfate double centrifugation to detect shedding of oocysts (Dabritz et al., 2007b). Once detected, unsporulated oocysts were harvested from fecal samples using sodium chloride (1.2 s.g.) gradient preparation as previously described (Dabritz et al., 2007b). Sporulation (>90%) was achieved by aeration in 2% sulfuric acid at 25  C over 7–10 days, after which oocysts were suspended in fresh sulfuric acid and placed at 4  C until use (within 6 mo of production). Prior to filtration experiments, sulfuric acid was removed by washing oocysts twice in PBS and twice in ultra-pure water to achieve a pH between 6 and 7. Oocysts were resuspended in approximately 1.5 ml ultra-pure water and placed within

water research 44 (2010) 893–903

a heating block set at 80 degrees Celsius for 15 minutes for inactivation. Oocysts were then counted using a hemacytometer chamber and epifluorescent microscopy.

2.2.

Surrogate microspheres

Two types of autofluorescent, carboxylate-modified polystyrene microspheres previously evaluated as potential T. gondii surrogate particles were used in this study (Shapiro et al., 2009): Dragon Green (DG) microspheres (10.35 mm diameter, density 1.06 s.g., COOH at 1.0 meq/g titration), and Glacial Blue (GB) microspheres (8.6 mm diameter, density 1.06. s.g., COOH at 800 meq/g) were obtained from Bangs Laboratory, Fishers IN, USA (product numbers FC07F/5493 and PC06N/ 8319, respectively).

2.3.

Water collection and sample preparation

Three water types were used for spiking experiments. Tap water was collected directly from the laboratory faucet into 20 Liter polypropylene carboys. Sea water from Monterey Bay was collected from Moss Landing Harbor (36 480 3500 N, 121 470 800 W) during the end of the flood tide. Freshwater runoff was collected from Tembladero Slough, a creek that drains surface and agricultural runoff from the northwestern portion of the Salinas watershed in central California, approximately one mile south of the town of Moss Landing (36 460 600 N, 121 460 200 W). For the environmental waters, 120 l of each water type were collected using a 12 V DC (Purge) pump (Geotech, Denver, CO, USA) to suction water into six 20 l carboys. Water was transported back to UCDavis within 4 hours of collection and kept at 4 degrees Celsius until use (within 7 days). A one l aliquot of each water type was reserved for water quality analyses. Parameters tested included salinity (Sybon Refractometer, Bethesda, MD, USA), pH (Accuemet pH meter, Fisher Scientific, Pittsburgh, PA, USA), turbidity (Micro 100 Turbidimeter, HF Scientific Inc., Fort Myers, FL, USA), dissolved organic carbon (Shimadzu TOC/TN analyzer, Columbia, MD, USA), total suspended solids (TSS), TSSNitrogen and TSS-Carbon (Carlo Erba NC1500, Interscience BV, Breda, The Netherlands). Samples were prepared for filtration experiments by aliquoting 10 l volumes of each water type and spiking with T. gondii oocysts, DG microspheres and GB microsphere to achieve a final concentration of 10, 100, or 1000 of each particle type per liter. Spiking levels were tested in triplicate for all water types.

2.4.

Water concentration

Hollow-Fiber Ultrafiltration. Water was concentrated via ultrafiltration by continuously pumping ten-liter samples through a recirculating small volume hollow fiber ultrafiltration system until the volume of retentate was reduced to approximately 50 ml (Rajal et al., 2007a). Filtration time lasted up to 40 min using a flow of 4 l/min, and an applied backpressure of 15–18 psi. The retentate was collected from the outflow port, and the filter was removed from the system apparatus and flushed back and forth with 10 cycles of 50 ml of glycin solution (0.05 M Glycin and 0.1% Tween 80) using two 60 ml syringes (Rajal et al., 2007a). The glycin wash was combined

895

with the collected retentate, and the exact volume of the final retentate recorded. The retentate was then well mixed and divided into two portions with one designated for molecular analyses (TaqMan and conventional PCR) and the other for flow cytometry and epifluorescent microscopy. Samples of each water type (10 l) were processed without oocysts or microspheres. These samples were filtered following the tap water experiment and before freshwater and seawater experiments to verify that T. gondii was not present in the environmental water samples. Two hollow-fiber smallvolume systems and three filters were used for concentrating all tap, sea- and freshwater samples. In between samples, each system was thoroughly cleaned by 10 min recirculation with a 2 l solution containing 64 g/l NaOH and 0.5 g/l NaOCl using a flow of 10 l/min, followed by 10 min recirculation with deionized water. The filters were flushed with a detergent as described above followed by deionized water for at least 20 minutes. Using a new filter for each sample was not feasible due to the high cost of the hollow-fiber filters (Microza membrane, Pall corporation, $900/filter). For quality assurance, a lab blank consisting of 10 l of deionized water (no particles spiked) was filtered at the end of each filtration day to assess for any carry-over potential between experiments. Spiked samples were processed in triplicate from lower to higher spiking concentrations, and three separate filters were used for each of the replicates. Filtrations of each water type were performed on separate days. Due to storage conditions and flushing of membranes after storage, filters were assumed to be free of contamination prior to use. Capsule Filtration. Aliquots (10 l) of seawater from Moss Landing and freshwater from Tembladero Slough were spiked with T. gondii oocysts and microspheres as described above and concentrated using Envirocheck HV capsules (Pall Corporation, Ann Arbor, MI, USA). For each water type, a negative control consisting of 10 l without any spiked particles was also processed. Filters were eluted following EPA method 1623 protocol (U.S.EPA, 2001), and the eluates were centrifuged down to 100 ml for particle detection using conventional PCR (T. gondii) and epifluorescent microscopy (T. gondii and surrogate microspheres).

2.5.

