Detection rate of diarrhoea-causing Kudoa hexapunctata in Pacific bluefin tuna Thunnus orientalis from Japanese waters

International Journal of Food Microbiology 194 (2015) 1–6

Contents lists available at ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

Detection rate of diarrhoea-causing Kudoa hexapunctata in Pacific bluefin tuna Thunnus orientalis from Japanese waters Jun Suzuki a,⁎, Rie Murata a, Hiroshi Yokoyama b, Kenji Sadamasu a, Akemi Kai a a b

Division of Clinical Microbiology, Department of Microbiology, Tokyo Metropolitan Institute of Public Health, Japan Department of Aquatic Bioscience, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan

a r t i c l e

i n f o

Article history: Received 1 August 2014 Received in revised form 26 October 2014 Accepted 1 November 2014 Available online 7 November 2014 Keywords: Kudoa hexapunctata Thunnus orientalis Diarrhoea Detection rate Caco-2 cell

a b s t r a c t Diffuse outbreaks of food poisoning with unknown aetiologies leading to diarrhoea and vomiting within a short time after ingesting flatfish (Paralichthys olivaceus), tuna (Thunnus spp.), or amberjack (Seriola dumerili) have occurred nationwide in Japan, including the Tokyo metropolitan area. In this study, we surveyed the detection rates of kudoid parasites in 12 tuna samples that caused clinical diarrhoea from 2009 to 2012; we assessed 104 samples of whole juvenile Pacific bluefin tuna (PBT, Thunnus orientalis) and 153 block samples of other tuna distributed in the Tokyo Metropolitan Central Wholesale Market. The survey revealed that more than 70% of clinical diarrhoea cases due to tuna ingestion occurred between June and September, and Kudoa hexapunctata were detected in 9 of 12 tuna samples associated with clinical diarrhoea cases. The numbers of spores and 18S ribosomal DNA (rDNA) copies per gram of fish in 8 of 9 samples were more than 1 × 106 spores and 1 × 109 copies, respectively. Market research revealed that the K. hexapunctata-positive rate in juvenile PBT from Japanese waters was 64.4% (67/104) but that in adult PBT was 10.4% (7/67). The numbers of K. hexapunctata 18S rDNA copies in 64.5% (20/31) samples and 72.7% (16/22) of b5 kg fish samples collected between May and July were more than 1 × 109 copies/g. On the other hand, kudoid parasites were not detected from 73 tuna samples except for a single sample of Thunnus albacares. Cell monolayer permeability assays performed to examine the toxicity of K. hexapunctata against Caco-2 cells revealed that the transepithelial electrical resistance (TER) in 5 × 107 K. hexapunctata spores decreased by 80% within 2–4 h. In conclusion, K. hexapunctata was commonly detected in juvenile PBT from Japanese waters and are a likely cause of the diarrhoea outbreaks. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Kudoid parasites with four or more valves and polar capsules are myxosporean species that infect a wide variety of marine fishes (Moran et al., 1999). There are approximately 95 species included in Kudoa Meglitsch (1947) (Myxosporea: Multivalida) (Eiras et al., 2014). Most species of Kudoa are histozoic, forming cysts in somatic muscles and/or other organs including the brain, pericardium, and digestive tract (Blaylock et al., 2004; Burger et al., 2007; Maeno et al., 1993; Meng et al., 2011). Some species infect myofibres by forming pseudocysts. Several Kudoa spp. such as Kudoa thyrsites (Gilchrist, 1923) and Kudoa neothunni (Arai and Matsumoto, 1953) can cause significant losses in the seafood industry either through direct mortality or by spoiling fish meat, that is, the infection often presents as either unsightly spots dispersed in fish fillets or as post-mortem myoliquefaction known as ‘post-harvest soft flesh’ or ‘jelly meat’ (Kudo et al., 1987; Moran et al., 1999; Yokoyama et al., 2004). As the host fishes to Kudoa ⁎ Corresponding author at: Department of Microbiology, Tokyo Metropolitan Institute of Public Health, Shinjuku-ku, Tokyo 169-0073, Japan. Tel.: +81 3 3363 3231; fax: +81 3 3368 4060. E-mail address: [email protected] (J. Suzuki).

http://dx.doi.org/10.1016/j.ijfoodmicro.2014.11.001 0168-1605/© 2014 Elsevier B.V. All rights reserved.