TaqMan PCR

Ten ml of the each retentate were subjected to three consecutive freeze/thaw cycles. The resultant lysate was centrifuged for 5 min at 4550  g, and the supernatant added to a QIAamp Maxi Spin column (Qiagen, Valencia, CA, USA) using a vacuum manifold (Qiagen) under a suction pressure of 800 mbar. The column was washed once with 5 mL buffer AW1 (Qiagen) and 5 mL buffer AW2 (Qiagen). The column was placed into a sterile 50 mL collection tube, centrifuged 4550  g for 15 min, and incubated at 70  C for 10 min to remove traces of AW1 and AW2. Nucleic acid was eluted with an addition of 600 mL of ultra-pure water, followed by centrifugation at 4550  g for 5 min. Another 600 mL of ultra-pure water were added to the column and centrifuged at 4550  g for 10 min (Rajal et al., 2007a). Extracted nucleic acid was stored at 70  C for PCR analysis. T. gondii ssrRNA was amplified by quantitative PCR using the following oligonucleotides: Tox18-213f 50 -CCGGTGGTCCTCAGGTGAT30 Tox18-332r 50 -TGCCACGGTAGTCCAATACAGTA-30 ; and

896

water research 44 (2010) 893–903

Tox18-249p 50 -FAM-ATCGCGTTGACTTCGGTCTGCGACTAMRA-30 (Arkush et al., 2003). A one-tube TaqMan RT (Reverse Transcription) – PCR was used to determine the presence of T. gondii ssrRNA after filtration and extraction. Twenty-five ml of reaction contained Tris–HCl (pH 8.3, 10 mM), KCl (50 mM), MgCl2 (5 mM), stabilized passive dye ROX (Applied Biosystems, Foster City, CA, USA), dATP, dCTP, dGTP, and dTTP (800 nM each), forward primer (800 nM), reverse primers (400 nM each), TaqMan probe (80 nM), MMLV-RT (6 U), AmpliTaq Gold DNA polymerase (1.25 U), nucleic acid (10 ml), and BSA (w1.3 ug/rxn) to a final concentration of 50 ng/mL. Cycling conditions were 30 min at 48  C, 10 min at 95  C, followed by 40 cycles at 95  C for 15 s, and 60  C for 1 min using an ABI Prism 7000 (Applied Biosystems). Cycle threshold values were calculated with a threshold set to 0.09, and a baseline of 3–15 cycles. Retentates were processed in duplicate and determined to be positive if an exponential amplification signal was produced. T. gondii oocysts served as a positive control, and a negative control (DI water) was measured for every other qPCR plate.

2.6.

Conventional PCR

Following vacuum filtration, the membranes were placed on glass slides, and a drop of glycerol mounting media and a round 25 mm cover slip were applied on top of each membrane. The entire filter was scanned using a Zeiss Axioskop epifluorescent microscope equipped with a UV emission filter set (emitter 460/50 nm band pass filter; Chroma #11000 v3) at 100X, and the numbers of T. gondii oocysts, DG microspheres, and GB microspheres were enumerated. For each retentate/eluate, triplicate membranes were processed, and the mean for each particle type across the three membranes was calculated. The percent particle recovery was calculated using Eq. (1): Particle recovery ð%Þ ¼

Number of particles counted  100 Number of particles expected (1)

where the number of expected particles was calculated using Eq. (2): Total number of particles spiked Retentate or eluate volume ðmlÞ  Volume of retentate or eluate applied

For each retentate or eluate, DNA was extracted from triplicate 1.5 ml aliquots. Each aliquot was centrifuged at 13,000 rpm for 5 minutes. The supernatant was removed and the remaining 25 ml pellet was extracted using one freeze/ thaw cycle followed by the protocol described by QIAamp DNeasy Blood and Tissue kit (Qiagen). DNA amplification was performed according to a previously described nested PCR protocol that targets a repetitive element sequence (Homan et al., 2000). Internal primers were designed in our lab for a nested reaction (50 AGAAGGGACAGAAGTCGAAG 30 forward and 50 CTCCACTCTTCAATTCTCTCC 30 reverse). Primary and secondary PCR reactions were carried out in 50 ml reaction volumes containing PCR buffer with MgCl2 (15 mM), dNTP (2.5 mM), forward primer (500 nM), reverse primer (500 nM), BSA (16 mg), Taq Polymerase (1.5 U), and 10 ml DNA template for external reaction, with 2 mL DNA amplicon for internal reaction. The secondary amplification products were detected by gel electrophoresis in 2% agarose gel containing ethidium bromide. Amplified products were visualized by UV transillumination and photographed. A positive control (DNA extracted from T. gondii oocysts) and negative control (DI water) were included in each gel.

2.7.

Epifluorescent microscopy

Epifluorescent microscopy was performed to visualize T. gondii oocysts and surrogate microspheres on membranes that were processed with concentrated retentates or eluates via membrane filtration. Membrane filtration was performed by modifying MicroFil filtration funnels (Millipore Corporate, Billerica, MA) to accommodate a 25 mm membrane using a gasket with a 22 mm inner diameter circle. A 25 mm diameter mixed cellulose filter with a 5 mm pore size (Millipore) was placed on the Microfil stage, overlaid with the gasket, and enclosed within the funnel. The modified MicroFil funnel was placed on top of a 1 l flask connected to a vacuum hose. Ten ml of tap and seawater retentates/eluates and 5 ml of freshwater retentates/eluates were vacuum filtered onto membranes.

onto membrane ðmlÞ

(2)

Randomly selected membranes from each spiking level and water type used in the ultrafiltration study were also processed for molecular detection of T. gondii DNA using conventional PCR. The cover slips were gently removed and the membranes placed into 50 ml Falcon tubes with 5 ml of ultra-pure water. Tubes were sonicated at 10% frequency for 3 min and three aliquots of 1.5 ml were divided into three microcentrifuge tubes. The DNA extraction and PCR procedures were then performed as described above.

2.8.