islandica have been consumed for centuries in Iceland without any reports of food poisoning (Kristmundsson and Freeman, 2014), it is widely thought that the ingestion of fresh fish infected with Kudoa spp. is not usually harmful to human health. Recently, there have been diffuse nationwide outbreaks of food poisoning with an unknown cause leading to diarrhoea and vomiting within a short time after ingestion of ingesting flatfish (Paralichthys olivaceus), Pacific bluefin tuna (PBT) (Thunnus orientalis), or amberjack (Seriola dumerili), including within the Tokyo metropolitan area. The Ministry of Health, Labour, and Welfare asked local governments to report incidences after July 2009 to help identify the causes of these outbreaks. Epidemiologically, Kudoa septempunctata-infected flatfish were strongly suspected to be involved in the diarrhoea outbreaks. Scientifically, K. septempunctata as the aetiological agent of foodborne illness was demonstrated using Caco-2 cell monolayer permeability assays and suckling-mouse tests (Harada et al., 2012; Kawai et al., 2012). In June 2011, the Governors of prefectures were notified by the General of Department of Food Safety in the Ministry of Health, Labour, and Welfare, Japan that the transient diarrhoea and vomiting were caused by the ingestion of flatfish infected with K. septempunctata. However, K. septempunctata has not been reported in tuna, sea bream, or amberjack, and the etiological agent of food poisoning has not been

2

J. Suzuki et al. / International Journal of Food Microbiology 194 (2015) 1–6

identified in tuna, sea bream, or amberjack which appear to also be involved through ingestion of raw product. Recently, Kudoa hexapunctata detected in PBT was determined to be a separate species from K. neothunni based on differences in morphological characteristic and sequences of the 18S and 28S ribosomal DNAs (rDNAs) (Yokoyama et al., 2014b). In this study, we sought to clarify the connection between diarrhoeal and kudoid parasites in tunas by surveying the detection rates of kudoid parasites in tunas that were related to diarrhoea clinical cases in Tokyo, Japan.

Table 2 Detection of Kudoa hexapunctata from the somatic muscle of Thunnus spp. from 2009 to 2012 in Tokyo, Japan. Fish species

Origin

Thunnus orientalis (Pacific bluefin tuna), or Thunnus thynnus (Northern bluefin tuna)

Japan Ireland Italia Morocco Spain Canada USA Tunisia Chile Korea Australia Pacific Ocean Tahiti Indian Ocean Atlantic Ocean Spain Angola South Africa Peru Australia New Zealand Indian Ocean Atlantic Ocean South Africa Japan

2. Materials and methods 2.1. Fish samples related to clinical cases In the examinations of food samples for food poisoning, 12 tuna samples associated with transient diarrhoea and vomiting were examined: 9 fish samples of juvenile PBT, a sample of adult PBT, a sample of bigeye tuna (Thunnus obesus), and a sample of yellowfin tuna (YFT) Thunnus albacares (Table 1). No other foodborne pathogenic bacteria or viruses were detected in the stool samples of patients and foods with food poisoning.

Thunnus maccoyii (Southern bluefin tuna)

2.2. Wholesale market fish samples A total of 104 fish samples from whole juvenile PBT ranging in size from 1.5 to 12.7 kg with clearly identified origins were purchased from the Tokyo Metropolitan Central or Tama branch of the Wholesale Market in Japan between April 2011 and December 2013. The meat parts of 80 adult PBTs/Northern bluefin tuna (Thunnus thynnus), 43 YFTs, 21 T. obesus, and 9 Southern bluefin tunas (Thunnus maccoyii) were purchased from the same markets (Table 2). After the separation of the muscle and internal organs of juvenile PBT, six somatic muscle samples per fish were collected from the ventral, dorsal, and tail parts of the right and left sides of each fish for morphological and molecular examinations. The samples of the other above-mentioned four species of tuna were collected from two points in proportion. 2.3. Morphological characteristics Several pieces of tissue of PBT were flattened between two glass plates and observed under a dissecting microscope with transmitted light. Kudoa spores from fish somatic muscle tissue in wet mount preparations were observed microscopically at ×1000 magnifications. The Kudoa spores in fish somatic muscle were collected by mincing the fish muscle with surgical scissors in a 5 × volume of 1/15 mol/L

Table 1 Detection of Kudoa hexapunctata from juvenile and adult Pacific bluefin tuna (PBT), Thunnus orientalis and other tunas related to food poisoning cases from 2009 to 2012 in Tokyo, Japan. Collection month

Fish samples

Jun. Juvenile PBT Jun. Juvenile PBT Jun. Juvenile PBT Jun. Juvenile PBT Jul. Juvenile PBT Jul. Thunnus obesus Jul. Thunnus albacares Aug. Juvenile PBT Sep. Juvenile PBT Nov. Adult PBT Dec. Juvenile PBT Dec. Juvenile PBT Average of positive samples n.d.: not detected.