Flow cytometry

A MoFlo flow cytometer and cell sorter (Beckman Coulter, Fort Collins, CO, USA) was used for detection of surrogate autofluorescent microspheres in ultrafiltration retentates. This instrument is equipped with 3 lasers and 12 detector channels. Fluorescent characteristics (excitation/emission) of the two surrogate microspheres were reported from the manufacturer as follows: DG 480/520 nm and GB 360/450 nm. To account for variability in instrument recovery in different samples, a known number of Cyto-Cal beads (a counting reference bead, Thermo Scientific, Waltham, MA, USA) were also spiked into each tube immediately prior to measurement. CytoCal beads are infused with two dyes, Firefli Fluorescent Green 488/510 nm and Red at 570/600 nm. Optimal detection of DG and GB microspheres along with CytoCal beads was achieved using the following instrument parameters: Excitation of DG microspheres using 100 mW of 488 nm and detection of emission with a 530/50 nm band pass filter; excitation of GB microspheres using 100 mW of 407 nm and detection of emission with a 450/60 nm band pass filter; and excitation of CytoCal reference beads using 80 mW of 568 nm and detection of emission with a 605/55 nm band pass filter. Due to the brightness of the DG microspheres and the high power of the laser, two neutral density filters (1.0 and 0.3 mm) were placed in front of the DG detector channel. Enumeration of surrogate

water research 44 (2010) 893–903

microspheres in retentates using cytometry was achieved by processing 1 ml of retentate through the MoFlo. Triplicate 1ml samples were processed for each retentate. Flow cytometry data was acquired using Summit software (Beckman Coulter Fort Collins, CO, USA) and the data analyzed using FlowJo software (Treestar Inc., Ashland, OR, USA). Gates were applied to each sample based on plots obtained by processing CytoCal, DG, and GB microspheres individually in ultra-pure water. Events that matched fluorescent criteria within the three designated gates were counted as Cytocal beads, DG, or GB microspheres depending on the gate that enclosed their emission characteristics. Following manufacturer recommendations, corrected microsphere counts were obtained using Eq. (3): Number of Cytocal microspheres spiked Number of Cytocal microspheres detected  Number of surrogate microspheres detected

(3)

A mean, standard deviation, and range for the 9 samples processed for each water and spiking level was calculated.

2.9.

Statistical analyses

The percent recoveries of microspheres and T. gondii oocysts in spiked water samples were compared between the ultrafiltration and capsule filtration concentration methods, and between flow cytometry and membrane filtration microsphere detection techniques, using a Mann–Whitney test statistic (P  0.05) (SPSS software, Chicago, IL, USA). The sensitivity of ultrafiltration and capsule filtration methods followed by epifluorescent microscopy for detection of T. gondii oocysts in sea and fresh water was also estimated by fitting a Poisson model to the observed oocyst count, using spiking level as the independent variable (STATA software, College Station, TX, USA). The method sensitivity S(ci), defined as the probability of detecting at least one oocyst per sample, was calculated as shown in Eq. (4), where ri is the exponentiated coefficient for recovery, ci is the spiking level, and Wi is the proportion of the sample tested (Hoar et al., 2000). Sðci Þ ¼ 1  eri ci Wi

3.

Results

3.1.

T. gondii detection following ultrafiltration

(4)

The water quality characteristics of the tap water, seawater, and freshwater samples used in the ultrafiltration and capsule filtration experiments are summarized in Table 1. A summary of the detection of T. gondii in spiked tap and environmental waters concentrated using hollow-fiber ultrafiltration is presented in Table 2. Using molecular methods, T. gondii DNA was detected in retentates from spiked tap water and seawater (Table 2). In tap and seawater retentates, detection of T. gondii was achieved using conventional PCR in water spiked at all levels; however, with TaqMan PCR, DNA was detected at all spiking levels in tap water but only at the 1000 oocyst/l spiking level in seawater.

897

Processing retentates through the membrane filtration technique followed by epifluorescent microscopy allowed for visual detection of T. gondii oocysts in all water types and across all spiking levels. In selected membranes that were processed after water filtration for conventional PCR analysis, T. gondii DNA was detected in tap water and seawater samples, but not on membranes processed with freshwater samples.

3.2. Surrogate microsphere detection following ultrafiltration Table 3 summarizes the flow cytometry and epifluorescent microscopy results for detection of surrogate microspheres in ultrafiltration retentates. A higher percentage of Dragon Green (DG) microspheres was detected using flow cytometry as compared with microscopy in the seawater 100/l, seawater 1000/l, and freshwater 1000/l retentates (Mann–Whitney; P  0.05). Detection of DG microspheres was higher using epifluorescent microscopy in the tap 10/l, tap 1000/l, seawater 10/l, and freshwater 100/l retentates (Mann–Whitney; P  0.05). No significant difference between the two methods was detected in the remaining water types and spiking levels. Detection of Glacial Blue (GB) microspheres and T. gondii oocysts was not possible using flow cytometry because autofluorescent debris interfered with detection of these particles. This background autoflorescence was seen in the concentrated tap water as well as the environmental negative control waters, which prevented identification of GB microspheres and oocysts by flow cytometry. Based on epifluorescent microscopy, recoveries of GB microspheres were 29% (SD 41), 27% (SD 22), and 28% (SD 17) in tap water samples spiked with 10, 100 and 1000 microspheres/l, respectively. Analyses of lab blanks in the ultrafiltration study indicated a low level of carry-over (0.1% of spiked particles for seawater and 0.3% of spiked particles for freshwater from the preceding sample were recovered in negative controls) that is not anticipated to have altered results significantly. In addition to carryover of microspheres, oocysts were visualized in the seawater negative control, and one out of the three extracted replicates of the seawater negative control retentate tested positive for T. gondii DNA using conventional PCR. None of the negative controls tested positive using TaqMan PCR. Detection of particle carry-over in the negative controls likely occurred because they were processed immediately after samples spiked with 10,000 particles (highest spiking level). This finding suggests that caution must be taken when analyzing field samples using a reusable ultrafiltration system to assure that cross-contamination between samples is minimized. Following the evaluation of the results of these experiments, our laboratory has incorporated additional cleaning steps between samples to further reduce the chance of particle carryover.