Thunnus obesus (bigeye tuna)

Microscopy

Real time PCR

No. of spores/g

Ave. Ct value

Ave. 18S rDNA copies/g

17.0 21.0 17.1 15.5 18.4 n.d. n.d. 20.3 15.4 n.d. 21.5 18.9 18.3

5.6 4.2 5.2 2.9 4.5 – – 5.3 1.6 – 1.5 1.9 7.7

8.1 × 7.2 × 9.4 × 4.2 × 7.4 × n.d. n.d. 9.8 × 4.9 × n.d. 2.0 × 2.6 × 1.5 ×

106 105 106 107 106

106 107 106 106 107

× × × × ×

109 108 109 1010 109

× 109 × 1010 × 109 × 109 × 109

Thunnus albacares (yellowfin tuna) Total

No. of fish samples

Positive no. by real-time PCR assay

67 3 1 3 1 1 2 1 1 2 6 15 3 2 6 1 3 4 1 5 5 3 2 6 9

7a 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1b

153

8

a

Avg. Ct values (mean ± SD) and avg. 18S rDNA copies in seven positive fish samples were 24.5 ± 2.6 and 1.4 × 108 copies/g of fish, respectively. b Ct values and 18S rDNA copies were 30.0 and 2.7 × 106 copies/g of fish, respectively.

phosphate buffer (PB, pH 7.2) and passed through a cell strainer (40-μm diameter) (BD Biosciences, Franklin Lakes, NJ, USA) and centrifuged at 600 ×g for 5 min. The collected Kudoa spores were examined microscopically at a magnification of × 400. The description and measurements of spores were performed according to previously reported methods (Adlard et al., 2005; Lom and Arthur, 1989). Moreover, the spore samples were observed by low-vacuum scanning electron microscopy (LV-SEM), according to a previously reported method (Yokoyama et al., 2014b).

2.4. DNA preparation and real-time polymerase chain reaction DNA was isolated from 50-mg fish samples using a QIAamp DNA Mini kit (Qiagen, Venlo, The Netherlands). The 18S or 28S rDNA sequence of Kudoa was targeted for real-time polymerase chain reaction (PCR) assays. The primers and probe set (KuRT-F, KuRT-R, and KuRTP; Table 3) as a universal primer and probe for 18S rDNA of kudoid parasites was designed with Primer Express v. 2.0 (Applied Biosystems, Foster City, CA, USA), and the Taqman® minor groove binding (MGB) probe was used. The DNA samples were amplified using two previously reported primers and probe sets (PBT-F, PBT-R, and PBT-P for K. hexapunctata 28S rDNA; YFT-F, YFT-R, and YFT-P for K. neothunni 28S rDNA; Table 3) (Yokoyama et al., 2014b), and these samples were verified to be K. hexapunctata. Real-time PCR was performed in a final volume of 50 μL containing Universal Master Mix (Applied Biosystems), 900 nM each of KuRT-F and KuRT-R primers, 250 nM Taqman MGB probe (KuRT-P), and 4 μL DNA template. PCR reactions were analysed with an Applied Biosystems 7900HT Fast Real Time PCR System under the following conditions; 2 min at 50 °C and 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Gene copy quantity was determined using the standard curve method with a plasmid DNA control template (Yokoyama et al., 2014b).

J. Suzuki et al. / International Journal of Food Microbiology 194 (2015) 1–6 Table 3 Oligonucleotide primers used for real-time polymerase chain reaction assays. Primer name

Primer sequence (5′ to 3′)

Position

Accession no.

KuRT-F KuRT-R KuRT-P PBT-F PBT-R PBT-P YFT-F YFT-R YFT-P

TGGTGCATGGCCGTTCTTA CTCGCTCGTTACCGGAATAAA TTGGTGGAGTGATCTGT GGCTAGTGAAAAGCCAACTTATGG TTCGCGGATTCCAACCTATT CACTTGTGTGGCTAAAT GCCAACTTATGGTCGCACTGT TTCCCTTTCGCGGATTCC TGTGGCTGGATATAGGT

1167–1185 1208–1228 1178–1203 1588–1611 1634–1653 1615–1631 1600–1620 1640–1657 1622–1638

AB902954 AB902954 AB902954 AB902955 AB902955 AB902955 AB902959 AB902959 AB902959

(Forward) (Reverse) (Probe) (Forward) (Reverse) (Probe) (Forward) (Reverse) (Probe)

2.5. PCR and sequence analysis PCR amplification of the DNA samples identified as Kudoa 18S rDNA by real-time PCR assay was performed using previously reported primer sets targeting the genes for the small and large subunits of ribosomal rDNA (18S and 28S rDNA, respectively) (Yokoyama et al., 2014b). The PCR products of the 18S and 28S rDNA of Kudoa isolated from fish samples were sequenced using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction kit (Applied Biosystems) and an ABI PRISM 3130 Genetic Analyzer.