3.3.

Comparison of ultrafiltration and capsule filtration

The percent detection of spiked microspheres and T. gondii oocysts using membrane filtration followed by epifluorescent microscopy on water concentrated by ultrafiltration or capsule filtration is shown in Fig. 1. In both concentration

898

water research 44 (2010) 893–903

Table 1 – Water quality parameters of samples collected for spiking experiments and concentration using either ultrafiltration or capsule filtration. Experiment

Water type

Salinity (ppt/sp gr)a

pH

Turbidity (NTU)

DOCb (mg/L)

TSSc (mg/L)

TSS-Cd (mg/L)

TSS-Ne (mg/L)

Ultrafiltration

Tap Seawater Freshwater

0/1.000 36/1.027 1 /1.000

8.26 8.13 8.61

0.2 2.0 108

0.5 1.3 8.4

ND 16 112

ND 0.05 1.00

ND 0.004 0.130

Capsule filtration

Seawater Freshwater

34/1.026 2/1.002

7.80 7.93

76 79

22.7 8.0

110 50

1.66 1.97

0.160 0.240

ND ¼ Not detected. a Parts per thousand/specific gravity. b Dissolved organic carbon. c Total suspended solids. d Total suspended solids – Carbon component. e Total suspended solids – Nitrogen component.

methods, detection of particles was generally higher in seawater than freshwater, and a higher proportion of DG microspheres were detected compared to GB microspheres or T. gondii oocysts. Compared with ultrafiltration, capsule filtration yielded significantly higher recovery of particles in the following samples: DG microspheres in seawater 1000/l, GB microspheres in freshwater 100/l and 1000/l, and T. gondii oocysts in seawater 1000/l and freshwater 100/l and 1000/l (Mann–Whitney; P < 0.05). In all other samples there were no differences in particle recovery between the two water concentration methods. Surrogate microspheres or oocysts were not visualized in any of the negative control samples using microscopy. In addition to microscopical detection of T. gondii oocysts in spiked environmental waters concentrated using capsule filtration, detection of parasite DNA was achieved using conventional PCR in 2/9 (22%) of seawater 100/l and 7/9 (77%)

of the seawater 1000/l replicates. T. gondii DNA was not detected in the seawater 10/l eluates, any of the freshwater eluates, or in negative controls. Fig. 2 displays the sensitivity curves for T. gondii oocyst detection using the hollow-fiber ultrafiltration and capsule filtration methods for concentrating water, followed by oocyst visualization using membrane filtration and epifluorescent microscopy. For both concentration methods, a higher probability of detecting at least one oocyst was seen in spiked seawater compared with freshwater samples, as is evident by the left shift of the curves. In both water types, using capsule filtration increased the probability of oocyst detection. In seawater, using capsule filtration improved the detection threshold in which 90% of the samples were correctly identified as positive (DT90), from approximately 320 to 100 oocysts/ 10 l, and in freshwater from approximately 7600 to 1700 oocysts/10 l.

Table 2 – Detection of Toxoplasma gondii oocysts in spiked water samples (10 l) that were concentrated using ultrafiltration. Concentrated retentates were tested directly by TaqMan and conventional PCR, or processed through membrane filtration followed by epifluorescent microscopy and conventional PCR. Water type

Spiking concentration (oocysts/l)a

Retentate testing b

Membrane filtration c

TaqMan PCR

Conventional PCR

Epifluorescent microscopyd

Conventional PCRe

Tap

10 100 1000

4/6 6/6 6/6

1/9 8/9 9/9

15 (9.8) 24 (17.5) 30 (11.3)

NA 8/9 9/9

Seawater

10 100 1000

0/6 0/6 6/6

1/9 8/9 9/9

8 (11.5) 15 (5.5) 10 (6.5)

1/9 9/9 9/9

Freshwater

10 100 1000

0/6 0/6 0/6

0/9 0/9 0/9

4 (8.8) 2 (1.7) 2 (0.6)

0/9 0/9 0/9

NA ¼ Not assessed. a Triplicate samples for different spiking levels and one negative control were tested for each water type. b Duplicate aliquots of extracted retentates were tested with positive/replicates shown. c Triplicate aliquots of extracted retentates were tested with positive/replicates shown. d Results presented as mean percent detection (SD). e One membrane from each water type and spiking level group was randomly selected for conventional PCR analysis and tested in triplicate.

899

water research 44 (2010) 893–903

Table 3 – Percent detection of spiked Dragon Green microspheres detected via flow cytometry or membrane filtration followed by epifluorescent microscopy on retentates of spiked water (10 l) concentrated using hollow-fiber ultrafiltration. Water type

Spiking concentration (microspheres/l)a

Flow cytometry Mean (SD)

Epifluorescent microscopy

Range

Mean (SD)

Range

Tap

10 100 1000

62 (146) 45 (20) 47 (27)

0–435 12–70 28–117

36 (21.1)* 45 (16.5) 54 (8.1)*

10–71 30–64 42–64

Seawater

10 100 1000

39 (76.4) 49 (19.4)* 103 (24.3)*

0–184 15–73 67–146

37 (29.1)* 24 (4.4) 26 (7.3)

8–101 18–30 14–32

Freshwater

10 100 1000

0 (0) 15 (41.5) 16 (15.1)*

0–0 0–117 0–52

11 (18.4) 8 (6.2)* 7.9 (6.24)

0–51 0–18 3–11

* Method that ranked significantly higher for detection of Dragon Green microspheres at each spiking level and water type (Mann–Whitney; P  0.05). a Triplicate samples for different spiking levels were tested for each water type.

4.