2.6. Cell monolayer permeability assay using Caco-2 cells The spores were prepared using a method previously reported by Yokoyama et al. (2014a). For differentiation, the parasite suspension was placed onto a 25%/50% Percoll gradient solution, and centrifuged at 2190 ×g for 30 min. The resulting pellets were washed and centrifuged at 400 ×g for 15 min, then re-suspended in phosphate-buffered saline (PBS). The human colon adenocarcinoma cell line Caco-2 (European Collection of Cell Cultures [ECACC] 86010202) was cultured in Eagle's minimal essential medium (MEM; Nissui Pharmaceutical, Tokyo, Japan) supplemented with 2 mM glutamine (MP Biomedical, Santa Ana, CA, USA) 10% foetal bovine serum (GIBCO/Life Technologies, Carlsbad, CA, USA), and 1% non-essential amino acids (GIBCO) at 37 °C in 5% CO2 for use in monolayer permeability assays. The method for the assay was provided with the Biocoat HTS Caco-2 Assay System (BD Biosciences). For differentiation, Caco-2 cells were suspended in MEM medium. The Caco-2 cells were then seeded at 2 × 105 cells/well in the Biocoat cell culture insert and incubated at 37 °C in 5% CO2 for 1 day. After 24 h, the culture medium was replaced with the assay kit's Basal Seeding Medium and incubated for 24 h. The integrity of the confluent polarised Caco-2 cell monolayer was checked by measuring transepithelial electrical resistance (TER) with an epithelial volt–ohm-milliammeter (World Precision Instruments, Sarasota, FL, USA). The TER showed more than 1000 Ω cm2 in the cell insert well; spores of K. hexapunctata (5 × 107, 5 × 106 and 5 × 105 spores/well), spores of K. hexapunctata (5 × 107

3

spores/well) frozen for 24 h, and K. septempunctata (1 × 106 spores/ well) were used as positive controls suspended in enterocyte differentiation medium with MITO and serum expander from the Caco-2 assay system. Each Kudoa spore sample was examined in three wells, inoculated in each cell insert, and the TER was measured every 60 min. 3. Results 3.1. Morphological characteristics of spores of Kudoa from PBT In the dissecting microscopic examination, the Kudoa pseudocysts were observed in specimen of muscle tissue (Fig. 1A). In the wet-mount preparations and LV-SEM image of the Kudoa spore, suture lines were visible between valves, and shell distal margins were smoothly rounded. Pyriform polar capsules were located in the anterior portion of the shell valves (Fig. 1B and C). The mean ratio of suture width to spore width was more than 70%. The spore dimensions were width, 8.0–11.2 μm; length, 6.0–8.2 μm; polar capsule length, 2.2–3.9 μm; and polar capsule width, 1.4–2.1 μm. These Kudoa morphologies were consistent with those previously reported for K. hexapunctata (Yokoyama et al., 2014b). 3.2. Detection of K. hexapunctata from tunas related to clinical cases More than 70% of clinical diarrhoea cases caused by tuna ingestion occurred between June and September. Microscopic and molecular exanimations revealed kudoid parasites in 75.0% (9/12) of tuna samples related to clinical diarrhoea cases, and all positive samples were juvenile PBTs. Jelly meat was not identified in the 9 K. hexapunctata positive tuna samples. With regard to the nine positive samples, the 18S and 28S rDNA sequences of kudoid parasites were identical with those of K. hexapunctata (AB902954 for 18S rDNA, AB902955 for 28S rDNA). The numbers of spores and 18S rDNA copies per gram of fish were 106 spores and 109 copies, respectively (Table 1). 3.3. Prevalence of K. hexapunctata from tunas in the market In the molecular examinations of 153 samples of tuna purchased from the Tokyo central market, K. hexapunctata was detected in seven samples of adult PBTs and one sample of YFT from Japanese waters (Table 2). The numbers of K. hexapunctata 18S rDNA copies in the seven PBTs and one YFT were 1.4 × 108 copies/g and 2.7 × 106 copies/g, respectively (Table 2). In 104 juvenile PBT samples from the Tokyo Metropolitan Central Wholesale Market, K. hexapunctata was detected in 64.4% (67/104) of juvenile PBT. In the microscopic examination of all realtime PCR-positive samples, K. hexapunctata was observed in the fish somatic muscles as translucent pseudocysts (Fig. 1), and jelly meat was not identified in the totally 75 K. hexapunctata positive tuna samples of 67 juvenile PBTs and seven PBTs and one YFT. The sequence analysis results of all positive PBT, YFT, and juvenile PBT revealed 18S and 28S rDNA sequences that were identical with the above-mentioned K. hexapunctata sequence.

Fig. 1. Kudoa hexapunctata pseudocysts in the somatic muscle of juvenile Pacific bluefin tuna (PBT) Thunnus orientalis and K. hexapunctata spore by wet mount preparations and lowvacuum scanning electron microscopy (LV-SEM). A: Arrows indicate K. hexapunctata pseudocysts in somatic muscle of juvenile PBT, bar: 1.0 mm. B: Phase contrast micrograph of K. hexapunctata spore with ×1000 magnification, bar: 10 μm. C: K. hexapunctata spore by LV-SEM with ×4000 magnification, bar: 2.0 μm.