Discussion

The ability to visualize T. gondii oocysts via epifluorescent microscopy on membranes processed with concentrated water samples offers a quantitative and cost-effective method for detection of this parasite in drinking and environmental waters. Visualization of T. gondii oocysts under UV excitation is possible due to the autofluorescent nature of the oocyst wall, a property that has been described in several apicomplexan protozoan parasites (Lindquist et al., 2003). Microscopy enabled quantitative detection of T. gondii oocysts in spiked water samples that were concentrated using either ultrafiltration or capsule filtration in which molecular methods failed to detect parasite DNA. Detection of T. gondii oocysts using membrane filtration was described in a recent study (Borchardt et al., in press), in which spiked oocysts were visualized in concentrated samples from drinking water utilities. In this study, visual detection of T. gondii oocysts using membrane filtration followed by epifluorescent microscopy was achieved across all spiking levels in concentrated tap water, sea water, and freshwater runoff draining agricultural and urban habitats. This was in contrast to molecular methods that failed to detect T. gondii DNA in any of the spiked freshwater samples. The freshwater retentates (ultrafiltration) and eluates (capsule filtration) were visually very dark brown; the amount and nature of the suspended and dissolved constituents likely caused a considerable amount of inhibition of the amplification of nucleic acids for the PCR (Wilson, 1997). It is interesting to note that turbidity and concentration of dissolved organic carbon (DOC) alone can not account for the PCR inhibition, since T. gondii DNA detection was achieved using conventional PCR in the seawater samples from Moss Landing that were concentrated using capsule filtration. In the capsule filtration experiments, the turbidity of the seawater was similar to that of freshwater samples (76 and 79 NTU, respectively), and the seawater had a higher concentration of DOC than freshwater (110 and 50 mg/L, respectively). Strong inhibition of the PCR reaction has been previously attributed to a brown-tinted component of soil that is distinct from humic and fulvic acids

(components of DOC) (Watson and Blackwell, 2000). The presence of such substances is likely to occur in freshwater runoff samples such as those collected in Tembladero Slough in this study. In the ultrafiltration retentates, the TaqMan PCR procedure performed slightly better than conventional PCR with tap water samples; however, the conventional PCR performed better than TaqMan PCR for detection of T. gondii DNA in seawater samples. TaqMan PCR yielded positive results in 67% of tap water samples spiked at 10 oocysts/l, and 100% of tap water samples spiked with 100 and 1000 oocysts/l. However, the only seawater retentates that tested positive for T. gondii via TaqMan PCR were the samples spiked with 1000 oocysts/l (100% detection). In comparison, conventional PCR performed equally well with oocysts spiked in tap and seawater samples where T. gondii detection was achieved in 11, 89, and 100% of the samples spiked with 10, 100, and 1000 oocysts/l, respectively. Performance of the two PCR assays may have differed due to the different nucleic acid extraction and/or amplification procedures used in the TaqMan and conventional PCR protocols. For example, the higher proportion of BSA used in conventional PCR reactions (16 mg versus 1.3 mg per reaction) may have improved detection of parasite DNA in seawater by greater reduction of PCR inhibitors. Conventional PCR was also performed on membrane filters (after they were scanned microscopically for visual detection of oocysts) to molecularly confirm the presence of T. gondii. Results show a similar detection pattern as was obtained by performing conventional PCR directly on retentates, with T. gondii DNA detected in tap and seawater-processed membranes, but not with freshwater-processed membranes. These results are particularly significant for the future application of the membrane filtration technique in water quality testing for T. gondii in drinking and environmental waters. The molecular confirmation of T. gondii following quantitative enumeration of oocysts via microscopy after membrane filtration allows for definitive classification of the parasite in field samples, in contrast to the identification of oocysts which should only be considered to be ‘‘Toxoplasma-like’’ based on morphological appearance.

900

water research 44 (2010) 893–903

Fig. 1 – Percent of spiked particles detected in seawater and in freshwater samples that were concentrated using either a) ultrafiltration or b) capsule filtration. Detection of particles was achieved via epifluorescent microscopy performed on membrane-filters processed with concentrated samples. Triplicate samples for each water type and spiking level were tested. Error bars represent one standard deviation from the mean. Dragon Green microspheres (DG); Glacial Blue microspheres (GB); Toxoplasma gondii oocysts (T. gondii).

Oocysts belonging to related and morphologically indistinguishable protozoans including Hammondia spp., Besnoitia spp., and Neospora spp., may be present in environmental samples. Differentiating T. gondii from other parasites is important, because the latter have different definitive host distribution (canids versus felids for H. heydorni and Neospora spp.), and are not known to cause disease in humans (Dubey and Sreekumar, 2003; Lindsay et al., 1999; Wallace and Frenkel, 1975). The conventional PCR assay used in this study is highly specific to T. gondii, and false positive results with

DNA from related protozoan parasites including Neospora or Hammondia spp. has been previously shown not to occur (Homan et al., 2000; Schares et al., 2008). Finally, due to the lower cost of membrane filtration (less than $4/sample vs. $10/sample with conventional PCR), using this method to screen samples followed by molecular confirmation of only positive samples in which oocysts are visualized can reduce the cost of testing water for T. gondii. In the ultrafiltration experiments, detection of T. gondii oocysts and surrogate microspheres in concentrated

water research 44 (2010) 893–903

Probability of detecting oocysts

1 CF Sea HFF Sea CF Fresh HFF Fresh

0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

1

10

100

1000

10000

No. T. gondii oocysts per 10 Liters Fig. 2 – Sensitivity of capsule filtration (CF) and hollow-fiber ultrafiltration (HFF) followed by epifluorescent microscopy for detecting Toxoplasma gondii oocysts in spiked seawater and freshwater. The sensitivity was modeled using Poisson regression.