4

J. Suzuki et al. / International Journal of Food Microbiology 194 (2015) 1–6

Table 4 Detection of Kudoa hexapunctata from juvenile Pacific bluefin tuna, Thunnus orientalis, by real-time PCR assay. Month

Jan. Feb. Apr. May Jun. Jul. Aug. Sep. Oct. Nov. Dec. Total

No. of fish samples

7 6 3 6 13 12 12 5 7 15 18 104

Positive no. (%)

3 (42.9) 4 (66.7) 2 (66.7) 6 (100) 11 (84.6) 11 (91.7) 8 (66.7) 4 (80.0) 4 (57.1) 6 (40.0) 8 (44.4) 67 (64.4)

Positive no. more than 109 copies/g in each examined 6 points of fish (%) 1 (14.3) 2 (33.3) 1 (33.3) 4 (66.7) 8 (61.5) 8 (66.7) 5 (41.7) 1 (20.0) 2 (28.6) 2 (13.3) 3 (16.7) 37 (35.6)

Ave. K. hexapunctata 18S rDNA copies/g

6.9 3.7 8.5 3.5 2.5 5.2 1.9 2.7 1.3 4.4 1.1 2.1

× × × × × × × × × × × ×

10 109 108 109 109 109 109 109 109 108 109 109

3.4. Cell monolayer permeability assay Cell monolayer permeability assays were performed to assess the toxicity of K. hexapunctata and K. septempunctata in Caco-2 cells. The TER in wells containing 5 × 107 spores/well K. hexapunctata spores decreased by 80% from 2 to 4 h, whereas it did not clearly decrease in wells with 105 or 106 spores or freeze-thawed K. hexapunctata spores (Fig. 2). As Ohnishi et al. (2013) previously reported, K. septempunctata rapidly decreased TER by 80% within 1 h. 4. Discussion The morphologically different Kudoa spores in different species of fish have been shown to have identical 18S and 28S rDNA sequences, demonstrating a conflict between morphological and molecular data Table 5 Detection of Kudoa hexapunctata in juvenile Pacific bluefin tuna, Thunnus orientalis, according to weight collected from May to July. Fish weight range

Month

No. of fish samples

No. of positive samples

Positive no. of N109 copies/g (%)

b5 kg

May Jun. Jul. May Jun. Jul.

5 10 7 1 3 5 31

5 9 7 1 2 4 28

3 (60.0) 8 (80.0) 5 (71.4) 1 (100) 0 (0) 3 (60.0) 20 (64.5)

Total

Tested fish parts (no. of tested: 58)

Ventral meat

Dorsal meat

Tail meat

Right side of fish Ave. Ct values ± SD Ave. 18S rDNA copies/g

19.71 ± 2.46 4.4 × 109

20.70 ± 3.07 3.2 × 109

20.14 ± 2.75 3.4 × 109

Left side of fish Ave. Ct values ± SD Ave. 18S rDNA copies/g

19.77 ± 2.77 4.7 × 109

20.31 ± 2.97 3.4 × 109

19.88 ± 2.24 3.4 × 109

8

The numbers of 18S rDNA copies/g in eight of nine juvenile PBT samples associated with clinical diarrhoea cases were more than 1 × 109. In the survey of juvenile PBT, the detection rates for May, June, and July were 100% (6/6), 84.6% (11/13), and 91.7% (11/12), and the positive rates of N109 copies/g in the same months were 66.7% (4/6), 61.5% (8/13), and 61.5% (8/12), respectively (Table 4). Moreover, in juvenile PBT samples (b5 kg fish) collected from May to July, N 109 K. hexapunctata 18S rDNA copies were detected in 72.7% (16/22) of fish samples (Table 5). On the other hand, the average positive rate from November to January and the percentage of K. hexapunctata 18S rDNA copies of N109 were 42.5% (17/40) and 15.0% (6/40), respectively (Table 4). In the total distribution of 67 K. hexapunctata-positive juvenile PBT samples, 58 fish samples did not have significant differences between K. hexapunctata 18S rDNA copies/g fish muscle in 6 points (Table 6). However, nine fish samples with weights of 7 kg or more had significant differences between 18S rDNA copies/g fish muscle of K. hexapunctata in six points (Table 7).

N5 kg

Table 6 The distributions of Kudoa hexapunctata detected from six examined points in juvenile Pacific bluefin tuna, Thunnus orientalis.