retentates was attempted using both flow cytometry and membrane filtration followed by epifluorescent microscopy. Microscopy was a more cost-effective and precise method for quantitative detection of fluorescent T. gondii surrogate microspheres as compared to flow cytometry. Flow cytometry could not be used for enumeration of Glacial Blue (GB) microspheres or T. gondii oocysts because of background debris present in all three water types that emitted autofluorescence. Differentiation of GB microspheres and oocysts from debris was attempted based on both their size and blue fluorescence properties, but this approach was not successful because of the similar autofluorescence and scatter characteristics of the debris. Detection of Dragon Green microspheres (DG) was possible using both flow cytometry and microscopy. The smaller range of detection that was obtained with microscopy suggests that this method may be more precise for detection of DG microspheres compared to flow cytometry. This could be due to the smaller volume (1 ml per replicate) of retentate analyzed using flow cytometry versus microscopy (10 ml per replicate for tap and seawater and 5 ml per replicate for freshwater). The ability to analyze a larger proportion of the retentate increases the probability of detecting particles, and improves the estimate of concentration by providing a more representative sample. In addition, membrane filtration followed by microscopy is significantly less costly and more readily available than flow cytometry instruments. The summary of the epifluorescent microscopy results for ultrafiltration and capsule filtration experiments presented in Fig. 1 illustrates that the percent detection of the brighter DG microspheres is generally higher than detection of GB microspheres and T. gondii oocysts. The similar percent detection seen between GB microspheres and oocysts may be due to their similar purple-blue fluorescence appearance. Because much of the background debris emitted a similar autofluorescence color as GB microspheres and T. gondii oocysts, only particles that could be definitely identified as either

901

microspheres or oocysts based on their morphology were counted during microscopical examinations of the membranes. Thus, reduced fluorescence intensity coupled with background debris likely resulted in the lower detection of GB microspheres and T. gondii oocysts compared with DG microspheres. For all particles, detection was lower in freshwater samples than in seawater samples. The lower probability of detecting T. gondii oocysts in freshwater was also evident from the right shift of the sensitivity curves for this water type in Fig. 2. Membranes that were processed with freshwater retentates or eluates were visibly dark brown (compared with light yellow for seawater membranes), and the large amount of dark debris resulted in diminished ability to visualize both microspheres and T. gondii oocysts. Yet, the ability to microscopically identify oocysts in this water type at all is significant, because molecular methods failed to detect T. gondii DNA in any of the freshwater samples. Improved recovery of T. gondii oocysts from environmentally challenging samples may be achieved as better parasite concentration methods are developed, including production of monoclonal antibodies against the oocyst wall which will enable separation of T. gondii from environmental debris using immunomagnetic separation (IMS) and visualization via direct fluorescence antibody (DFA) testing. Monoclonal antibodies have been developed against the oocyst and sporocyst walls (Dumetre and Darde, 2005, 2007). However, recovery of T. gondii using the IMS/DFA method has not been previously described in environmental samples. A comparison of the two water concentration methods (Fig. 1) indicates a similar percent detection of particles via epifluorescent microscopy using either ultrafiltration or capsule filtration in the majority of the samples. However, concentrating water using capsule filtration yielded a higher percent detection of particles in some samples. The left shift of the sensitivity curves (Fig. 2) for capsule filtration compared to ultrafiltration further illustrates that capsule filtration yielded a higher probability of detecting T. gondii oocysts in both seawater and freshwater samples. An advantage of using capsule filtration compared to ultrafiltration for water concentration is that the risk of cross-contamination between samples is reduced because a new capsule filter is used for processing each sample. In addition, this method is relatively simple to perform and is more readily available to potential users than the ultrafiltration system. While our results suggest that capsule filtration performed better than ultrafiltration for particle recovery in this study, several investigators highlight that ultrafiltration offers advantages over capsule filtration. In a study that compared recovery of the zoonotic protozoan parasite Cryptosporidium parvum from surface waters, the recovery of oocysts was significantly higher using hollow fiber than the capsule filtration method (Simmons et al., 2001). Another study reported similar performance using ultrafiltration and capsule filtration with low turbidity waters, but a higher recovery of C. parvum oocysts was obtained using ultrafiltration in high turbidity samples (Kuhn and Oshima, 2002). Additionally, an advantage offered by the ultrafiltration system is that it allows for the concentration of multiple pathogens simultaneously, including viruses, bacteria and parasites (Hill et al., 2007; Morales-Morales et al., 2003; Rajal et al., 2007b).

902

5.

water research 44 (2010) 893–903

Conclusions

Concentration of water using either ultrafiltration or capsule filtration followed by microscopy of membrane filters offers a novel tool for the quantitative detection of T. gondii oocysts in drinking and environmental waters. Visual detection of T. gondii oocysts on membranes was achieved in concentrated tap water, sea water and freshwater runoff, even at low concentrations of spiked organisms. Molecular confirmation of T. gondii DNA following quantitative enumeration of oocysts on membranes also offers a definitive method for parasite detection that could be applied in future field and waterborne toxoplasmosis outbreak investigations. Membrane filtration followed by epifluorescent microscopy allowed quantitative detection of both DG and GB surrogate microspheres at low concentrations and in all water types tested. Application of these surrogate particles in transport studies will provide a new tool for investigating the transport and fate of T. gondii oocysts in waterways, as well as for improving current water treatment processes for removal of this zoonotic pathogen from contaminated water.