(Diamant et al., 2005; Holzer et al., 2006; Whipps and Kent, 2006). Kudoa species with six polar capsules, such as K. hexapunctata in juvenile PBT, include K. neothunii (morphologically, most similar to K. hexapunctata) in YFT and also K. scomberomori, K. grammatorcyni, and K. scomberi detected in Scomberomorus commerson (Spanish mackerel), Grammatorcynus bicarinatus (shark mackerel), and Scomber japonicus (chub mackerel), respectively. Like tuna, these fish belong to Scombridae (Adlard et al., 2005; Li et al., 2013). However, except for K. septempunctata from flatfish and K. hexapunctata from juvenile PBT, there were no reports of kudoid parasites detected in patient vomit or stool samples or leftover fish samples associated with acute diarrhoea cases in Tokyo. Several species of kudoids such as K. thyrsites, Kudoa hypoepicardialis, and Kudoa amamiensis are known to infect a number of unrelated fish hosts (Blaylock et al., 2004; Burger et al., 2008; Whipps et al., 2004), but we only detected K. hexapunctata from PBT and YFT in Japanese waters. The distribution of K. hexapunctata in somatic muscle of juvenile PBT weighing b5 kg was homogeneous, but the K. hexapunctata-positive rate in adult PBT from Japanese waters was 10.4% (7/67), which was markedly lower than that in juvenile PBT (64.4% [67/104]). The test results of residual juvenile PBT in food-poisoning episodes were mostly consistent with the number of parasitic K. hexapunctata per gram of fish. A period of the positive rates of N 109 copies/g in a year were from May to July, and the requests for testing related to acute diarrhoea after tuna ingestion increased in June and July. Moreover, based on oral consultations of the health centre staff members in Tokyo, it was clear that the incubation time of food poisoning cases following P. olivaceus consumption is approximately 3 h shorter than for juvenile PBT (Fig. 3). The Caco-2 cell line assay has been widely used as an in vitro model for intestinal transport and enterotoxin studies (Guarino et al., 1995; Nath and Desjeux, 1990), and the incubation period correlated with the results of these assays (the time lag until the TER across the Caco-2 cell monolayer decreased to 80%). A previous study reported that the average spore number of K. septempunctata in an epidemiologic survey of foodborne outbreaks from 2009 to 2010 was 2.4 × 106 spores/g, and N106 spores/mouse were required to induce diarrhoea in mice (Kawai et al., 2012). In our screening of K. hexapunctata using Caco-2, the spore number required

Table 7 The distribution of the real-time PCR Ct values in the fish samples showed a significant difference in the quantities of Kudoa hexapunctata 18S rDNA. Month

Mar. Apr. Aug. Aug. Sep. Sep. Nov. Nov. Dec.

Fish weight

Ct values of right side of fish

Ct values of left side of fish

(kg)

Ventral

Dorsal

Tail

Ventral

Dorsal

Tail

8.6 12.2 7.5 8.4 9.2 11.4 7.9 8.5 10.1

28.9 n.d. n.d. n.d. n.d. n.d. 26 n.d. 23.8

n.d. n.d. n.d. 28.4 28.2 n.d. n.d. 26 22.5

n.d. 24.3 n.d. n.d. 26.6 18.7 23.8 19.5 n.d.

n.d. n.d. 21.9 n.d. n.d. n.d. n.d. 19.6 23.4

n.d. n.d. 22.5 28.1 n.d. n.d. n.d. 23.8 21.1

n.d. 22.4 n.d. 29.4 17.2 18.4 24.4 21.7 n.d.

n.d.: not detected.

J. Suzuki et al. / International Journal of Food Microbiology 194 (2015) 1–6

Kudoa hexapunctata 5 x 107 spores/well Frozen K. hexapunctata

TER (%)

5 x 107 spores/well

local governments have conducted research into K. septempunctata in flatfish; however, no studies have assessed food poisoning cases thought to be caused by other fish species. Therefore, investigation into the food poisoning cases caused by the ingestion of tuna and other fish is needed.

K. hexapunctata 5 x 106 spores/well K. hexapunctata 5 x 105 spores/well Kudoa sptempunctata 1 x 106 spores/well Negative control

Incubation time (hour)

Acknowledgements We are very grateful to Mr. Toshiyuki Kinugasa, Mr. Yutaka Sasaki and the staff of the Tokyo Metropolitan Institute of Public Health, Tama Branch Institute, for providing the fish samples.

References

Fig. 2. Increased permeability across the Caco-2 cell monolayer induced by Kudoa hexapunctata and Kudoa septempunctata spores. The transepithelial electrical resistance (TER) was measured for 5 h, with TER at time 0 represented as 100%. Each value is the mean ± SD of three wells containing the same number of spores.

to decrease TER was N107 spores/well, which is approximately 10 times that of K. septempunctata. The number of spores/g in five of nine food poisoning cases in Tokyo was more than 8 × 106 spores. As a reference, we intragastrically inoculated three suckling mice with 4 × 107 spores/ mouse or PBS (negative control), respectively, according to a previously reported method (Kawai et al., 2012). We then assessed the fluid accumulation (FA) ratio and observed a significant difference (P b 0.006) between the FA ratio of the Kudoa-treated mice (mean ± SD: 0.063 ± 0.001) and the negative control (0.052 ± 0.001) within 2.5 h. Approximately 95 Myxosporea species have been identified in the genus Kudoa to date. However, the invertebrate host for Kudoidae is unknown, and consequently, the morphology of actinospores within this life stage are also unknown. Flatfish parasitized by K. septempunctata are mainly cultured, and a screening system for K. septempunctata in the production step is currently being devised. In contrast, it may be difficult to control Kudoa infection of natural fish, such as juvenile PBT. The K. hexapunctata-positive rate and number in tuna other than juvenile PBT were low, no K. hexapunctata was detected in the residual food of clinical diarrhoea cases by ingestion of tunas, and TER of freezethawed K. hexapunctata was not decreased in Caco-2 cell assays. The frozen distribution of juvenile PBT b 5 kg from May to July may be necessary to prevent acute diarrhoea outbreaks. Since Because K. septempunctata in flatfish was specified as the food poisoning substance by the Ministry of Health, Labour, and Welfare, Japan in 2011, 25

20

Incidence rate (%)

5

15

10

5

0

> 17

15-16

14-15

13-14

12-13

11-12

10-11

9-10

8-9

7-8

6-7

5-6

4-5

3-4

2-3

1-2

<1

Incubation time (hour) Fig. 3. Comparison of incubation times in the causative agent of food poisoning in humans between the ingestion of olive flounder Paralichthys olivaceus and juvenile Pacific bluefin tuna Thunnus orientalis between 2011 and 2012, as reported by the Tokyo Metropolitan Government. □: P. olivaceus, ■: T. orientalis.