Acknowledgments This work was supported by the National Science Foundation, Ecology of Infectious Disease Grant 0525765. Daniel Rejmanek is acknowledged for designing the internal primers that were used in the nested conventional PCR assay. We thank Andrea Packham and Ann Melli for assistance with mice inoculation and T. gondii oocyst production. Jennifer Chou and Jennifer Hogan assisted in the capsule filtration experiments and sample analyses. We also thank Carol Oxford and Bridget McLaughlin for their insight and assistance with the flow cytometry studies, and Tad (Timothy) Doane for conducting the water quality analyses.

references

Aramini, J.J., Stephen, C., Dubey, J.P., Engelstoft, C., Schwantje, H., Ribble, C.S., 1999. Potential contamination of drinking water with Toxoplasma gondii oocysts. Epidemiology and Infection 122 (2), 305–315. Arkush, K.D., Miller, M.A., Leutenegger, C.M., Gardner, I.A., Packham, A.E., Heckeroth, A.R., Tenter, A.M., Barr, B.C., Conrad, P. A., 2003. Molecular and bioassay-based detection of Toxoplasma gondii oocyst uptake by mussels (Mytilus galloprovincialis). International Journal of Parasitology 33 (10), 1087–1097. Bahia-Oliveira, L.M., Jones, J.L., Azevedo-Silva, J., Alves, C.C., Orefice, F., Addiss, D.G., 2003. Highly endemic, waterborne toxoplasmosis in north Rio de Janeiro state, Brazil. Emerging Infectious Diseases 9 (1), 55–62. Benenson, M.W., Takafuji, E.T., Lemon, S.M., Greenup, R.L., Sulzer, A.J., 1982. Oocyst-transmitted toxoplasmosis associated with ingestion of contaminated water. New England Journal of Medicine 307 (11), 666–669. Boia, M.N., Carvalho-Costa, F.A., Sodre, F.C., Pinto, G.M., Amendoeira, M.R., 2008. Seroprevalence of Toxoplasma gondii infection among indian people living in Iauarete, Sao Gabriel

da Cachoeira, Amazonas, Brazil. Revista do Instituto de Medicina Tropical de Sa˜o Paulo 50 (1), 17–20. Borchardt, M.A., Spencer, S.K., Bertz, P.D., Ware, M.W., Dubey, J.P., Alan Lindquist, H.D. Concentrating Toxoplasma gondii and Cyclospora cayetanensis from surface water and drinking water by continuous separation channel centrifugation. Journal of Applied Microbiology, in press. Bowie, W.R., King, A.S., Werker, D.H., Isaac-Renton, J.L., Bell, A., Eng, S.B., Marion, S.A., 1997. Outbreak of toxoplasmosis associated with municipal drinking water. The BC Toxoplasma Investigation Team. Lancet 350 (9072), 173–177. Carme, B., Bissuel, F., Ajzenberg, D., Bouyne, R., Aznar, C., Demar, M., Bichat, S., Louvel, D., Bourbigot, A.M., Peneau, C., Neron, P., Darde, M.L., 2002. Severe acquired toxoplasmosis in immunocompetent adult patients in French Guiana. Journal of Clinical Microbiology 40 (11), 4037–4044. Dabritz, H.A., Gardner, I.A., Miller, M.A., Lappin, M.R., Atwill, E.R., Packham, A.E., Melli, A.C., Conrad, P.A., 2007a. Evaluation of two Toxoplasma gondii serologic tests used in a serosurvey of domestic cats in California. Journal of Parasitology 93 (4), 806–816. Dabritz, H.A., Miller, M.A., Atwill, E.R., Gardner, I.A., Leutenegger, C.M., Melli, A.C., Conrad, P.A., 2007b. Detection of Toxoplasma gondii-like oocysts in cat feces and estimates of the environmental oocyst burden. Journal of the American Veterinary Medical Association 231 (11), 1676–1684. Darde, M.L., Villena, I., Pinon, J.M., Beguinot, I., 1998. Severe toxoplasmosis caused by a Toxoplasma gondii strain with a new isoenzyme type acquired in French Guyana. Journal of Clinical Microbiology 36 (1), 324. de Moura, L., Bahia-Oliveira, L.M., Wada, M.Y., Jones, J.L., Tuboi, S.H., Carmo, E.H., Ramalho, W.M., Camargo, N.J., Trevisan, R., Graca, R.M., da Silva, A.J., Moura, I., Dubey, J.P., Garrett, D.O., 2006. Waterborne toxoplasmosis, Brazil, from field to gene. Emerging Infectious Diseases 12 (2), 326–329. Dubey, J.P., Miller, N.L., Frenkel, J.K., 1970. The Toxoplasma gondii oocyst from cat feces. Journal of Experimental Medicine 132 (4), 636–662. Dubey, J.P., Sreekumar, C., 2003. Redescription of Hammondia hammondi and its differentiation from Toxoplasma gondii. International Journal of Parasitology 33 (13), 1437–1453. Dubey, J.P., Jones, J.L., 2008. Toxoplasma gondii infection in humans and animals in the United States. International Journal of Parasitology 38 (11), 1257–1278. Dumetre, A., Darde, M.L., 2003. How to detect Toxoplasma gondii oocysts in environmental samples? FEMS Microbiology Reviews 27 (5), 651–661. Dumetre, A., Darde, M.L., 2005. Immunomagnetic separation of Toxoplasma gondii oocysts using a monoclonal antibody directed against the oocyst wall. Journal of Microbiological Methods 61 (2), 209–217. Dumetre, A., Darde, M.L., 2007. Detection of Toxoplasma gondii in water by an immunomagnetic separation method targeting the sporocysts. Parasitology Research 101 (4), 989–996. Dumetre, A., Le Bras, C., Baffet, M., Meneceur, P., Dubey, J.P., Derouin, F., Duguet, J.P., Joyeux, M., Moulin, L., 2008. Effects of ozone and ultraviolet radiation treatments on the infectivity of Toxoplasma gondii oocysts. Vet Parasitol 153, 209–213. Elsheikha, H.M., 2008. Congenital toxoplasmosis: priorities for further health promotion action. Public Health 122 (4), 335–353. Hill, V.R., Kahler, A.M., Jothikumar, N., Johnson, T.B., Hahn, D., Cromeans, T.L., 2007. Multistate evaluation of an ultrafiltration-based procedure for simultaneous recovery of enteric microbes in 100-liter tap water samples. Applied Environmental Microbiology 73 (13), 4218–4225. Hoar, B.R., Atwill, E.R., Farver, T.B., 2000. Estimating maximum possible environmental loading amounts of Cryptosporidum

water research 44 (2010) 893–903

parvum attributable to adult beef cattle. Quantitative Microbiology 2, 21–36. Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren, H., 2000. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. International Journal of Parasitology 30 (1), 69–75. Isaac-Renton, J., Bowie, W.R., King, A., Irwin, G.S., Ong, C.S., Fung, C.P., Shokeir, M.O., Dubey, J.P., 1998. Detection of Toxoplasma gondii oocysts in drinking water. Applied and Environmental Microbiology 64 (6), 2278–2280. Jones, J., Lopez, A., Wilson, M., 2003. Congenital toxoplasmosis. American Family Physician 67 (10), 2131–2138. Kuhn, R.C., Oshima, K.H., 2002. Hollow-fiber ultrafiltration of Cryptosporidium parvum oocysts from a wide variety of 10-L surface water samples. Canadian Journal of Microbiology 48 (6), 542–549. Kuticic, V., Wikerhauser, T., 1996. Studies of the effect of various treatments on the viability of Toxoplasma gondii tissue cysts and oocysts. Current Topics in Microbiology and Immunology 219, 261–265. Lindquist, H.D., Bennett, J.W., Hester, J.D., Ware, M.W., Dubey, J.P., Everson, W.V., 2003. Autofluorescence of Toxoplasma gondii and related coccidian oocysts. Journal of Parasitology 89 (4), 865–867. Lindsay, D.S., Dubey, J.P. Long-term survival of Toxoplasma gondii sporulated oocysts in seawater. Journal of Parasitology, in press. Lindsay, D.S., Upton, S.J., Dubey, J.P., 1999. A structural study of the Neospora caninum oocyst. International Journal of Parasitology 29 (10), 1521–1523. Morales-Morales, H.A., Vidal, G., Olszewski, J., Rock, C.M., Dasgupta, D., Oshima, K.H., Smith, G.B., 2003. Optimization of a reusable hollow-fiber ultrafilter for simultaneous concentration of enteric bacteria, protozoa, and viruses from water. Applied and Environmental Microbiology 69 (7), 4098–4102. Mortensen, P.B., Norgaard-Pedersen, B., Waltoft, B.L., Sorensen, T.L., Hougaard, D., Yolken, R.H., 2007. Early infections of Toxoplasma gondii and the later development of schizophrenia. Schizophrenia Bulletin 33 (3), 741–744. Palanisamy, M., Madhavan, B., Balasundaram, M.B., Andavar, R., Venkatapathy, N., 2006. Outbreak of ocular toxoplasmosis in Coimbatore, India. Indian Journal of Ophthalmology 54 (2), 129–131. Rajal, V.B., McSwain, B.S., Thompson, D.E., Leutenegger, C.M., Kildare, B.J., Wuertz, S., 2007a. Validation of hollow fiber

903

ultrafiltration and real-time PCR using bacteriophage PP7 as surrogate for the quantification of viruses from water samples. Water Research 41 (7), 1411–1422. Rajal, V.B., McSwain, B.S., Thompson, D.E., Leutenegger, C.M., Wuertz, S., 2007b. Molecular quantitative analysis of human viruses in California stormwater. Water Research 41 (19), 4287–4298. Schares, G., Herrmann, D.C., Beckert, A., Schares, S., Hosseininejad, M., Pantchev, N., Globokar Vrhovec, M., Conraths, F.J., 2008. Characterization of a repetitive DNA fragment in Hammondia hammondi and its utility for the specific differentiation of H. hammondi from Toxoplasma gondii by PCR. Molecular and Cellular Probes 22 (4), 244–251. Shapiro, K., Largier, J., Mazet, J.A., Bernt, W., Ell, J.R., Melli, A.C., Conrad, P.A., 2009. Surface properties of Toxoplasma gondii oocysts and surrogate microspheres. Applied and Environmental Microbiology 75 (4), 1185–1191. Simmons 3rd, O.D., Sobsey, M.D., Heaney, C.D., Schaefer 3rd, F.W., Francy, D.S., 2001. Concentration and detection of Cryptosporidium oocysts in surface water samples by method 1622 using ultrafiltration and capsule filtration. Applied and Environmental Microbiology 67 (3), 1123–1127. U.S.EPA., 2001. Method 1623: Cryptosporidium and Giardia in water by filtration/IMS/DFA. EPA-821-R-01-025, Office of Water, U.S. Environmental Protection Agency, Washington, D.C. Wainwright, K.E., Lagunas-Solar, M., Miller, M.A., Barr, B.C., Gardner, I.A., Pina, C., Melli, A.C., Packham, A.E., Zeng, N., Truong, T., Conrad, P.A., 2007a. Physical inactivation of Toxoplasma gondii oocysts in water. Applied and Environmental Microbiology 73 (17), 5663–5666. Wainwright, K.E., Miller, M.A., Barr, B.C., Gardner, I.A., Melli, A.C., Essert, T., Packham, A.E., Truong, T., Lagunas-Solar, M., Conrad, P.A., 2007b. Chemical inactivation of Toxoplasma gondii oocysts in water. Journal of Parasitology 93 (4), 925–931. Wallace, G.D., Frenkel, J.K., 1975. Besnoitia species (Protozoa, Sporozoa, Toxoplasmatidae): recognition of cyclic transmission by cats. Science 188 (4186), 369–371. Watson, R.J., Blackwell, B., 2000. Purification and characterization of a common soil component which inhibits the polymerase chain reaction. Canadian Journal of Microbiology 46 (7), 633–642. Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology 63 (10), 3741–3751. Yilmaz, S.M., Hopkins, S.H., 1972. Effects of different conditions on duration of infectivity of Toxoplasma gondii oocysts. Journal of Parasitology 58 (5), 938–939.