Adlard, R.D., Bryant, M.S., Whipps, C.M., Kent, M.L., 2005. Multivalvulid myxozoans from Eastern Australia: three new species of Kudoa from scombrid and labrid fishes of the Great Barrier Reef, Queensland, Australia. J. Parasitol. 91, 1138–1142. Arai, Y., Matsumoto, K., 1953. On a new sporozoa, Hexacapsula neothunni gen. et sp. nov., from the muscle of yellowfin tuna, Neothunnus macropterus. Bull. Jpn. Soc. Sci. Fish. 18, 293–298. Blaylock, R.B., Bullard, S.A., Whipps, C.M., 2004. Kudoa hypoepicardialis n. sp. (Myxozoa: Kudoidae) and associated lesions from the heart of seven perciform fishes in the northern Gulf of Mexico. J. Parasitol. 90, 584–593. Burger, M.A.A., Cribb, T.H., Adlard, R.D., 2007. Patterns of relatedness in the Kudoidae with descriptions of Kudoa chaetodoni n. sp. and K. lethrini n. sp. (Myxosporea: Multivalvulida). Parasitology 134, 669–681. Burger, M.A.A., Barnes, A.C., Adlard, R.D., 2008. Wildlife as reservoirs for parasites infecting commercial species: host specificity and a redescription of Kudoa amamiensis from teleost fish in Australia. J. Fish Dis. 31, 835–844. Diamant, A., Ucko, M., Paperna, I., Colorni, A., Lipshitz, A., 2005. Kudoa iwatai (Myxosporea: Multivalvulida) in wild and cultured fish in the Red Sea: redescription and molecular phylogeny. J. Parasitol. 91, 1175–1189. Eiras, J.C., Saraiva, A., Cruz, C., 2014. Synopsis of the species of Kudoa Meglitsch, 1947 (Myxozoa: Myxosporea: Multivalvulida). Syst. Parasitol. 87, 153–180. Gilchrist, J.D.F., 1923. A protozoal parasite (Chloromyxum thyrsites sp. n.) of the cape seafish, the “snoek” (Thyrsites atun, Euphr.). Trans. R. Soc. S. Afr. 11, 263–273. Guarino, A., Canani, R.B., Casola, A., Pozio, E., Russo, R., Bruzzese, E., Fontana, M., Rubino, A., 1995. Human intestinal cryptosporidiosis: secretory diarrhoea and enterotoxic activity in Caco-2 cells. J. Infect. Dis. 171, 976–983. Harada, T., Kawai, T., Sato, H., Yokoyama, H., Kumeda, Y., 2012. Development of a quantitative polymerase chain reaction assay for detection of Kudoa septempunctata in olive flounder (Paralichthys olivaceus). Int. J. Food Microbiol. 156, 161–167. Holzer, A.S., Blasco-Costa, I., Sarabeev, V.L., Ovcharenko, M.O., Balbuena, J.A., 2006. Kudoa trifolia sp. n. — molecular phylogeny suggests a new spore morphology and unusual tissue location for a well-known genus. J. Fish Dis. 29, 743–755. Kawai, T., Sekizuka, T., Yahata, Y., Kuroda, M., Kumeda, Y., Iijima, Y., Kamata, Y., SugitaKonishi, Y., Ohnishi, T., 2012. Identification of Kudoa septempunctata as the causative agent of novel food poisoning outbreaks in Japan by consumption of Paralichthys olivaceus in raw fish. Clin. Infect. Dis. 54, 1046–1052. Kristmundsson, A., Freeman, M.A., 2014. Negative effects of Kudoa islandica n. sp. (Myxosporea: Kudoidae) on aquaculture and wild fisheries in Iceland. Int. J. Parasitol. Parasite Wildl. 3, 135–146. Kudo, G., Barnett, H.J., Nelson, R.W., 1987. Factors affecting cooked texture quality of Pacific whiting, Merluccius productus, fillets with particular emphasis on the effect of infection by the myxosporeans Kudoa paniformis and K. thyrsites. Fish. Bull. 85, 745–755. Li, Y.C., Sato, H., Tanaka, S., Ohnishi, T., Kamata, Y., Sugita-Konishi, Y., 2013. Characterization of the ribosomal RNA gene of Kudoa neothunni (Myxosporea: Multivalvulida) in tunas (Thunnus spp.) and Kudoa scomberi n. sp. in a chub mackerel (Scomber japonicus). Parasitol. Res. 112, 1991–2003. Lom, J., Arthur, J.R., 1989. A guideline for the preparation of species descriptions in Myxosporea. J. Fish Dis. 12, 151–156. Maeno, Y., Nagasawa, K., Sorimachi, M., 1993. Kudoa intestinalis n. sp. (Myxosporea: Multivalvulida) from the intestinal musculature of the striped mullet, Mugil cephalus, from Japan. J. Parasitol. 79, 190–192. Meng, F., Yokoyama, H., Shirakashi, S., Grabner, D., Ogawa, K., Ishimaru, K., Sawada, Y., Murata, O., 2011. Kudoa prunusi n. sp. (Myxozoa: Multivalvulida) from the brain of Pacific bluefin tuna Thunnus orientalis (Temminck & Schlegel, 1844) cultured in Japan. Parasitol. Int. 60, 90–96. Moran, J.D.W., Whitaker, D.J., Kent, M.L., 1999. A review of the myxosporean genus Kudoa Meglitsch, 1947, and its impact on the international aquaculture industry and commercial fisheries. Aquaculture 172, 163–196. Nath, S.K., Desjeux, J.F., 1990. Human intestinal cell lines as in vitro tools for electrolyte transport studies with relevance to secretory diarrhoea. J. Diarrhoeal Dis. Res. 8, 133–142. Ohnishi, T., Kikuchi, Y., Furusawa, H., Kamata, Y., Sugita-Konishi, Y., 2013. Kudoa septempunctata invasion increases the permeability of human intestinal epithelial monolayer. Foodborne Pathog. Dis. 10, 137–142. Whipps, C.M., Kent, M.L., 2006. Phylogeography of the cosmopolitan marine parasite Kudoa thyrsites (Myxozoa: Myxosporea). J. Eukaryot. Microbiol. 53, 364–373.

6

J. Suzuki et al. / International Journal of Food Microbiology 194 (2015) 1–6

Whipps, C.M., Grossel, G., Adlard, R.D., Yokoyama, H., Bryant, M.S., Munday, B.L., Kent, M.L., 2004. Phylogeny of the Multivalvulida (Myxozoa: Myxosporea) based on comparative ribosomal DNA sequence analysis. J. Parasitol. 90, 618–622. Yokoyama, H., Whipps, C.M., Kent, M.L., Mizuno, K., Kawakami, H., 2004. Kudoa thyrsites from Japanese flounder and Kudoa lateolabracis n. sp. from Chinese sea bass: causative myxozoans of postmortem myoliquefaction. Fish Pathol. 39, 79–85.

Yokoyama, H., Abe, N., Maehara, T., Suzuki, J., 2014a. First record of Unicapsula seriolae (Myxozoa: Multivalvulida) from the muscle of Malabar grouper Epinephelus malabaricus in Japan. Parasitol. Int. 63, 561–566. Yokoyama, H., Suzuki, J., Shirakashi, S., 2014b. Kudoa hexapunctata n. sp. (Myxozoa: Multivalvulida) from the somatic muscle of Pacific bluefin tuna Thunnus orientalis and re-description of K. neothunni in yellowfin tuna T. albacares. Parasitol. Int. 63, 571–579.